A novel potassium channel encoded by Ectocarpus siliculosus virus

BBRC Biochemical and Biophysical Research Communications 326 (2005) 887–893 www.elsevier.com/locate/ybbrc

A novel potassium channel encoded by Ectocarpus siliculosus virusq Jun Chen*, Steven C. Cassar, Di Zhang, Murali Gopalakrishnan Neuroscience Research, Global Pharmaceutical Research and Development, Abbott Laboratories, Abbott Park, IL 60064-6125, USA Received 18 November 2004 Available online 8 December 2004

Abstract Kcv, the first identified viral potassium channel encoded by the green algae Paramecium bursaria chlorella virus (PBCV-1), conducted K+ selective currents when expressed in heterologous systems. This K+ channel was proposed to be important for PBCV-1 infection and replication. In the present study, we identified and functionally characterized a novel K+ channel Kesv, encoded by Ectocarpus siliculosus virus that infects filamentous marine brown algae. Kesv encodes a protein of 124 amino acids and is 21.8% identical and 37.1% homologous to Kcv. Membrane topology programs predicted that Kesv consists of three transmembrane domains. When expressed in Xenopus oocytes, Kesv induced largely instantaneous, K+ selective currents that were sensitive to block by Ba2+ and amantadine. Thus, Kesv along with Kcv, constitutes an emerging family of viral potassium channels, which may play important roles in the life cycle of viruses. Ó 2004 Elsevier Inc. All rights reserved. Keywords: Potassium channel; Ectocarpus siliculosus virus; Paramecium bursaria chlorella virus; Viral life cycle

Potassium channels have been described in living cells across a wide range of organisms including animals, plants, yeast, and bacteria [1]. These channels control potassium flow across cell membrane and participate in a multitude of physiological functions, including modulation of neuronal excitability, cardiac rhythm, hormonal release, K+ uptake, and cell volume regulation. Common to all known potassium channels is a conserved ‘‘signature sequence’’ viz. (T/S)XX(T/S) XG(Y/F)G [2], which determines potassium selectivity in the tetrameric channel structure. Although K+ channels from animal and plant kingdoms have been most extensively studied and relatively well understood, the existence and physiological functions of potassium channels encoded by viruses are only beginning to emerge. q Abbreviations: PBCV-1, Paramecium bursaria chlorella virus; EsV-1, Ectocarpus siliculosus virus; TM, transmembrane domain; cRNA, complementary RNA. * Corresponding author. Fax: +1 847 937 9195. E-mail address: [email protected] (J. Chen).

0006-291X/$ - see front matter Ó 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2004.11.125

The first viral K+ channel identified, Kcv, is encoded by Paramecium bursaria chlorella virus (PBCV-1), a plaque-forming dsDNA virus that infects freshwater green algae [3–5]. Kcv consists of 94 amino acids with two transmembrane domains (TM), and when expressed in Xenopus oocytes, HEK-293 or CHO cells yielded robust K+ selective currents sensitive to block by Ba2+. Kcv channels could also be inhibited by amantadine, an antiviral agent known to block the influenza virus M2 channel [3,6]. The physiological functions of Kcv are less clearly understood, although limited analysis with nonselective pharmacological tools suggested that Kcv function is required at certain stages during the life cycle of the virus. For example, it was demonstrated that the plaque-forming ability of chlorella virus can be inhibited by amantadine at concentrations comparable to that required for blocking Kcv channel activity [3]. A model for Kcv channel function was proposed recently by Mehmel et al. [7], wherein upon membrane fusion of the host and PBCV-1 viron particle, Kcv channels are inserted into the host membrane and enable potassium outflow and membrane depolarization. The change in

888

J. Chen et al. / Biochemical and Biophysical Research Communications 326 (2005) 887–893

membrane potential and decrease in host cell turgor pressure consequentially lead to entry of the viral genome and proteins into the host cell. Given the role of Kcv in the replication of chlorella virus, the question arises as to whether other viruses also adopt a similar strategy for their replication. The present study was directed towards the identification of novel viral K+ channels. By searching GenBank, we identified a viral K+ channel Kesv encoded by Ectocarpus siliculosus virus (EsV-1), a member of the Phaeovirus family which infects filamentous marine brown algae [8]. When expressed in Xenopus oocytes, Kesv formed ion channels that conducted K+ selective currents with biophysical and pharmacological properties largely comparable to those of Kcv. The emerging family of K+ channels including Kcv and Kesv implicates that viruses could utilize K+ channel function as an underlying mechanism for replication.

Materials and methods Molecular biology. A BLAST search of the GenBank database using KcsA and other K+ channels as bait [9] and a text search of the completed viral genomes identified Kesv, a putative K+ channel from the brown algal E. siliculosus virus (GenBank NP_077708). To construct the coding sequence of Kesv, the following oligonucleotides were synthesized and used for PCRs: ATCAGATCTATGTCCCGGCGACTGTTTGCGACTTGCGGCA TCGCTATCGCGCTCAGAGGACTGGTGGTGAGCGGAGGCG TAAAA (1F); AGCGGAGGCGTAAAAGAGATTGTATCGTTCAGGCCACTG ATTGATACTTCGCTCGTCGGCGGAATATTGTCTAATCTGAT TTTG (2F); CAAGGAGATGATCACACACACTTCGGCTTCTCGTCCGCGA TCGACGCTTACTACTTCAGTGCGGTCACGTCT TCCTCTGTC (3F); AGA ACT AGT CTA CTT CTC GAG AGC CTT CGC GAC AAC AGG GAG CAT CAC GAA GAA CAT GGC CAA AAT GTG TGC GAT GGT AAG (1A); GAA GTG TGT GTG ATC ATC TCC TTG GTC CAG CTG CCA ATA AAG TTC AGC GAA AAC GAC GAG CAA AAT CAG ATT AGA CAA TAT TCC (2A); GTG TGC GAT GGT AAG CAA TTT TGC CTT CGG AGT TTT CGG CAA CAA ATC GCC GTA TCC GAC AGA GGA AGA CGT GAC CGC ACT (3A). Kesv coding sequence was constructed in two PCR steps by using platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA): in the first step, 1 pmol each of 2F, 2A, 3F, and 3A were mixed in a 50 ll reaction, and 10 cycles of amplification were performed. In the second step, 10 ll reaction from the first step PCR was used as template, and 1F/1A were used as PCR primers. Four silent mutations were introduced into the coding sequence to facilitate PCR amplification, including G48A, G66A, G186A, and C348T. PCR fragments were purified from agarose gel, digested with BglII/SpeI, and subcloned into an oocyte expression vector pT7TS [10]. Mutations in the selectivity filter of Kesv channels (Y89A, G88A/ Y89A/G90A) were introduced by using a site-directed mutagenesis approach as described previously [11]. Before use in expression experiments, all constructs were confirmed by restriction mapping and DNA sequence analyzes. Complementary RNA (cRNA) for injection

into oocytes was prepared with T7 Message Machine (Ambion, Austin, TX) after linearization with EcoRI. RNA quality was routinely confirmed by gel electrophoresis. Oocyte injection and two electrode voltage-clamp. Stage IV and V Xenopus laevis oocytes were isolated and injected with 60 ng cRNA encoding WT or mutant Kesv channels. Oocytes were cultured in BarthÕs solution supplemented with 50 lg/ml gentamicin and 1 mM pyruvate at 14 °C for 2–6 days before use. BarthÕs solution contained (in mM): 88 NaCl, 1 KCl, 0.4 CaCl2, 0.33 Ca(NO3)2, 1 MgSO4, 2.4 NaHCO3, and 10 Hepes (pH 7.4). For voltage-clamp experiments, unless otherwise mentioned, oocytes were bathed in a modified OR2 solution containing (in mM): 42.5 NaCl, 50 KCl, 1 MgCl2, 2.5 CaCl2, and 5 Hepes (pH 7.4). Currents were recorded at room temperature (23–25 °C) with standard two microelectrode voltage-clamp techniques [12,13]. For most experiments, oocytes were held near the reversal potential for K+ channel, prepulsed to 20 mV for 50 ms, and followed by 1-s test pulses to potentials ranging from 150 to +60 mV. Currents were measured at the end of 1-s pulses and plotted as a function of voltage to obtain the current–voltage (I–V) relationship. Data were expressed as means ± SEM (n = number of oocytes). Ion selectivity studies. In experiments to test K+ selectivity, solutions contained (in mM): 2.5 CaCl2, 1 MgCl2, with variable concentrations of KCl (2.5, 20, 50 or 92.5). LiOH was used to adjust pH to 7.4 and mannitol was used to adjust osmolarity to 200 mOsmol. Permeability ratios for monovalent cations were derived from the Goldman–Hodgkin–Katz (GHK) equation [1]: DErev = Erev, B Erev, A = RT/zF ln (PB[B]O/PA [A]O) where Erev, R, T, F are reversal potential (in mV), gas constant, absolute temperature, and Faraday constant, respectively. Reversal potentials were determined by employing various solutions (in mM): 92.5 XCl, 2.5 CaCl2, and 1 MgCl2, where X indicates K+, Li+, Na+, Rb+, Cs+ or NMG+. Since pH of these solutions was adjusted to 7.4 with less than 0.1 mM LiOH, the effect of lithium on reversal potentials was negligible.

Results Cloning and primary structure of Kesv Two types of GenBank database searches were performed. First, a text search of the completed viral genomes was made. Second, a BLASTP or TBLASTX search using whole or partial sequence of KcsA and other K+ channels as bait was performed. Two types of K+ channels encoded by virus were identified, including the recently published Kcv and its variants from chlorella virus [3,14], and a novel, putative channel encoded by the marine brown algae-infecting E. siliculosus virus (Accession No. NP_077708). We have named the latter Kesv. Kesv contains an open reading frame of 375 bp which encodes a protein of 124 amino acids (Fig. 1A). Sequence analysis using vector NTI predicted a molecular weight of 13.4 kDa and an isoelectric point of 8.09. A PROSITE database search identified several consensus motifs for protein post-translational modification, including three PKC phosphorylation sites ((S/T) X(R/K)) at residues 2, 28, and 96, as well as a casein kinase II phosphorylation site (SXXE) at residue 72. A BLAST search against the entire GenBank revealed that the most closely related protein to Kesv is Kcv. At the amino acid level, Kesv and Kcv are 21.8% identical

J. Chen et al. / Biochemical and Biophysical Research Communications 326 (2005) 887–893

889

Fig. 1. Primary sequence and membrane topology of Kesv protein (GenBank Accession No. NP_077708). (A) Deduced amino acid sequence. The three putative transmembrane domains (TM0, TM1, and TM2) are indicated along with K+ channel signature sequence (boxed); three potential PKC (*) and one casein kinase II phosphorylation site ( ). (B) Hydropathicity plot derived by the Kyte–Doolittle method with a window of 12 amino acids predicting three TM.

and 37.1% homologous among 124 residues. Kesv is also 17.7% identical and 37.7% homologous to KcsA. Kcv and KcsA are potassium channels with 2TM and intracellular N- and C-terminal domains [3,15]. However, Kyte–Doolittle hydropathicity analysis with a window of 12 residues predicted three transmembrane stretches (tentatively designated as TM0, TM1, and TM2; Figs. 1A and B). Other predictive topology algorithms such as DAS (dense alignment surface) and TMHMM (transmembrane hidden Markov model) also suggested a 3TM topology (data not shown) [16,17]. Given the mixed results by using these programs for topology prediction [18,19], the membrane topology of Kesv remains to be determined experimentally. Functional expression of Kesv channels in Xenopus oocytes The electrophysiological function of Kesv was examined in Xenopus oocytes using standard two microelectrode voltage-clamp techniques. Currents from uninjected oocytes and oocytes injected with Kesv-cRNA were elicited with 1-s voltage pulses ranging from 150 to +60 mV. Step changes in membrane potential elicited large instantaneous currents in oocytes injected with Kesv-cRNA, but tiny currents in uninjected oocytes, suggesting that Kesv expressed functional ion channels (Fig. 2A). For example, in 50 mM K+ solution, whole cell currents measured at the end of 1-s pulses averaged 1.37 ± 0.11 lA at +40 mV and 0.28 ± 0.02 lA at 60 mV in Kesv-cRNA injected oocytes (n = 6), but were only 0.09 ± 0.02 lA and 0.05 ± 0.01 lA, respectively, in uninjected oocytes (n = 6). A large com-

Fig. 2. Functional expression of Kesv in Xenopus oocytes. (A) Voltage protocol and currents recorded in uninjected oocytes and oocytes expressing: Kesv wild-type, Kesv/GAG (Kesv/Y89A), and Kesv/AAA (Kesv/G88A/Y89A/G90A). Currents were evoked by 1-s test pulses ranging from +60 to 150 mV from a prepulse potential of 20 mV. The dotted line indicates zero current level. (B) I–V relationships for currents from Kesv, mutants, and uninjected oocytes (n = 6). Current amplitudes were measured at the end of 1-s pulse. Note that Kesv/ GAG and Kesv/AAA did not express currents beyond levels observed in uninjected oocytes.

ponent of Kesv currents appeared to be instantaneously activated, suggesting that Kesv channels were constitutively open or activation was extremely fast. Time-dependent currents elicited by step changes in membrane potential reached steady state in less than 100 ms. To analyze the voltage dependency of Kesv channels, currents at the end of 1-s pulses were plotted as a function of voltage, since under these conditions, there was little contamination by endogenous currents in uninjected oocytes (Figs. 2A and B). In 50 mM K+, the inward currents peaked around 60 mV. To establish that the observed ion conductance was through the Kesv channel pore, we mutated the canonical potassium selectivity sequence GYG to GAG (Kesv/Y89A) and AAA (Kesv/G88A/Y89A/G90A), with the expectation that these mutations would eliminate channel permeation. As shown in Figs. 2A and B, both GAG and AAA mutant channels failed to conduct currents. The small currents present in oocytes expressing either mutant channel were comparable to currents measured in uninjected oocytes. The loss of function in these mutant channels could result from collapse of ion permeation pathway or defects in folding and/or trafficking that cause the reduced surface expression of

890

J. Chen et al. / Biochemical and Biophysical Research Communications 326 (2005) 887–893

mature proteins. No matter what the precise mechanism, these data support the idea that wild type Kesv formed functional ion channels, setting the stage for additional biophysical and pharmacological studies. K+ selectivity of Kesv The calculated potassium equilibrium potential with 50 mM extracellular K+ is 17.5 mV assuming an intracellular K+ concentration of 100 mM in oocytes [1]. The measured reversal potential for Kesv channels was 12.5 ± 0.2 mV (n = 6) (also see Fig. 2B). The similarity of the two values suggests that Kesv may be potassium selective. To test this hypothesis, Kesv currents were recorded in 2.5, 20, 50, and 92.5 mM extracellular K+ (Fig. 3A). Outward currents were noticeably reduced and inward currents increased following elevation of [K+]o. The effect of varying [K+]o on currents amplitudes is further illustrated by the I–V relationships (Fig. 3B) and the plot of reversal potential against [K+]o (Fig. 3C). The slope of the resulting linear relationship was 56.5 mV per decade change in [K+]o, close to the value of 58 mV predicted by the Nernst equation [1] for a K+ selective pore. Ion selectivity was further investigated by replacing extracellular K+ (92.5 mM) with equivalent concentrations of monovalent cations including Li+, Na+, Rb+, Cs+, and NMG+ (Fig. 4A). Reversal potentials derived from the I–V relationships (shown in Fig. 4B) were 1.2 ± 2.3, 91.7 ± 3.0, 83.2 ± 3.2, 15.7 ± 2.0, 67.7 ± 8.6, and 106.8 ± 7.6 mV for K+, Li+, Na+, Rb+, Cs+, and NMG+, respectively (n = 4–6). Permeabil-

Fig. 4. Ion selectivity of Kesv channels. (A) Kesv currents recorded in 92.5 mM external K+, Li+, Na+, Rb+, Cs+, and NMG+, during 1-s voltage pulses ranging from +40 to 150 mV; the dotted lines indicate zero current level. (B) I–V relationship (n = 4–6). (C) Permeability ratios for different monovalent ions derived by the GHK equation [1] based on changes in reversal potentials.

ity ratios relative to K+ were derived from change of reversal potentials based on the GHK equation (see Materials and methods) and shown in Fig. 4C. The rank order of permeability, K+ > Rb+ > Cs+ > Na + > Li+ > NMG+, is typical for K+ channels [1], as would be expected from the conserved ‘‘signature sequence’’ in Kesv protein. A striking feature of Kesv was the strong outward rectification, i.e., outward currents were larger than inward currents for equivalent step changes in membrane voltage from the reversal potential (Figs. 2B, 3B, and 4B). This phenomenon was obvious for all tested extracellular monovalent cations at concentration even as high as 92.5 mM (Fig. 4B). The outward rectification may result from inherent gating behavior of Kesv, or from block of inward currents by extracellular divalent cations such as Ca2+ and Mg2+ (2.5 and 1 mM, respectively, contained in solutions). Block of Kesv by Ba2+ and amantadine

Fig. 3. Kesv is a K+ permeable channel. (A) Representative Kesv currents recorded from an individual oocyte in 2.5, 20, 50, and 92.5 mM [K+] during 1-s test pulses to potentials ranging from +60 to 150 mV, applied in 10 mV increments from a prepulse potential of 20 mV. The dotted line represents zero current level. (B) I–V relationship under different [K+] (n = 5). Note shifts in reversal potential with increase in [K+]. (C) Reversal potentials for each oocyte under different [K+] were obtained, averaged, and plotted against extracellular [K+] (n = 5). The line is a linear fit of data points and represents a change of 56.5 mV per decade change in K+ concentration (comparable to Nernst prediction of 58 mV).

In addition to changes in reversal potentials noted above, ion substitution also changed current amplitudes. For example, at +40 mV, currents were 1.81 ± 0.33, 1.16 ± 0.04, and 1.49 ± 0.21 lA for K+, Cs+, and NMG+, respectively (Fig. 4B), suggesting partial blockade of currents by Cs+ and NMG+. To further characterize pharmacological properties of Kesv channels, we tested the effect of Ba2+, a known blocker of K+ channels. Application of 1 mM Ba2+ produced a reversible

J. Chen et al. / Biochemical and Biophysical Research Communications 326 (2005) 887–893

Fig. 5. Blockade of Kesv currents by barium and amantadine. (A) I–V relationships under control and 1 mM Ba2+ conditions (n = 6). (B) Relative block by 1 mM Ba2+ as function of voltage based on data obtained from (A). Values at 30, 20, and 10 mV were not obtained since currents were small at these potentials (near reversal potential). (C) I–V relationships under control, 1, 3, and 10 mM amantadine (n = 6). (D) Concentration-effect relationship for block of currents recorded at +40 mV. IC50 for amantadine block of Kesv currents was 2.3 ± 0.4 mM (n = 6).

inhibition of Kesv currents (Fig. 5A, n = 6). The inhibition was both time and voltage dependent, consistent with a pore-blocking mechanism (Figs. 5A and B, n = 6). Amantadine, an antiviral agent known to inhibit the influenza virus M2 channel at micromolar concentrations [20], has been shown to inhibit Kcv channel conductance and PBCV-1 plaque forming ability, albeit at millimolar concentration [3,6]. Kesv currents were blocked by amantadine in a concentration-dependent manner as illustrated in Figs. 5C and D. Based on inhibition of currents recorded at +40 mV, the IC50 was 2.3 ± 0.4 mM (n = 6). The question remains as to whether the low potency inhibition of currents is due to channel specific block, or due to the membrane partition and perturbation effects as previously reported for amantadine [21].

Discussion This study describes a novel K+ channel Kesv, encoded by E. siliculosus virus that infects marine brown algae. When expressed in Xenopus oocytes, Kesv induced outward rectifying currents that were largely instantaneous, indicating that channels are either constitutively open or activate extremely rapidly in response to stepped changes in transmembrane potential. Muta-

891

tion of the canonical K+ channel signature sequence GYG to GAG or AAA abolished currents and further confirmed that Kesv formed functional channels. Kesv is K+ selective as revealed by ion substitution experiments, with a rank order of permeability typical of other K+ channels. Like Kcv and other K+ channels, Kesv was sensitive to block by Ba2+. Kcv was reported to be inhibited by external Ca2+, while a 10-fold reduction of external Ca2+ increased current 4-fold [4]. In our preliminary experiments, we also observed that Ca2+ had inhibitory effects on Kesv, hence the inhibition observed by Ba2+ might be partially masked by the presence of Ca2+ (2.5 mM in all solutions). In addition, amantadine inhibited Kesv currents in a concentration-dependent manner with an IC50 of 2.3 mM, comparable to its potency for blockade of Kcv channel [3]. In general, Kesv displayed biophysical and pharmacological properties largely similar to those of Kcv channel. By comparison of potencies of Ba2+ and amantadine to block conductance of Kcv and plaque forming ability of PBCV-1, it was suggested that Kcv channel activity is essential for PBCV-1 replication [3]. However, these inhibitors are weak (millimolar range) and nonselective. For example, amantadine has strong potential for membrane partition and perturbation [21], hence it may affect membrane integrity and directly interfere with the viron/algae membrane fusion and plaque formation. Moreover, amantadine has been shown to affect the activity of a variety of ion channels with much higher potency compared to Kcv and Kesv, such as the influenza virus M2 channel (Ki of 9–78 lM) [20], KATP channel (Ki of 120 lM) [22], and a7 nicotinic acetylcholine receptor (IC50 of 6.5 lM) [23]. Most notably, amantadine is also a potent inhibitor of NMDA glutamate receptor (40% current reduction with 100 lM amantadine) [23]. Since chlorella virus has been proposed to encode two NMDA glutamate receptors and possibly more other ion channels [24], it is interesting to determine if the reduced plaque forming capability by amantadine and Ba2+ is through block of Kcv or other mechanisms. What is the biological function of Kesv? Although we have not directly determined the biological role of Kesv due to the lack of selective pharmacological tools, it is tempting to speculate that it may be important in viral life cycle based on the following set of observations: first, potassium channel function appears to be conserved between EsV-1 and PBCV-1. EsV-1 and PBCV1 belong to the same family of large icosahedral, dsDNA, Phycodnaviridae virus [8]. EsV-1 infects freeswimming, wall-less gametes or spores of the filamentous, marine, brown algae with a lysogenic life cycle, whereas chlorella virus infects freshwater green algae with a lytic infection cycle. There are only 33 protein encoding genes common to the two viral genomes (231 and 375 genes, respectively, for EsV-1 and PBCV-1)

892

J. Chen et al. / Biochemical and Biophysical Research Communications 326 (2005) 887–893

[25,26]; however, K+ channel function is conserved, as reflected by the existence of Kesv and Kcv. Second, as noted previously, Kesv shares similar biophysical and pharmacological properties with those of Kcv. Thus, we propose that Kesv may perform biological functions similar to those proposed for Kcv: i.e., induction of sustained K+ flow, alteration in electrochemical conditions of host/virion particles, and facilitation of viral life cycle. It should be noted that in addition to the lack of selective pharmacological tools, another factor that hampers the study of biological role of Kesv is the fact that Esv-1 has a lysogenic life cycle, limiting a direct, quantitative measurement of EsV-1 replication (such as the plaque forming experiments performed for chlorella virus). The fact that viral proteins have ion channel activity in the heterologous expression system does not necessarily guarantee that they function as ion channels in vivo and contribute to viral life cycle. One example is the NB protein encoded by influenza B virus. It displayed ion channel activity in vitro and was thought to play an important role in virus entry based on the analogy with influenza A M2 channel [27]. However, recent data showed that NB knockout virus replicated as efficiently as wild type virus in vitro [28] and another protein (BM2) was more likely to function as ion channel and be important for viral replication [29]. Future studies by using genetic tools and more selective pharmacological agents will ultimately determine the biological roles of Kesv channel. Recently, Kang et al. [14] analyzed Kcv genes in 40 chlorella virus strains isolated from diverse geographical sources and found 16 residue substitutions in the 94 residue protein. Characterization of these Kcv variants and guided mutagenesis studies have provided valuable information regarding structure–function relationships of K+ channels [14,30]. One example is the NY-2B Kcv variant: it contains a GLG sequence instead of the canonical G(Y/F)G in the selectivity filter, yet preserving typical K+ selectivity, challenging the conventional notion that a Y/F residue is necessary to ensure K+ selectivity. E. siliculosus, the host of EsV-1, is just one of many filamentous marine algal species and all examined species contain EsV-1 like virus [26]. EsV is pandemic in E. siliculosus populations that inhabit temperate seacoasts. Like chlorella virus, EsV from different geographic locations likely encodes Kesv-like channels; and it is tempting to speculate that Kesv and its variants will provide additional opportunities for understanding structure–function and biological roles of these K+ channels. In summary, we identified a novel K+ channel Kesv encoded by the E. siliculosus virus. Kesv channels conduct K+ selective currents sensitive to block by Ba2+, and amantadine. The identification and functional characterization of Kesv advance the notion that viruses

may employ K+ channels for replication and provide opportunities for elucidation of their biological role in viral life cycle.

Acknowledgment We thank Dr. Michael Sanguinetti for critically reading the manuscript and providing helpful comments.

References [1] B. Hille, Ion Channels of Excitable Membranes, third ed., Sinauer, Sunderland, MA, 2001. [2] L. Heginbotham, Z. Lu, T. Abramson, R. MacKinnon, Mutations in the K+ channel signature sequence, Biophys. J. 66 (1994) 1061– 1067. [3] B. Plugge, S. Gazzarrini, M. Nelson, R. Cerana, J.L. Van Etten, C. Derst, D. DiFrancesco, A. Moroni, G. Thiel, A potassium channel protein encoded by chlorella virus PBCV-1, Science 287 (2000) 1641–1644. [4] S. Gazzarrini, M. Severino, M. Lombardi, M. Morandi, D. DiFrancesco, J.L. Van Etten, G. Thiel, A. Moroni, The viral potassium channel Kcv: structural and functional features, FEBS Lett. 552 (2003) 12–16. [5] A. Moroni, C. Viscomi, V. Sangiorgio, C. Pagliuca, T. Meckel, F. Horvath, S. Gazzarrini, P. Valbuzzi, J.L. Van Etten, D. DiFrancesco, G. Thiel, The short N-terminus is required for functional expression of the virus-encoded miniature K(+) channel Kcv, FEBS Lett. 530 (2002) 65–69. [6] C. Wang, R.A. Lamb, L.H. Pinto, Direct measurement of the influenza A virus M2 protein ion channel activity in mammalian cells, Virology 205 (1994) 133–140. [7] M. Mehmel, M. Rothermel, T. Meckel, J.L. Van Etten, A. Moroni, G. Thiel, Possible function for virus encoded K+ channel Kcv in the replication of chlorella virus PBCV-1, FEBS Lett. 552 (2003) 7–11. [8] C.R. Pringle, The universal system of virus taxonomy of the International Committee on Virus Taxonomy (ICTV), including new proposals ratified since publication of the Sixth ICTV Report in 1995, Arch. Virol. 143 (1998) 203–210. [9] H. Schrempf, O. Schmidt, R. Kummerlen, S. Hinnah, D. Muller, M. Betzler, T. Steinkamp, R. Wagner, A prokaryotic potassium ion channel with two predicted transmembrane segments from Streptomyces lividans, EMBO J. 14 (1995) 5170–5178. [10] O.B. Cleaver, K.D. Patterson, P.A. Krieg, Overexpression of the tinman-related genes XNkx-2.5 and XNkx-2.3 in Xenopus embryos results in myocardial hyperplasia, Development 122 (1996) 3549–3556. [11] G. Sarkar, S.S. Sommer, The ‘‘megaprimer’’ method of sitedirected mutagenesis, Biotechniques 8 (1990) 404–407. [12] W. Stuehmer, Electrophysiological recording from Xenopus oocytes, Methods Enzymol. 207 (1992) 319–339. [13] J. Chen, A. Zou, I. Splawski, M.T. Keating, M.C. Sanguinetti, Long QT syndrome-associated mutations in the Per-Arnt-Sim (PAS) domain of HERG potassium channels accelerate channel deactivation, J. Biol. Chem. 274 (1999) 10113–10118. [14] M. Kang, A. Moroni, S. Gazzarrini, D. DiFrancesco, G. Thiel, M. Severino, J.L. Van Etten, Small potassium ion channel proteins encoded by chlorella viruses, Proc. Natl. Acad. Sci. USA 101 (2004) 5318–5324. [15] D.A. Doyle, J. Morais Cabral, R.A. Pfuetzner, A. Kuo, J.M. Gulbis, S.L. Cohen, B.T. Chait, R. MacKinnon, The structure of

J. Chen et al. / Biochemical and Biophysical Research Communications 326 (2005) 887–893

[16]

[17]

[18]

[19]

[20]

[21]

[22]

the potassium channel: molecular basis of K+ conduction and selectivity, Science 280 (1998) 69–77. M. Cserzo, E. Wallin, I. Simon, G. von Heijne, A. Elofsson, Prediction of transmembrane alpha-helices in prokaryotic membrane proteins: the dense alignment surface method, Protein Eng. 10 (1997) 673–676. E.L. Sonnhammer, G. von Heijne, A. Krogh, A hidden Markov model for predicting transmembrane helices in protein sequences, Proc. Int. Conf. Intell. Syst. Mol. Biol. 6 (1998) 175– 182. S.R. Durell, H.R. Guy, Atomic scale structure and functional models of voltage-gated potassium channels, Biophys. J. 62 (1992) 238–247, discussion 247–250. K. Melen, A. Krogh, G. von Heijne, Reliability measures for membrane protein topology prediction algorithms, J. Mol. Biol. 327 (2003) 735–744. C. Wang, K. Takeuchi, L.H. Pinto, R.A. Lamb, Ion channel activity of influenza A virus M2 protein: characterization of the amantadine block, J. Virol. 67 (1993) 5585–5594. J. Wang, J.R. Schnell, J.J. Chou, Amantadine partition and localization in phospholipid membrane: a solution NMR study, Biochem. Biophys. Res. Commun. 324 (2004) 212–217. F.M. Ashcroft, A.J. Kerr, J.S. Gibson, B.A. Williams, Amantadine and sparteine inhibit ATP-regulated K-currents in the insulin-secreting beta-cell line, HIT-T15, Br. J. Pharmacol. 104 (1991) 579–584.

893

[23] H. Matsubayashi, K.L. Swanson, E.X. Albuquerque, Amantadine inhibits nicotinic acetylcholine receptor function in hippocampal neurons, J. Pharmacol. Exp. Ther. 281 (1997) 834–844. [24] M. Kang, A. Moroni, S. Gazzarrini, J.L. Van Etten, Are chlorella viruses a rich source of ion channel genes? FEBS Lett. 552 (2003) 2–6. [25] N. Delaroque, D.G. Muller, G. Bothe, T. Pohl, R. Knippers, W. Boland, The complete DNA sequence of the Ectocarpus siliculosus virus EsV-1 genome, Virology 287 (2001) 112–132. [26] J.L. Van Etten, M.V. Graves, D.G. Muller, W. Boland, N. Delaroque, Phycodnaviridae—large DNA algal viruses, Arch. Virol. 147 (2002) 1479–1516. [27] T. Betakova, M.V. Nermut, A.J. Hay, The NB protein is an integral component of the membrane of influenza B virus, J. Gen. Virol. 77 (Pt. 11) (1996) 2689–2694. [28] M. Hatta, Y. Kawaoka, The NB protein of influenza B virus is not necessary for virus replication in vitro, J. Virol. 77 (2003) 6050–6054. [29] J.A. Mould, R.G. Paterson, M. Takeda, Y. Ohigashi, P. Venkataraman, R.A. Lamb, L.H. Pinto, Influenza B virus BM2 protein has ion channel activity that conducts protons across membranes, Dev. Cell 5 (2003) 175–184. [30] S. Gazzarrini, M. Kang, J.L. Van Etten, S. Tayefeh, S.M. Kast, D. DiFrancesco, G. Thiel, A. Moroni, Long distance interactions within the potassium channel pore are revealed by molecular diversity of viral proteins, J. Biol. Chem. 279 (2004) 28443–28449.