A novel signature-tagged mutagenesis system for Streptococcus suis serotype 2

Veterinary Microbiology 122 (2007) 135–145 www.elsevier.com/locate/vetmic

A novel signature-tagged mutagenesis system for Streptococcus suis serotype 2 Thomas L. Wilson, Jenifer Jeffers, Vicki J. Rapp-Gabrielson, Stephen Martin, Loretta K. Klein, David E. Lowery, Troy E. Fuller * Veterinary Medicine Research and Development, Pfizer Animal Health, 7000 Portage Road, Kalamazoo, MI 49001-0199, USA Received 11 September 2006; received in revised form 20 December 2006; accepted 27 December 2006

Abstract Streptococcus suis is an economically important, zoonotic pathogen causing death and disease in swine. The objectives of this study were to develop a signature-tagged mutagenesis (STM) system for S. suis serotype 2 and to identify genes required for in vivo virulence. Identification of such candidate genes may lead to a better understanding of the pathogenesis of S. suis and may provide substrate for the discovery of new vaccines. A novel STM approach was designed to allow for a higher throughput assay of mutants using the Luminex xMAP1 system. Additionally, to speed the identification process, a direct genomic DNA sequencing method was developed that overcomes the problems associated with the presence of repetitive insertion sequences. Approximately 2600 mutants were screened through both mouse and caesarian-derived, colostrum-deprived (CDCD) pig models. The disrupted ORF was identified for each potential attenuated mutant, and mutants with distinct and unique mutated ORFs were analyzed individually for attenuation in mouse and CDCD pig models. A variety of genes were identified, including previously known genes essential to the virulence of other organisms, genes involved in capsule biosynthesis, a regulator of suilysin expression, and several conserved or predicted genes. Of the 22 mutants identified as attenuated in either animal model, eight insertion mutants caused no mortality in both mouse and pig models. # 2007 Elsevier B.V. All rights reserved. Keywords: Signature-tagged mutagenesis; STM; Streptococcus suis; Luminex

1. Introduction Streptococcus suis is an important and world-wide pathogen that causes meningitis, endocarditis, septicemia, arthritis, polyserositis and pneumonia in swine. * Corresponding author. Tel.: +1 269 833 3642; fax: +1 269 833 7636. E-mail address: [email protected] (T.E. Fuller).

S. suis has become a major problem in swineproducing countries due to intensive management practices. On rare occasions S. suis can infect humans, mainly associated with exposure to infected pigs or tissues. In fact, the largest outbreak in humans was recently reported, along with a newly described toxic shock syndrome clinical manifestation (Yu et al., 2006). The magnitude and severity of the outbreak has sparked new interest in the zoonotic potential of this

0378-1135/$ – see front matter # 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.vetmic.2006.12.025

136

T.L. Wilson et al. / Veterinary Microbiology 122 (2007) 135–145

organism. There are 35 known serotypes of S. suis with serotype 2 being the most prevalent in North America and Europe (Gottschalk and Segura, 2000). Important S. suis virulence associated factors include the capsular polysaccharide (CPS), muramidasereleased protein (MRP), extracellular protein factor (EF), suilysin, and adhesins (reviewed in Gottschalk and Segura, 2000). However, many virulent isolates lacking these factors have also been isolated from clinical cases (Gottschalk et al., 1998). Experimental vaccines in mice have been shown to induce significant protection against strains of homologous serotype, but protection was serotype specific (Kebede et al., 1990). In addition, currently available commercial vaccines have been formulated with multiple serotypes, presumably to increase the spectrum of protection. Successful comprehensive coverage of vaccines may be improved by a more thorough knowledge of virulence factors. The infection process can be directly influenced by factors, such as toxins, adhesins, and various other proteins, or it can be indirectly influenced by factors that control cellular metabolism and regulatory processes in response to the host environment. Comprehensive screens for virulence related genes, such as in vivo expression technology (IVET), signature-tagged mutagenesis (STM), subtractive hybridization, and differential display have not been reported to date for S. suis. Limited screening by in vivo complementation (Smith et al., 2001) has been employed, and the preliminary development of a transposon system for S. suis has been reported (Slater et al., 2003). STM is a negative selection procedure that is used to identify attenuated bacteria from pools of mutants, thus allowing subsequent identification of genes critical for in vivo survival (Hensel et al., 1995). Since its inception, the STM process has been utilized for screens of numerous pathogenic bacteria (reviewed in Autret and Charbit, 2005). Several STM screens have been performed in Streptococcus organisms (Jones et al., 2000; Miller and Neely, 2005; Paik et al., 2005; Polissi et al., 1998). Over the past decade, technical advances have been developed to enhance the STM process, including microarray and PCR detection systems (reviewed in Saenz and Dehio, 2005). The Luminex xMAP1 system (http://www.luminexcorp.com/) utilizes microfluidics and microsphere based technology for analysis of up to

100 different analytes simultaneously and quantitatively. The capabilities of the technology are well suited to improving the throughput of STM screening. In this paper, we report development of a novel STM analysis method using the Luminex xMAP1 system, a modified protocol for direct genomic sequencing of an ISS1 insertion site, the successful screening of approximately 2600 S. suis serotype 2 mutants in both the natural host and a laboratory model, and the identification of genes critical for the virulence of S. suis in both mice and pigs.

2. Materials and methods 2.1. Construction of a S. suis library containing transposon-tagged mutants S. suis serotype 2 S735 cells were kindly provided by Marcelo Gottschalk (University of Montreal, Faculty of Veterinary Medicine, St. Hyacinthe, Quebec, Canada) under USDA Import permit 49703. Cells were made electrocompetent essentially as described by Takamatsu et al. (2001) except cells were grown without DLthreonine. A library of S. suis serotype 2 S735 signature-tagged mutants was constructed using the suicide vector pGh9:ISS1 (Maguin et al., 1996) modified by incorporation of a pre-selected set of 87 unique sequence tags (Fuller et al., 2000) into the EcoRI site. S. suis serotype 2 S735 competent cells were electroporated with pGh9:ISS1 plasmids essentially as described by Takamatsu et al. (2001) except that cells were spread on THY (Todd Hewitt Yeast Extract Agar; BBL, Becton, Dickinson, Sparks, MD, USA) containing 0.5 mg/ml erythromycin (Em0.5) (Sigma–Aldrich, St. Louis, MO, USA) and incubated at 28 8C with 5% CO2. Electroporations were performed for every tagged pGh9:ISS1 plasmid, resulting in 87 different S. suis serotype 2 S735 strains with unique sequence tags. A 96-well master plate was prepared by addition of 15% (final concentration) sterile glycerol to the cultures, and the plate was stored frozen at 70 8C. The presence of pGh9:ISS1 within erythromycin resistant colonies was verified by PCR with primers DEL-2121 and DEL-2126 (Table 1). The pGh9:ISS1 tagged plasmids were forced to integrate into the S. suis chromosomal DNA, and mutants were selected as follows. Overnight broth cultures incubated at 28 8C were diluted 1000-fold to 100 ml total volume in a

T.L. Wilson et al. / Veterinary Microbiology 122 (2007) 135–145

137

Table 1 Oligonucleotides used for PCR Oligo name

Sequence (50 –30 )

DEL-2121 DEL-2126 DEL-2403 DEL-2122 TEF-327 TEF-498 TEF-597 TEF-598 TEF-599 TEF-663 TEF-664 TEF-665 TEF-666 TEF-667 TEF-668 TEF-705 TEF-708 TEF-893 TEF-897 TEF-898

AAAGCGCCCTCTATTGGTTCTGC GGTTTGATGTTGCGATTAATAGC CCGAAGAAATGGAACGCTCT TTATTCATTTTACACTAAAATAG CTAGAATTCCTAGGTACCTACAACCTC CATGAATTCCATGGTACCCATTCTAACa GGCCACGCGTCGACTAGTACNNNNNNNNNNCATAT GGCCACGCGTCGACTAGTAC GGCCACGCGTCGACTAGTACNNNNNNNNNNACGCC GGCCACGCGTCGACTAGTACNNNNNNNNNNATGCAT GGCCACGCGTCGACTAGTACNNNNNNNNNNGTTAAC GGCCACGCGTCGACTAGTACNNNNNNNNNNTTCGAA GGCCACGCGTCGACTAGTACNNNNNNNNNNGATATC GGCCACGCGTCGACTAGTACNNNNNNNNNNTGATCA GGCCACGCGTCGACTAGTACNNNNNNNNNNCAGCTG AGGAGTTCTTGAATTTCACGATAGC CGATTAAGGGCATGGAAACAATTCG CCTTTAAAATAGTTCATTGATATATCCTCGCTGTC GCTTGATAATTCGATGCTCTAGAGCATTCTCTGG CAGGAATTCGATAGCTTGATGGAGAGAATGGG

a

Oligo labeled with biotin at 50 end.

96-well plate. The entire dilution was plated onto BHI (Brain Heart Infusion, Becton, Dickinson) agar plates containing Em0.5, and incubated overnight at 37 8C with 5% CO2. Pools were then constructed by inoculating single colonies with sterile toothpicks into individual wells of 96-well plates containing 100 ml BHI/Em0.5 broth. Each of 87 wells in a total of 30 plates was inoculated with a strain containing the appropriate sequence tag, thus creating 30 pools with 87 different S. suis serotype 2 S735 signature-tagged mutants in each pool. 2.2. Animal studies All procedures in this study were approved and conducted in compliance with the ‘‘Guide for the Care and Use of Laboratory Animals (ILAR, 1996) and the ‘‘Guide for the Care and Use of Agricultural Animals in Agricultural Research and Teaching’’ (FASS, 1999) and also in compliance with the guidelines of the Institutional Biosafety Committee and the Internal Animal Care and Use Committee, Pfizer Animal Health. Procedures and facilities were in accordance with BSL-2 and ABSL-2 recommendations. CF-1 mice were obtained from Charles River Laboratories (Boston, MA, USA). Caesarian-derived colostrum-deprived (CDCD)

pigs were obtained from Struve Labs (Manning, IA, USA). 2.3. Screening of S. suis serotype 2 S735 STM pools in mice Frozen pools of S. suis serotype 2 S735 signaturetagged mutants were used to inoculate a new 96-well round bottom plate (Corning Costar, Cambridge, MA, USA) containing 200 ml of Todd Hewitt broth with 0.5 mg/ml erythromycin (TH/Em0.5). Plates were incubated overnight at 37 8C with 5% CO2 without shaking and then wells were pooled. One milliliter of this pooled solution was diluted 1:50 in TH/Em0.5 broth. The cells from the remaining pooled solution were pelleted and stored at 4 8C for use as the source of input pool total DNA. The diluted, pooled solution was incubated at 37 8C with 5% CO2 while shaking at 100 rpm. At a concentration of approximately 1  107 CFU/ml, 5 CF-1 mice/pool were infected with 1 ml of culture by intraperitoneal (IP) administration. After 24 h post-inoculation, the mice were euthanized and spleens harvested. The five spleens from mice infected with the same pool were combined, homogenized and plated on TH/Em0.5 agar plates which were incubated overnight at 37 8C with 5% CO2. The

138

T.L. Wilson et al. / Veterinary Microbiology 122 (2007) 135–145

resulting colonies (greater than 1000) were suspended in 10 ml of TH/Em0.5 broth and used as the source of recovery pool total DNA. Genomic DNA from the input and recovery pools was isolated using traditional methods (Wilson, 1997) or the Wizard1 Genomic DNA Purification Kit (Promega, Madison, WI, USA). 2.4. Screening of S. suis serotype 2 S735 STM pools in CDCD pigs Frozen glycerol stocks of S. suis serotype 2 S735 pGh9:ISS1 STM pools were used to create replicate pools as described above for mouse studies. Three milliliters of the pooled cultures were inoculated into 27 ml of TH broth in a sterile, disposable Erlenmeyer flask. The refreshed, pooled culture was incubated at 37 8C with 5% CO2 until the OD550 reached 0.9 (approximately 5  108 CFU/ml). While held at 4 8C, 20 ml of the culture was pelleted at 3400 rpm using a Beckman GS-6R centrifuge. The cell pellet was suspended in 10 ml of sterile Dulbecco’s phosphate buffered saline (PBS; Sigma–Aldrich, St. Louis, MO, USA). A 1 ml aliquot from the suspended culture was used as the input pool DNA source. Pigs were anesthetized with a cocktail of Tiletamine HCl and Zolazapam HCl (Telazol1, Fort Dodge Animal Health, Fort Dodge, IA, USA) and xylazine (Xylaxine-100, The Butler Company, Dublin, OH, USA) given intramuscularly (IM). The challenge cultures (1  109 CFU) were administered intravenously (IV) into the neck or ear veins (three pigs per treatment). Pigs were monitored closely for clinical signs including inappetence, dyspnea, depression, lameness and CNS signs. After 24 or 48 h post-inoculation, heparinized blood samples were drawn, animals were euthanized, and tissue samples were collected for analysis. Samples collected were from the blood, brain, lung, liver, spleen, and synovial fluid. Recovery of S. suis serotype 2 S735 pGh9:ISS1 STM mutants was performed by combining approximately 10 g of tissue with 10 ml of PBS. A Seward Stomacher 80 Lab System and manual manipulation was used for homogenization. The mixture was centrifuged in a Beckman GS-6R centrifuge at 1000 rpm for 10 min, and the supernatant was plated on TH/Em0.5 agar plates. For the blood samples, further centrifugation of supernatant for 15 min at 3000 rpm in a Beckman GS-6R centrifuge was performed. The majority of the

supernatant was discarded and the pellet was suspended in approximately 500 ml PBS and spread directly onto TH/Em0.5 agar plates. Plates containing more than 1000 CFU were used to prepare the recovery pool DNA as described above. 2.5. Multiplexed quantification of STM tags from pools of genomic DNA Oligonucleotides complimentary to 20 bp of the sequence tags in the STM transposon arrays (Table 2) and modified at the 50 end with an amino-linker (AC12) were synthesized by Sigma-Genosys Biotechnologies (The Woodlands, TX, USA). Amine-modified oligos were coupled to 96 different carboxylate-modified polystyrene microspheres (Luminex Corporation, Austin, TX, USA) according to the manufacturer’s recommendations. The quantification of signature tags in each pool of input or recovery DNA from 30 pools was determined using the Luminex xMAP1 100 system (Luminex Corporation). Calibration microspheres (CAL-1 and CAL-2) were used to calibrate the instrument as recommended by the manufacturer. Biotinylated PCR products, proportional to the relative concentration of STMtagsinthegenomicDNApools,werepreparedfrom 1 ml genomic DNA using the primers TEF-327and TEF498labeled with a 50 biotinlabel and a standard rTth PCR reaction (Invitrogen, Carlsbad, CA, USA). For hybridization, a 1.0 ml working microsphere mixture (WMM) was prepared according to manufacturer’s recommendations. Aliquots of 33 ml of sonicated WMM (containing approximately 5000 microspheres of each set) were added to each sample well or background well of a 96-well PCR plate. Five microliters of biotinylated PCR product were added to each sample well or 5 ml of TE buffer, pH 8.0, was added to the background control well. The volume of the final solution in the well was brought up to 50 ml with TE buffer, pH 8.0, and the samples were gently mixed by repeated pipetting. The plate was sealed with Costar 6570 ThermowellTM Sealing Tape (Costar) to prevent evaporation and light exposure. Using an Applied Biosystems GeneAmp PCR System 2700, the plate was incubated under the following conditions: 10 min at 95 8C followed by a hold at 45 8C for a minimum of 15 min. The microspheres were pelleted in the plate by centrifugation at 2500 rpm in a Beckman

T.L. Wilson et al. / Veterinary Microbiology 122 (2007) 135–145 Table 2 Oligonucleotides (amine C12-50 modified) covalently linked to Luminex microspheres Oligo name

Sequence

STM-01 STM-02 STM-03 STM-04 STM-05 STM-06 STM-07 STM-08 STM-09 STM-10 STM-11 STM-12 STM-13 STM-14 STM-15 STM-16 STM-17 STM-18 STM-19 STM-20 STM-21 STM-22 STM-23 STM-24 STM-25 STM-26 STM-27 STM-28 STM-29 STM-30 STM-31 STM-32 STM-33 STM-34 STM-35 STM-36 STM-37 STM-38 STM-39 STM-40 STM-41 STM-42 STM-43 STM-44 STM-45 STM-46 STM-47 STM-48 STM-49 STM-50 STM-51 STM-52

TGGTGAGAGTGACCGCTAGG CACGCCCTACAGCGCGACAA GGCGATGTATGGCTAGGTTT GTGGGGCTCTGTGTTTGGTG GGTGGGGTGTCGGGGTGGGG GTTGCGGTATCGCTATTTGT TGGCGGGGTTGCGAGTTCTA GGTTTAGCGATTTTGGGGGA GGAGCTGGGTGTATAGATGG AGGGGGTGTGGTGTGGGGAT AGTGATGGGTCGGGGTTGTG GGCGCTAGTAGGTTTGGTGT TGTGCGATGGGTTGTTGGGG ATGGGGCGGTCGGGATATGT TGGGGTTATAGTGATTTTGG GTATATGGAGAGCTGTGTAG GTGGCATGTTTGTGTGAGGG GGGGTGCGGTTTGGTTATTG AGGTGCGAGCTCGGTCTGTA ATCTCGGGGTCGGGGGATGG GCGTGGTGTGCGGTCTATTT TGTGGTTGGTGTGTAGAGTG CGTGTGTGGTGTTTGGGGGT GTGGGTGATGTGTGGATGGC AGTGGGTTGTTGTGTCGAGA GGTCGCGGGTGTTTCTGGGG GGCGGGGTTGTTAGGGGTCG GGAGCGTGTTAGGGAGGTTT GGAGGGTTTGTTTGGGCGTT ATCGGGGGAGGGGTTGCGCT CGGGGTGTGGGGATAGTGGT CTTTGGAGGGATGTTTTGAG CTCTTTGCGCTTTTTAGTGG TGGAGTGGTATGGCTCGCGG TAGTTGCTGGTGGTTTGTGT GTGCGCTCGCGATCGATGTC AGGGCTTGGGATTGGGAGTG GGATGTAGCGGTCTTTCTGG CGGGTGTGGTCGCTCTGTTT CTGGATTGGTTGGTTTACTG CGTGGGGTGGTGGGCGATTT TGCGCGAGTGGGTTAGTGGG AGGTCTCGAGATGTCTGTCT AGTGCGCGGGTTTTGGGTGT ATGGGTGAGGGAGTGAAGAG GGTGAGTGGTAGAGGGGTCG GGTGTGTTCCGGGTCGTGTT AGAGTGTGCTTTGATGTGTG GTATCGGTCGCGGGAATAGC AGAGCGTGAGTTCTTTCGTG ATGGATGGCGCGGTAGGTTG GTGGAGGGTTCGGTTGTTCG

139

Table 2 (Continued ) Oligo name

Sequence

STM-53 STM-54 STM-55 STM-56 STM-57 STM-58 STM-59 STM-60 STM-61 STM-62 STM-63 STM-64 STM-65 STM-66 STM-67 STM-68 STM-69 STM-70 STM-71 STM-72 STM-73 STM-74 STM-75 STM-76 STM-77 STM-78 STM-79 STM-80 STM-81 STM-82 STM-83 STM-84 STM-85 STM-86 STM-87 STM-88 STM-89 STM-90 STM-91 STM-92 STM-93 STM-94 STM-95 STM-96

GGGTATGTTGGGGTAGAGGA GGTCGATTCTCGTGGGTGAT GGTGGGAGCGTTTGCGGGCG GGCTTTAGTTATGGGGAGTG GGGGTGCTGGCTGTCTGGTT GGGTTTTGTGGGGTGTGGCG TGGCGCGGGGTGTTGTTTTC GGGTTGGTAGGGTTGGGTCT GTGATGGGTGCGATCAGTGC AGTGGTGTTTAGCGAGGTAT ATGGGGATTTCGTGTTTTGG TGGGCGGTGTCTAGATAGAG AGGGTGGTTGGGCGAGGGCT GGGGTGAGTGATGGTGGTCG GCTTGGGCGGGCTATAGGGC GAGCTGGTGGGTTGGGGTTT GGGAGTTTGGGCGCTGGGTT CGTGATGTTGGGAGGGTTAG GGCTTTGGTTGGTGGTGGAG GTATTTGTCTGGCTGTGTTG AGAGGGCGTGCGTGAGTGGA GGAGCGGGTTAGGGCGGTGT TGTGTGGATCTCTCGGTGCT TTTGTTATGGGGCTGCGTGA CGGGAGTGGGATGGGTTTTG GATTGTGGTAGGTGGCGGTA GGGTGTGTATTTGGCTTGGG GGGCGGGTTAGATATTGGGA GCTCGCTTGGCGCTATGGGG GGTGGAGTGTGGTCGGTCTT ATGTAGTGTTATGGCTGGAT CGGTCGCGTGATATGGTGTT TGTTGGTGGAGCTTTTGATT GGGTATCGCTGGGGAGATTG GGTTCGAGTTGTTGAGCTTG ATCGGGCTGGTGATAGATGG AGTTGGGTCGGGAGCTTGCG GGATTGATTGCTGGGTGGCG GGGTGGGTGTCTGGCTGGGA CTGTGTGGGGTTGTCTCTCG TGGGTCTGGTTGTCGGGTTA TTAGTTGCTCGTTTGGTGTA CTCGTTATTTTAGGTTGGTC TTGAGGTATGGTTAGATGTG

GS-6R centrifuge for 10 min and 25 ml of the supernatant was carefully removed with a pipet. For each reaction, 75 ml of fresh reporter mix, containing 4 ng/ml of streptavidin, R-phycoerythrin (Molecular Probes, Eugene, OR, USA) in 1 TMAC hybridization buffer (3 M TMAC, 0.1% sarkosyl, 50 mM Tris–HCl, pH 8.0, 4 mM EDTA, pH 8.0), was added to each well. The samples were gently mixed by repeated pipetting. With

140

T.L. Wilson et al. / Veterinary Microbiology 122 (2007) 135–145

the XYP platform of the Luminex 100 System held at 45 8C, the samples were analyzed according to the manufacturer’s recommendations. At least 100 microspheres of each bead set were analyzed within each mixture. The median of the Mean Fluorescent Intensity (MFI), or the fluorescence associated with the outside of each microsphere, was used to quantify the measure of the hybridizing oligonucleotide, and thus, to quantify the relative concentration of each STM tag present in the genomic DNA pool. 2.6. Identification of genes tagged by transposon insertions For direct genomic sequencing, a digestion with HindIII and EcoRI (Invitrogen, Carlsbad, CA, USA) was performed at 37 8C for at least 1 h in 50 ml total volume containing approximately 2 mg DNA, 25 units of each enzyme, and 1 buffer. Digested DNA was cleaned with the QIAquick PCR Purification Kit (Qiagen Worldwide, Valencia, CA, USA) and approximately 0.7 mg was used for sequencing reactions. Sequencing reactions were performed in 20 ml total volume with 9 ml digested DNA, 8 ml BigDye1 Terminator v3.1 (Applied Biosystems, Foster City, CA), and 1.5 mM primer. Primers used were TEF-708, TEF-893, TEF-897, or TEF-898. Thermocycler conditions were as follows: 95 8C for 1 min; 99 cycles of 95 8C for 20 s and 65 8C for 5 min; 4 8C hold. Arbitrary PCR was performed using primers TEF705 or TEF-708, respectively, for the primary amplification of DNA left and right of the ISS1 element. For both amplifications, a mix of up to eight arbitrary primers was used, including TEF-597, TEF-599, TEF663, TEF-664, TEF-665, TEF-666, TEF-667, and TEF668. Template consisted of 5 ml of 5 ml overnight broth culture or up to 5 ml of a genomic DNA preparation. Thermocycling was as follows: 2 min at 94 8C; 14 cycles of 15 s at 94 8C, 30 s touchdown starting at 50 8C (decreasing 1 8C/cycle), 5 min at 72 8C; 30 cycles of 15 s at 94 8C, 30 s at 50 8C, 5 min at 72 8C; 7 min at 72 8C; a final hold at 4 8C. Secondary PCR amplification of the DNA was performed using nested primers TEF-598 and either DEL-2122 or DEL-2403, respectively, for DNA left and right of the ISS1 element. Single primer PCR was performed essentially as described by Karlyshev et al. (2000) followed by a second round of amplification using nested primers to

improve product concentration with limited background. As described above, primary amplification of DNA flanking the left or right of the ISS1 insertional element used primer TEF-705 or TEF-708, respectively. Secondary amplification of the DNA left of the ISS1 element was performed using nested primers TEF-705 and DEL-2122. Secondary amplification of the DNA right of the ISS1 element was performed using nested primers TEF-708 and DEL-2403. Isolated and purified PCR products (5 ml) from both types of PCR were sequenced with primers DEL-2122 or DEL-2403 and BigDye1 v3.1 according to manufacturer’s recommendations (PE Applied Biosystems, Foster City, CA, USA). 2.7. Evaluation of individual candidate mutants for virulence For attenuation studies in mice, individual insertion mutant and wild type strains were incubated at 37 8C with 5% CO2 while shaking at 100 rpm until the concentration of bacteria was approximately 1  107 CFU/ml. Three CF-1 mice per mutant were infected with 1 ml of culture by IP administration. Mortality and clinical signs were monitored for 72 h post-infection. For attenuation studies in pigs, individual insertion mutant strains and the wild type were grown overnight and diluted 1:25 in 10 ml of TH broth or TH/Em0.5 broth in 13 mm  100 mm disposable, sterile culture tubes. Cultures were incubated at 37 8C with 5% CO2 until the concentration of bacteria was approximately 5  108 CFU/ml. Broth cultures were combined with 10 ml PBS and held on ice. Challenge cultures (1  109 CFU/ml) were administered to anesthetized CDCD pigs (three pigs per treatment) using the procedures described above. Pigs were monitored closely for 7 days post-inoculation and moribund pigs were humanely euthanized. Body temperatures and clinical signs, including inappetence, depression, lameness, dyspnea and CNS signs, were monitored and recorded.

3. Results 3.1. Preparation of STM mutant pools A library of 30 pools containing approximately 2600 S. suis serotype 2 S735 signature-tagged mutants

T.L. Wilson et al. / Veterinary Microbiology 122 (2007) 135–145

was constructed using signature-tagged pGh9:ISS1 plasmids. The ISS1 element on the vector allowed integration of the plasmid into the chromosome when thermosensitive replication was inhibited at 37 8C (Maguin et al., 1996). The Luminex screening protocol in Section 2 was developed for screening of STM tags after evaluation of several parameters including oligo tag length, hybridization temperature and time (data not shown). Sets of 96 different Luminex beads were prepared, each containing a 20 mer complementary oligo (Table 2) to the appropriate STM tag. 3.2. Screening of STM pools in mice All 30 STM pools were successfully screened through a septicemic mouse model resulting in 96 mutants that demonstrated a reduced abundance in the recovery pools as compared to the input pools. These mutants were then screened individually through the septicemic mouse model, using three mice per mutant. The level of attenuation was compared to 100% mortality with a wild type positive control and no mortality with a growth medium (vehicle) negative control. Of the 96 initial candidates, 32 mutants resulted in no mortality, 20 resulted in 33% mortality, and 6 resulted in 66% mortality. Genomic DNA was prepared from the top 52 candidates showing the strongest attenuation (0–33% mortality) and was evaluated by Southern blot analysis, probing for the ISS1 element of the integrated plasmid. Only mutants with a single insertion of the transposon were evaluated further. Sequencing of the region surrounding the transposon insertion sites identified mutants with the plasmid integrated into the same open reading frame (ORF). After in vitro analysis, the collection of 52 mutants was reduced to a total number of 14 unique single insertion mutants. 3.3. Screening of mutant pools in CDCD pigs STM screening was also performed in the septicemic CDCD pig model in order to assess the relationship between the murine and natural porcine host models for S. suis infection. After initial screening to establish the appropriate parameters, S. suis serotype 2 S735 pGh9:ISS1 STM Pools # 01–16 were screened by inoculating CDCD pigs IV with

141

1  109 CFU and reisolating bacteria 1 day postinoculation. Recovery pool DNA isolated from every tissue was individually PCR amplified and analyzed via Luminex techniques, and data resulting from replicate pigs was averaged. For an alternative analysis method, recovery pool DNA was isolated from replicate pigs and tissues, pooled and used as one template for PCR and Luminex analysis, similar to the method of the mouse screen. Using the combined results of both methods, the porcine STM screen of pGh9:ISS1 STM Pools # 01–16 identified 78 mutants having reduced abundance in the recovery pools as compared to the input pools, i.e. a higher input/ recovery ratio. Of these 78 mutants identified, 10 were previously confirmed to be attenuated in the septicemic mouse model. The remaining 68 mutants were analyzed in vitro as before by Southern blot analysis and sequencing. A total of 45 unique mutants were identified and were screened individually in the mouse model. When compared to wild type positive and negative medium controls, 8 of the 45 mutants caused no mortality in mice. 3.4. ORF identity determination The identity of each disrupted open reading frame (ORF) was determined by sequencing directly from the genomic DNA or from arbitrary and single primer PCR products. Sequencing directly from genomic DNA involved initially digesting the DNA with HindIII and EcoRI restriction enzymes. Restriction digestion was necessary due to the duplicate copies of ISS1 in the insertion site and resulted in the only complete extension of the sequencing product being into the chromosomal DNA (Fig. 1). This procedure circumvents the need for PCR amplification prior to sequencing and vastly improved the turnaround time for mutant identification. Using at least 200 bp immediately flanking the insertion site, BLASTN was performed to identify corresponding genomic sequence from the S. suis BLAST Server, provided by the S. suis P1/7 sequencing group at the Sanger Institute (http://www.sanger.ac.uk/cgi-bin/blast/submitblast/ s_suis). Subsequently, a complete ORF was predicted and used with BLASTX analysis for putative identification of the genes (BLASTX 2.2.12, AUG-07-2005, GenBank, non-redundant database). The top BLAST Hits and putative functions are shown in Table 3.

142

T.L. Wilson et al. / Veterinary Microbiology 122 (2007) 135–145

Fig. 1. Direct sequencing of gDNA flanking the plasmid insertion site. DNA was digested using HindIII and EcoRI prior to sequencing to allow a sequencing primer to be used close to the insertion site without generating multiple sequence products. Once digested, either a 50 or 30 primer was used to obtain a single chromosomal sequence from products A and B, respectively.

Table 3 Attenuation screen of Streptococcus suis serotype 2 # S735 pGh9:ISS1 STM mutants in septicemic models of CDCD pigs and CF-1 mice Locus hit

Putative function (organism)

GenBank protein IDa

Attenuationb in CDCD pigs

Attenuationb in CF-1 mice

cps2C lin0523 purA purD SP1724 (scrB) SP1725 (scrR) spyM3_0908

Putative role in chain length determination/export (S. suis) Similar to specificity determinant HsdS (Listeria innocua Clip11262) Adenylosuccinate synthetase (Streptococcus mutans UA159) Phosphoribosylamine-glycine ligase (S. suis) Sucrose-6-phosphate hydrolase (Streptococcus pneumoniae) Sucrose operon repressor (S. pneumoniae) Putative amino acid ABC transporter; permease protein (Streptococcus pyogenes) Probable transcriptional regulator—trehalose utilization (Clostridium perfringens)

AAD24449 CAC95755 AAN58036 BAB63438 AAK75801 AAK75802 AAM79515

0/3 0/6c 0/3 0/3 0/3 0/3 0/6c

0/3 0/3 0/3 0/3 0/3 0/3 0/3

BAB80269

0/3

0/3

neuB SP0498 (endoD) gtfA manN SMU_61

N-Acetylneuraminic acid synthetase (Streptococcus agalactiae) Similar to endo-beta-N-acetylglucosaminidase (S. pneumoniae) Sucrose phosphorylase (Listeria monocytogenes) Mannose-specific PTS IID (S. suis) Putative transcriptional regulator (S. mutans)

AAR25956 AAK74656 AAT03058 AAW21987 AAN57849

0/3 0/3 0/3 0/3 0/3

1/3 1/3 1/3 1/3 1/3

spr1018 nadR

Conserved hypothetical protein (S. pneumoniae) Transcriptional regulator (Streptococcus thermophilus)

AAK99822 AAV62030

1/3 1/3

0/3 0/3

glnH SP0844 (cdd) lpp

Hypothetical protein (S. pyogenes) Cytidine deaminase (S. pneumoniae) Lipoprotein (S. mutans)

AAL97931 AAK74975 AAY34517

1/3 1/3 1/3

1/3 1/3 1/3

Orf207

Putative protease-U32 peptidase family/collagenase (S. suis)

BAB83975

2/3

treR

guaA guaB SAG0907

GMP synthase (S. agalactiae) Inosine monophosphate dehydrogenase (S. thermophilus) Putative lipoprotein (S. agalactiae)

ABA459 AAV63526 AAM99793

6/6 3/3 3/3

Wild type

N/A

N/A

2/3

a

1/3 c

0/3 0/3 0/3 3/3

Top BLASTX hit. Mortality (number of animals/euthanized number of animals infected). c Two independent experiments (n = 3) were performed with mutants administered intravenously and intraperitoneally. The results in each experiment were the same. b

T.L. Wilson et al. / Veterinary Microbiology 122 (2007) 135–145

3.5. Evaluation of individual candidate mutants for virulence in CDCD pigs To determine attenuation in the natural porcine host, 14 mutants from the original mouse screen and 8 mutants from the pig screen were evaluated individually for virulence in CDCD pigs, using 3 animals per mutant group. No significant growth differences were observed in vitro, with all mutants reaching similar optical densities in approximately the same time frame (data not shown). Of the 22 mutants evaluated, inoculation of 13 resulted in 0% mortality in CDCD pigs compared to the wild type control which resulted in 66% mortality. Of these 13 mutants, 8 were also completely attenuated in CF-1 mice with 0% mortality compared to the wild type control at 100% mortality. Inoculation of 5 mutants resulted in 0% mortality in pigs and 33% mortality in mice. An additional subset of mutants caused 0% mortality in mice and 100% mortality in pigs. All identification and attenuation results for the 22 mutants are listed in Table 3.

4. Discussion In order to identify virulence genes necessary for in vivo survival, a signature-tagged mutagenesis (STM) system for S. suis was developed. Approximately 2600 S. suis serotype 2 S735 pGh9:ISS1 STM mutants were successfully constructed, assembled into 30 pools, and screened through a septicemic mouse model. The Luminex xMAP1 system was adapted for use with the STM process, allowing a higher throughput analysis of samples. A total of 174 insertion mutants were initially identified as possible attenuated mutants in the mouse and pig screens based on their relative absence from the recovered pool versus the input pool. In order to eliminate false positives and redundant mutants, we employed a combination of mouse screening, Southern blotting for identification of multiple insertion mutants, and sequencing of the insertion sites. This strategy narrowed the field to 22 unique mutants that were then screened through pigs to yield 8 mutants causing no mortality in either host species. The other remaining mutants caused varying numbers of mortality in the two animal models. The large number of mutants for screening necessitated the use of small group sizes, and

143

thus no conclusions should be made regarding the relative virulence of mutants. It is encouraging that virulence determinations were repeated for three of the mutants (Table 3) in an independent experiment, using an intraperitoneal rather than intravenous challenge, and the results were identical. The types of genes identified in this study were similar to categories obtained in previous STM screens. Several of the genes, including purA, purD, gtfA, scrB/R, and guaB/A, are known to be involved in the virulence of a variety of Gram positive and Gram negative organisms (Baumler et al., 1994; Garsin et al., 2001; McFarland and Stocker, 1987; Yamashita et al., 1993) and is further evidence of the validity of our STM screen. Two genes related to capsule synthesis, cps2C and neuB, were identified; however, only cps2C is located within the previously described capsule biosynthetic loci (Smith et al., 1999). Several ORFs important for the virulence of S. suis, such as treR, SMU_61 and nadR, have homologues that are putative transcriptional regulators in other Gram positive bacteria. The remaining genes include a variety of hypothetical and conserved proteins with similarity to putative lipoproteins, proteases, nucleases and transporters. The role of these genes in virulence is unknown. It was interesting to identify the gene for manN, whose product is the IID component of the mannosespecific phosphotransferase system. The manN product has recently been shown to play a negative regulatory role in the expression of suilysin, where a transposon insertion in manN resulted in a hyperhemolytic phenotype. This was reported as the first example of a carbohydrate-specific transport component that can regulate hemolysin gene expression (Lun and Willson, 2005). The importance of suilysin in the pathogenesis of S. suis is not entirely clear. While suilysin has been shown to be associated with virulent strains of S. suis (Staats et al., 1999), isogenic mutants lacking suilysin also seem to remain virulent (Allen et al., 2001; Lun et al., 2003) and there are virulent strains that do not produce suilysin (Staats et al., 1999). Our data demonstrate for the first time that a manN mutant is attenuated in both mice and pigs. Whether this attenuation is a result of the suilysin overexpression observed by Lun and Willson or the lack of a phosphotransferase metabolic function remains unclear.

144

T.L. Wilson et al. / Veterinary Microbiology 122 (2007) 135–145

The definition of virulence for S. suis has been problematic for the field (Gottschalk et al., 1999; Gottschalk and Segura, 2000). While there have been varied reports on the utility of a S. suis mouse model (Beaudoin et al., 1992; Vecht et al., 1997), we have found numerous genes (Table 3) that are similarly required for virulence in both host species examined. Exceptions to this correlation are the genes guaA, guaB and SAG0907, which seem to be required for virulence in mice but not in pigs. Given these results, a mouse model for STM screening will be useful when the wild type parent S. suis strain can be demonstrated to be virulent in mice. Since, we also initially screened STM pools 01–16 through a septicemic CDCD pig model, there are likely to be mutants identified during the pig screen that are only attenuated in the pig and not in the mouse. However, subsequent screening of individual mutants in pigs was not practical given the number of mutants to screen, and that the genes required for cross species virulence are of most interest as targets for possible vaccine target development. The S735 S. suis strain utilized in this study was originally a pneumonic isolate (de Moor, 1963) and differing reports of the virulence of the strain have been published (Charland et al., 1998; Vecht et al., 1996). Strain S735 is considered the serotype 2 reference strain and phenotypically is MRP+, EF*, suilysin+ (Vecht et al., 1996). In our experimental model using intravenous infection of CDCD pigs with 1  109 CFU, we repeatedly reproduced systemic infection, complete with CNS involvement. In the future, it would be interesting to use the STM system developed here to look for differences in virulence gene requirements among strains that lack MRP, EF and suilysin and in isolates of CNS origin. A STM screen in a strain lacking these factors may prove useful for better understanding the virulence of S. suis. In summary, a novel signature-tagged mutagenesis system was successfully used to identify a set of S. suis serotype 2 S735 mutants attenuated in septicemic mouse and CDCD pig models. Using Luminex technology, a novel method for STM screening was developed that significantly shortened the time required for screening and that is more cost effective than using a microarray based assay. Also, a new approach of sequencing restriction digested genomic DNA was utilized, allowing for direct sequencing of

the disrupted genes, despite the presence of significant repetitive sequences from duplicated ISS1 elements. We observed significant disease with the S735 type strain, observed a good correlation between the genes required for virulence in mouse and pig models using this strain, and identified several genes that have already been linked to the virulence of other organisms. The genes reported may be useful as candidates for targeted vaccine development; however, additional work, perhaps including STM screening of a variety of strains, will be required to truly understand the pathogenesis of this organism.

Acknowledgements The authors thank Stephen X. Behan, Heather R. Francis, James A. Jackson, Rika Jolie, Rob Keich, Vickie L. King, Albert MacKenzie, Paul Runnels, Gary J. Sibert, Lucas P. Taylor, Janet F. Teel, Sandra S. Walters, and the Animal Technicians at Pfizer Animal Health, Richland, MI.

References Allen, A.G., Bolitho, S., Lindsay, H., Khan, S., Bryant, C., Norton, P., Ward, P., Leigh, J., Morgan, J., Riches, H., Eastty, S., Maskell, D., 2001. Generation and characterization of a defined mutant of Streptococcus suis lacking suilysin. Infect. Immun. 69, 2732–2735. Autret, N., Charbit, A., 2005. Lessons from signature-tagged mutagenesis on the infectious mechanisms of pathogenic bacteria. FEMS Microbiol. Rev. 29, 703–717. Baumler, A.J., Kusters, J.G., Stojiljkovic, I., Heffron, F., 1994. Salmonella typhimurium loci involved in survival within macrophages. Infect. Immun. 62, 1623–1630. Beaudoin, M., Higgins, R., Harel, J., Gottschalk, M., 1992. Studies on a murine model for evaluation of virulence of Streptococcus suis capsular type 2 isolates. FEMS Microbiol. Lett. 78, 111–116. Charland, N., Harel, J., Kobisch, M., Lacasse, S., Gottschalk, M., 1998. Streptococcus suis serotype 2 mutants deficient in capsular expression. Microbiology 144, 325–332. de Moor, C.E., 1963. Septicaemic infections in pigs, caused by haemolytic streptococci of new Lancefield groups designated R, S, and T. Antonie Van Leeuwenhoek 29, 272–280. FASS, 1999. Guide for the Care and Use of Agricultural Animals in Agricultural Research and Teaching, First Revised Edition. Federation of Animal Science Societies, Savoy. Fuller, T.E., Kennedy, M.J., Lowery, D.E., 2000. Identification of Pasteurella multocida virulence genes in a septicemic mouse

T.L. Wilson et al. / Veterinary Microbiology 122 (2007) 135–145 model using signature-tagged mutagenesis. Microb. Pathog. 29, 25–38. Garsin, D.A., Sifri, C.D., Mylonakis, E., Qin, X., Singh, K.V., Murray, B.E., Calderwood, S.B., Ausubel, F.M., 2001. A simple model host for identifying Gram-positive virulence factors. Proc. Natl. Acad. Sci. U.S.A. 98, 10892–10897. Gottschalk, M., Segura, M., 2000. The pathogenesis of the meningitis caused by Streptococcus suis: the unresolved questions. Vet. Microbiol. 76, 259–272. Gottschalk, M., Lebrun, A., Wisselink, H., Dubreuil, J.D., Smith, H., Vecht, U., 1998. Production of virulence-related proteins by Canadian strains of Streptococcus suis capsular type 2. Can. J. Vet. Res. 62, 75–79. Gottschalk, M., Higgins, R., Quessy, S., 1999. Dilemma of the virulence of Streptococcus suis strains. J. Clin. Microbiol. 37, 4202–4203. Hensel, M., Shea, J.E., Gleeson, C., Jones, M.D., Dalton, E., Holden, D.W., 1995. Simultaneous identification of bacterial virulence genes by negative selection. Science 269, 400–403. ILAR, 1996, Guide for the care and use of laboratory animals / Institute of Laboratory Animals Resources, Commission on Life Sciences, National Research Council., 7th ed. National Academy Press, Washington, D.C., 125 pp. Jones, A.L., Knoll, K.M., Rubens, C.E., 2000. Identification of Streptococcus agalactiae virulence genes in the neonatal rat sepsis model using signature-tagged mutagenesis. Mol. Microbiol. 37, 1444–1455. Karlyshev, A.V., Pallen, M.J., Wren, B.W., 2000. Single-primer PCR procedure for rapid identification of transposon insertion sites. Biotechniques 28, 1078. Kebede, M., Chengappa, M.M., Stuart, J.G., 1990. Isolation and characterization of temperature-sensitive mutants of Streptococcus suis: efficacy trial of the mutant vaccine in mice. Vet. Microbiol. 22, 249–257. Lun, S., Willson, P.J., 2005. Putative mannose-specific phosphotransferase system component IID represses expression of suilysin in serotype 2 Streptococcus suis. Vet. Microbiol. 105, 169– 180. Lun, S., Perez-Casal, J., Connor, W., Willson, P.J., 2003. Role of suilysin in pathogenesis of Streptococcus suis capsular serotype 2. Microb. Pathog. 34, 27–37. Maguin, E., Prevost, H., Ehrlich, S.D., Gruss, A., 1996. Efficient insertional mutagenesis in lactococci and other Gram-positive bacteria. J. Bacteriol. 178, 931–935. McFarland, W.C., Stocker, B.A., 1987. Effect of different purine auxotrophic mutations on mouse-virulence of a Vi-positive strain of Salmonella dublin and of two strains of Salmonella typhimurium. Microb. Pathog. 3, 129–141. Miller, J.D., Neely, M.N., 2005. Large-scale screen highlights the importance of capsule for virulence in the zoonotic pathogen Streptococcus iniae. Infect. Immun. 73, 921–934.

145

Paik, S., Senty, L., Das, S., Noe, J.C., Munro, C.L., Kitten, T., 2005. Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis. Infect. Immun. 73, 6064–6074. Polissi, A., Pontiggia, A., Feger, G., Altieri, M., Mottl, H., Ferrari, L., Simon, D., 1998. Large-scale identification of virulence genes from Streptococcus pneumoniae. Infect. Immun. 66, 5620–5629. Saenz, H.L., Dehio, C., 2005. Signature-tagged mutagenesis: technical advances in a negative selection method for virulence gene identification. Curr. Opin. Microbiol. 8, 612–619. Slater, J.D., Allen, A.G., May, J.P., Bolitho, S., Lindsay, H., Maskell, D.J., 2003. Mutagenesis of Streptococcus equi and Streptococcus suis by transposon Tn917. Vet. Microbiol. 93, 197–206. Smith, H.E., Damman, M., van der Velde, J., Wagenaar, F., Wisselink, H.J., Stockhofe-Zurwieden, N., Smits, M.A., 1999. Identification and characterization of the cps locus of Streptococcus suis serotype 2: the capsule protects against phagocytosis and is an important virulence factor. Infect. Immun. 67, 1750–1756. Smith, H.E., Buijs, H., Wisselink, H.J., Stockhofe-Zurwieden, N., Smits, M.A., 2001. Selection of virulence-associated determinants of Streptococcus suis serotype 2 by in vivo complementation. Infect. Immun. 69, 1961–1966. Staats, J.J., Plattner, B.L., Stewart, G.C., Changappa, M.M., 1999. Presence of the Streptococcus suis suilysin gene and expression of MRP and EF correlates with high virulence in Streptococcus suis type 2 isolates. Vet. Microbiol. 70, 201–211. Takamatsu, D., Osaki, M., Sekizaki, T., 2001. Construction and characterization of Streptococcus suis–Escherichia coli shuttle cloning vectors. Plasmid 45, 101–113. Vecht, U., Wisselink, H.J., Stockhofe-Zurwieden, N., Smith, H.E., 1996. Characterization of virulence of the Streptococcus suis serotype 2 reference strain Henrichsen S 735 in newborn gnotobiotic pigs. Vet. Microbiol. 51, 125–136. Vecht, U., Stockhofe-Zurwieden, N., Tetenburg, B.J., Wisselink, H.J., Smith, H.E., 1997. Murine and pig models of Streptococcus suis type 2 infections are incompatible. Adv. Exp. Med. Biol. 418, 827–829. Wilson, K., 1997. Preparation of genomic DNA from bacteria. In: Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G.,Smith, J.A., Struhl, K. (Eds.), Current Protocols in Molecular Biology. John Wiley and Sons, New York, pp. 2.4.1–2.4.5. Yamashita, Y., Bowen, W.H., Burne, R.A., Kuramitsu, H.K., 1993. Role of the Streptococcus mutans gtf genes in caries induction in the specific-pathogen-free rat model. Infect. Immun. 61, 3811– 3817. Yu, H., Jing, H., Chen, Z., Zheng, H., Zhu, X., Wang, H., Wang, S., Liu, L., Zu, R., Luo, L., Xiang, N., Liu, H., Liu, X., Shu, Y., Lee, S., Chuang, S., Wang, Y., Xu, J., Yang, W., China, S.S.G., 2006. Human Streptococcus suis outbreak, Sichuan, China. Emerg. Infect. Dis. 12, 914–920.