- Email: [email protected]
A novel single-stranded DNA enzyme expression system using HIV-1 reverse transcriptase
BBRC Biochemical and Biophysical Research Communications 301 (2003) 535–539 www.elsevier.com/locate/ybbrc
A novel single-stranded DNA enzyme expression system using HIV-1 reverse transcriptase Akiko Kusunoki,a Naoko Miyano-Kurosaki,a,b and Hiroshi Takakua,b,* a b
Department of Industrial Chemistry, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016, Japan High Technology Research Center, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016, Japan Received 19 December 2002
Abstract In this study, we exploited a DNA enzyme expression system using the mechanism of HIV-1 reverse transcription in vitro. HIV-1 reverse transcription is initiated when its cognate primer tRNA (Lys-3) binds to the primer binding site (PBS) of the viral RNA template. Therefore, this RNA contains the HIV-1 PBS, the DNA enzyme, and a tRNA (Lys-3) at the 30 -end of its RNA transcript, such that a single-stranded DNA (ssDNA) is synthesized by the HIV-1 reverse transcriptase. We constructed RNA expression vectors including the HIV-1 PBS, the DNA enzyme, and either a native tRNA (Lys-3) or one of two truncated tRNAs (Lys-3), DtRNA (Lys-3) and DDtRNA (Lys-3). The reactions of the pVAX1-Dz-tRNA (Lys-3), pVAX1-Dz-DtRNA (Lys-3), and pVAX1Dz-DDtRNA (Lys-3) vectors with T7 RNA polymerase in vitro gave the corresponding RNAs. The liberated RNAs were treated with HIV-1 reverse transcriptase (HIV-1 RT) in vitro, which yielded the corresponding ssDNA. The cleavage assay results demonstrated that the expressed DNA enzyme has cleavage ability against the target sequence. Thus, we have found a new DNA enzyme oligonucleotide expression system using the HIV-1 reverse transcriptase in vitro. Ó 2003 Elsevier Science (USA). All rights reserved. Keywords: ssDNA expression vector; DNA enzyme; tRNA (Lys-3); Primer binding site (PBS); HIV-1 reverse transcriptase
Antisense and ribozyme technologies are major tools in gene inactivation for gene therapy. Approaches mediated by RNA-cleaving ribozymes are more attractive, because of their ability to cleave the target RNA catalytically [1–6]. However, these molecules (both as native nucleic acids and in modified forms) are highly susceptible to enzymatic hydrolysis, and have the potential for side effects in a cellular environment, thus limiting their pharmaceutical applications in a direct delivery mode. Recently, a new class of catalytic molecules, made of single-stranded DNA (deoxyribozyme or DNA enzyme), was obtained through in vitro selection [7–14]. One model, denoted as the deoxyribozyme, was especially useful because of its ability to bind and cleave any single-stranded RNA at purine/pyrimidine junctions [13]. The DNA enzyme is similar to hammerhead ribo-
* Corresponding author. Fax: +81-474-71-8764. E-mail address: [email protected] (H. Takaku).
zymes, at least in terms of its secondary structure, with two binding arms and a catalytic loop that captures the indispensable catalytic metal ions. The sequence-specific cleavage activities of short DNA molecules possessing two previously identified catalytic motifs (10–23 and 8– 17) [13] have recently been recognized as a powerful biological tool to interfere with gene expression. Furthermore, these RNA-cleaving DNA enzymes are expected to be more stable than short catalytic RNAs (ribozymes), which are inherently less stable. A number of investigators have reported the sequence-specific cleavage of a variety of target RNAs, including HIV-1 RNA [15–24]. The inhibition of infection by an incoming HIV-1 was reported earlier by Zhang et al. [16], who used DNA enzymes that were targeted against the V3 loop of the envelope region. Generally, DNA enzymes are synthesized chemically. However, an enzyme-associated method of expressing the DNA enzyme has not yet been reported. In this study, we describe a new system design for single-stranded DNA expression using HIV-1 RT. We
0006-291X/03/$ - see front matter Ó 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S0006-291X(02)03067-X
536
A. Kusunoki et al. / Biochemical and Biophysical Research Communications 301 (2003) 535–539
found that the expressed DNA enzymes have sitespecific cleavage activity in vitro.
Results and discussion Single-stranded DNA enzyme expression by using HIV-1 reverse transcriptase
Materials and methods Construction of plasmids. After digestions with KpnI and BamHI, the synthesized DNA enzyme complementary sequences and the PBS sequence, including the KpnI and BamHI restriction sites, were inserted into the RNA transcription vector, pVAX1 (Ca. No. V260-20; Invitrogen, Groningen, Netherlands). Then, the native tRNA (Lys-3), DtRNA (Lys-3), and DDtRNA (Lys-3), which include BamHI and EcoRI restriction sites, were each subcloned into pVAX1, bearing the DNA enzyme complementary sequence and the PBS sequence. Moreover, the native tRNA (Lys-3) was subcloned into pVAX1, bearing the DNA enzyme complementary sequence that has two binding arms composed of random sequences and the PBS sequence, as a control. These plasmids (pVAX1-Dz-tRNA (Lys-3), pVAX1-DzDtRNA (Lys-3), pVAX1-Dz-DDtRNA (Lys-3), and pVAX1-RantRNA (Lys-3)) were used to generate the in vitro template RNA transcripts. DNA enzyme and its target. Based on Santoro and JoyceÕs report, we designed an RNA cleaving DNA enzyme using the described catalytic active site. This DNA enzyme includes an AU in the V3 loop region (7196–7210, according to the GenBank Accession No. AF324493) of the NL4-3 env mRNA, as reported by Zhang et al. [16]. In vitro transcription reaction by T7 RNA polymerase and reverse transcription reaction by HIV-1 reverse transcriptase. The RNA transcription plasmids were used as templates with a T7 transcription kit (EPICENTRE Tech., Wisconsin, USA) to produce the RNA transcripts. The integrity of the RNA transcripts was routinely monitored on 8% polyacrylamide gels containing 7 M urea, prior to use in the reverse transcription reaction. The RNA transcripts (30 pmol) were annealed onto themselves by incubations at 65 °C for 5 min and room temperature for 30 min, in a 5 ll reaction mixture containing 40 mM Tris–HCl (pH 8.0) and 50 mM KCl. These annealed tRNA (Lys-3)template RNA complexes were directly subjected to the following in vitro reverse transcription reaction. The primer tRNA was extended by HIV-1 reverse transcriptase in a 10 ll reaction, containing 50 mM Tris– HCl (pH 8.0), 50 mM KCl, 8 mM MgCl2 , 2 mM dithiothreitol, 10 U RNase inhibitor (TOYOBO, Tokyo, Japan), 2 mM dNTPs, and 5 U HIV-1 Reverse transcriptase (SEIKAGAKU, Tokyo, Japan) at 37 °C for 2 h. After an RNase A (SIGMA, Missouri, USA) digestion at 37 °C for 2 h, a phenol:chloroform extraction was performed. Equal volumes of the reverse-transcribed ssDNA, used as the DNA enzyme for the in vitro cleavage reaction, were monitored on 12% polyacrylamide gels containing 7 M urea. Detection of ssDNA by PCR. To confirm the expressed ssDNA in vitro, a PCR was carried out using the expression ssDNA-specific primers, 50 -GTTACAAGGCTAGCTACAAC-30 and 50 -AGACCCAA GCTGGCT-30 . ssDNA was used as the template and was pretreated with either RNase A or S1 nuclease (Promega, Madison, USA) for 30 min at 37 °C. The pretreated ssDNA samples were then PCR amplified at 94 °C for 2 min, and then for 30 cycles: 94 °C for 15 s, 45 °C for 30 s, and 68 °C for 30 s. The PCR products were analyzed on a 12% polyacrylamide gel. In vitro cleavage reaction using the expression DNA enzyme. The 50 FITC labeled substrate RNA (50 -FITC-HIV-1-env-mRNA), 50 -UGA GACAAGCACAUUGUAACAUUAG-30 (7191–7215, according to the GenBank Accession No. AF324493), was incubated for 1 h at 37 °C with an expression ssDNA enzyme, in a buffer containing 50 mM Tris– HCl (pH 7.5) and 25 mM MgCl2 , in a reaction volume of 10 ll. The products were then denatured at 95 °C for 3 min. The cleaved, labeled RNA products were resolved by electrophoresis on an 18% polyacrylamide gel and were analyzed by a fluorescent image reader (FLA2000G; FUJIFILM, Tokyo, Japan).
We have designed a novel DNA enzyme oligonucleotide expression system using the HIV-1 reverse transcriptase in vitro. We constructed ssDNA expression vectors (pVAX1Dz-tRNA (Lys-3), pVAX1-Dz-DtRNA (Lys-3), and pVAX1-Dz-DDtRNA (Lys-3)) including the DNA enzyme, the HIV-1 primer binding site (HIV-1 PBS), and either a native tRNA (Lys-3), or one of two truncated tRNAs, DtRNA (Lys-3) and DDtRNA (Lys-3) (Fig. 1A). We also constructed a control vector, pVAX1-RantRNA (Lys-3). The DtRNA (Lys-3) lacked the D-stemloop, the anticodon-stem loop, and the variable loop, while the DDtRNA (Lys-3) lacked the D-stem-loop, the anticodon-stem loop, the variable loop, and the 50 -end strand from the full-length tRNA (Lys-3) (Fig. 1B). The native tRNA (Lys-3) was subcloned into pVAX1, bearing the DNA enzyme complementary sequence that has two binding arms with random sequences and the PBS sequence, as a control vector, pVAX1-Ran-tRNA. Sequences encoding an active fragment of the DNA enzyme that contained the 10–23 catalytic motif, as described by Santoro and Joyce [13], the HIV-1 PBS, and three different lengths of tRNAs (Lys-3) were inserted between the KpnI and EcoRI restriction sites of the RNA transcription vector, pVAX1. The DNA enzyme sequence was placed between two oligonucleotide arms that are complementary and able to target the V3-loop of the HIV-1 env mRNA specifically (7196–7210, according to the GenBank Accession No. AF324493) (env-Dz of Figs. 1C and 4A), as reported by Zhang et al. [16], or two arms composed of random sequences, as a control (Ran-Dz of Fig. 1C). These ssDNA expression vectors were linearized at the EcoRI site. When the reaction mixture was subjected to in vitro transcription, the corresponding RNAs, 183, 142, and 122 nt transcripts, were synthesized from immediately after the T7 promoter (Fig. 2A). We made use of the HIV-1 reverse transcription mechanism to construct DNA enzyme expression vectors against HIV-1. The HIV-1 reverse transcription is initiated when its cognate primer tRNA (Lys-3) binds the PBS of the viral RNA template. Therefore, this expression plasmid contains the HIV-1 PBS and the tRNA (Lys-3) at the 30 -end of its RNA transcript, so that a ssDNA would be synthesized by the HIV-1 reverse transcriptase (Fig. 1). The RNA transcripts were incubated to allow selfannealing. The tRNA (Lys-3)-template RNA complexes were directly subjected to the following in vitro reverse transcription reaction. The reaction mixture was treated with RNase A and then a phenol:chloroform extraction was performed.
A. Kusunoki et al. / Biochemical and Biophysical Research Communications 301 (2003) 535–539
537
Fig. 1. Schematic representations of in vitro transcription and reverse transcription. (A) The DNA enzyme, the HIV-1 primer binding site (PBS), and either the native tRNA (Lys-3), DtRNA (Lys-3) or DDtRNA (Lys-3) were sub-cloned into the pVAX1 vector downstream of the T7 promoter. (B) The predicted secondary structure of the T7 transcript. (C) The strategy used to generate an in vitro reverse transcript using HIV-1 RT.
As shown in Fig. 1B, the native tRNA (Lys-3), DtRNA (Lys-3), and DDtRNA (Lys-3)-PBS complexes played the role as the primer for the HIV-1 reverse transcriptase. Furthermore, the reverse transcripts, the ssDNA from the template RNA (Fig. 2A), were showed the production of the expected 69 base band (Fig. 2B). These results suggest that the three different tRNA (Lys3) primers can express the expected size of the DNA enzyme (69 bases) from the corresponding pVAX1-Dz vectors. Furthermore, we found that the native tRNA (Lys-3) has higher DNA enzyme expression than those of the DtRNA (Lys-3) and DDtRNA (Lys-3) (Fig. 2B).
Detection of ssDNA by PCR analysis To confirm the in vitro ssDNA expression from the pVAX1-Dz-tRNA (Lys-3), pVAX1-Dz-DtRNA (Lys-3), and pVAX1-Dz-DDtRNA (Lys-3) plasmids, PCR methods were used to detect ssDNA. The PCR amplification was carried out using the expressed ssDNA specific primers 50 -GTTACAAGGCTAGCTACAAC-30 and 50 -AGACCCAAGCTGGCT-30 . The PCR products were pretreated with RNase A. The results are shown in Fig. 3A. The bands of the expected size (env DNA enzyme: 69 bp; 50 -GTTACAAGGCTAGCTACAAC
538
A. Kusunoki et al. / Biochemical and Biophysical Research Communications 301 (2003) 535–539
tions treated with S1 nuclease, a highly specific ssDNA endonuclease, resulted in no amplified products (Fig. 3B, lanes 3–5). Furthermore, the 100% homologous DNA enzyme sequence was confirmed with a Gene sequencer (ABI PRISM 310, genetic analyzer, Perkin– Elmer/Applied Biosystems, Foster, CA).
Sequence-specific cleavage activities of the expressed DNA enzyme for the env-mRNA substrate
Fig. 2. Detection of the RNA and ssDNA transcripts. (A) The RNA transcripts from pVAX1-Dz-tRNA (lane 2) (183 nt), pVAX1-DzDtRNA (lane 3) (142 nt), and pVAX1-Dz-DDtRNA (lane 4) (122 nt) were routinely checked on 8% polyacrylamide gels containing 7 M urea. Lane 1 is RNA Markers (Novagen, Germany). (B) The reverse transcripts from template RNA transcripts from pVAX1-Dz-tRNA (lane 1), pVAX1-Dz-DtRNA (lane 2), and pVAX1-Dz-DDtRNA (lane 3) were checked on 12% polyacrylamide gels containing 7 M urea. Lane 4 is a 10 bp DNA step Ladder Marker (Promega, Madison, USA). Lane 5 is a 50 bp DNA step Ladder Marker (Promega, Madison, USA).
Fig. 3. Detection of ssDNA using PCR. To confirm the ssDNA expression in vitro, a PCR was carried out using the expressed ssDNAspecific primer. The ssDNA used as the template was pretreated with either RNase A (A) or S1 nuclease for 30 min at 37 °C (B). PCR products were analyzed on a 12% polyacrylamide gel. Lane 1, 100 bp DNA step Ladder Marker (Promega, Madison, USA). Lane 2, 10 bp DNA step Ladder Marker (Promega, Madison, USA). Lane 3, pVAX1-Dz-tRNA; lane 4, pVAX1-Dz-DtRNA; and lane 5, pVAX1Dz-DDtRNA. The band of the expected size is marked by an arrow.
GAGTGCTTGGGTACCAAGCTTAAGTTTAAAC GCTAGCCAGCTTGGGTCT-30 ) of the pVAX1Dz-tRNA (Lys-3), pVAX1-Dz-DtRNA (Lys-3), and pVAX1-Dz-DDtRNA (Lys-3) plasmids were produced with RNase A (Fig. 3A, lanes 3–5). Control prepara-
To test the possible application of the expressed envDNA enzyme (env-Dz) against the target sequence, we investigated their cleavage activities against the env mRNA substrate in vitro. To determine whether the DNA enzyme cleaved the RNA, we synthesized a substrate composed of 25 nucleotides (50 -UGAGACAA GCACAUUGUAACAUUAG-30 ; 7191–7215), including the V3-loop of the env mRNA region. Reactions were performed in 50 mM Tris–HCl (pH 7.5) and 25 mM MgCl2 under single turnover conditions at 37 °C. The env-DNA enzyme cleaved this 25 nucleotide RNA (labeled with FITC at the 50 end, 50 -FITC-HIV-1-envmRNA) (Fig. 4A). The product fragments and the unreacted substrate in these samples were resolved by electrophoresis on an 18% polyacrylamide gel. The extent of the reaction at each time point was determined by densitometry of the gel image produced through FLA-2000G images (FUJIFILM, Tokyo, Japan) (Fig. 4B). As shown in Fig. 4, after treatment of the 50 -FITCHIV-1-env-mRNA with env-Dz, the strength of the substrate env-mRNA band became weak, whereas the strength of the cleavage product band increased in intensity (Fig. 4B, lanes 2 and 4). In contrast, the control Ran-Dz band did not yield any cleavage product (Fig. 4B, lane 6). Furthermore, with the env-Dz treatment, an increase in the cleavage product was found with an increase in the env-Dz concentration (Figs. 4B and C). These results suggest that the expressed ssDNA, from the pVAX1-Dz-DtRNA (Lys-3), pVAX1-Dz-DtRNA (Lys-3), and pVAX1-Dz-DDtRNA (Lys-3) plasmids, contains the sequence for the env-DNA enzyme function as well as the flanking arms complementary to the HIV1 V3-loop of the env mRNA. Thus, the expressed envDNA enzyme can cleave the target RNA substrate. In this study, we constructed a ssDNA expression vector including the HIV-1 PBS, the DNA enzyme, and either a native tRNA (Lys 3) or one of two truncated tRNAs (Lys-3), (DtRNA (Lys-3) and DDtRNA (Lys-3)). The reactions of the pVAX1-Dz-tRNA (Lys-3), pVAX1-Dz-DtRNA (Lys-3), and pVAX1-DzDDtRNA (Lys-3) vectors with T7 RNA polymerase in vitro gave the corresponding RNAs. The liberated RNAs were treated with the HIV-1 reverse transcriptase in vitro, which gave the corresponding ssDNA. The cleavage assay results demonstrated that the expressed
A. Kusunoki et al. / Biochemical and Biophysical Research Communications 301 (2003) 535–539
Fig. 4. Cleavage of substrate RNA by the expressed DNA enzyme. (A) Proposed structure of the in vitro cleavage of substrate RNA with the expressed DNA enzyme. (B) The substrate RNA (50 -FITC-HIV-1-envmRNA) was treated with 20 pmol env-Dz (lanes 1 and 2) or 200 pmol env-Dz (lanes 3 and 4) or 200 pmol Ran-Dz as a control (lanes 5 and 6), in the presence of 25 mM MgCl2 in 50 mM Tris–HCl (pH 7.5) buffer for 0 or 60 min. The cleavage labeled RNA products were resolved by electrophoresis on an 18% polyacrylamide gel. (C) The percentage of substrate at 0 min was normalized as 100%. The cleavage labeled RNA products were analyzed by a fluorescent image reader (FLA-2000G).
DNA enzyme has cleavage ability against the target sequence. This novel system may be applied to ssDNA expression in vivo.
Acknowledgments This work was supported in part by a Grant-in-Aid for High Technology Research, from the Ministry of Education, Science, Sports and Culture, Japan, a Grant from the Japan Society for the Promotion of Science in the ‘‘Research for the Future’’ program (JSPSRFTF97L00593), and a Sasagawa Scientific Research Grant from The Japan Science Society.
References [1] J. Goodchild, Hammerhead ribozymes: biochemical and chemical considerations, Curr. Opin. Mol. Ther. 2 (2000) 272–281. [2] A.S. Lewin, W.W. Hauswirth, Ribozyme gene therapy: applications for molecular medicine, Trends Mol. Med. 7 (2001) 221–228.
539
[3] R. Shippy, R. Lockner, M. Farnsworth, A. Hampel, The hairpin ribozyme. Discovery, mechanism, and development for gene therapy, Mol. Biotechnol. 12 (1999) 117–129. [4] L.Q. Sun, J.A. Ely, W.L. Gerlach, G. Symonds, Anti-HIV ribozymes, Mol. Biotechnol. 7 (1997) 241–251. [5] R.H. Symonds, Small catalytic RNAs, Annu. Rev. Biochem. 61 (1992) 641–671. [6] N.K. Vaish, A.R. Kore, F. Eckstein, Recent developments in the hammerhead ribozyme field, Nucleic Acids Res. 26 (1998) 5237– 5242. [7] R.R. Breaker, G.F. Joyce, A DNA enzyme that cleaves RNA, Chem. Biol. 1 (1994) 223–229. [8] R.R. Breaker, G.F. Joyce, A DNA enzyme with Mg2þ -dependent RNA phosphoesterase activity, Chem. Biol. 2 (1995) 655–660. [9] R.R. Breaker, DNA enzymes, Nat. Biotechnol. 15 (1997) 427–431. [10] R.R. Breaker, Catalytic DNA: in training and seeking employment, Nat. Biotechnol. 17 (1999) 422–423. [11] C.R. Geyer, D. Sen, Evidence for the metal-cofactor independence of an RNA phosphodiester-cleaving DNA enzyme, Chem. Biol. 4 (1997) 579–593. [12] Y. Li, R.B. Breaker, Deoxyribozymes: new players in the ancient game of biocatalysis, Curr. Opin. Struct. Biol. 9 (1999) 315–323. [13] S.W. Santoro, G.F. Joyce, A general purpose RNA-cleaving DNA enzyme, Proc. Natl. Acad. Sci. USA 94 (1997) 4262–4266. [14] L.Q. Sun, M.J. Cairns, E.G. Saravolac, A. Baker, W.L. Gerlach, Catalytic nucleic acids: from lab to applications, Pharmacol. Rev. 52 (2000) 325–347. [15] F.S. Santiago, H.C. Lowe, M.M. Kavurma, C.N. Chesterman, A. Baker, D.G. Atkins, L.M. Khachigian, New DNA enzyme targeting Egr-1 mRNA inhibits vascular smooth muscle proliferation and regrowth after injury, Nat. Med. 11 (1999) 1264–1269. [16] X. Zhang, Y. Xu, H. Ling, T. Hattori, Inhibition of infection of incoming HIV-1 virus by RNA-cleaving DNA enzyme, FEBS Lett. 458 (1999) 151–156. [17] L.Q. Sun, M.J. Cairns, W.L. Gerlach, C. Witherington, L. Wang, A. King, Suppression of smooth muscle cell proliferation by a cmyc RNA-cleaving deoxyribozyme, J. Biol. Chem. 274 (1999) 17236–17241. [18] Y. Wu, L. Yu, R. McMahon, J.J. Rossi, S.J. Forman, D.S. Snyder, Inhibition of bcr-abl oncogene expression by novel deoxyribozymes (DNAzymes), Hum Gene Ther. 10 (1999) 2847– 2857. [19] S. Basu, B. Sriram, R. Goila, A.C. Banerjea, Targeted cleavage of HIV-1 coreceptor-CXCR-4 by RNA-cleaving DNA-enzyme: inhibition of coreceptor function, Antiviral Res. 46 (2000) 125– 134. [20] T. Toyoda, Y. Imamura, H. Takaku, T. Kashiwagi, K. Hara, J. Iwahashi, Y. Ohtsu, N. Tsumara, H. Kato, N. Hamada, Inhibition of influenza virus replication in cultured cells by RNAcleaving DNA enzyme, FEBS Lett. 481 (2000) 113–116. [21] B. Sriram, A.C. Banerjea, In vitro-selected RNA cleaving DNA enzymes from a combinatorial library are potent inhibitors of HIV-1 gene expression, Biochem. J. 352 (2000) 667–673. [22] H. Unwalla, A.C. Banerjea, Inhibition of HIV-1 gene expression by novel macrophage-tropic DNA enzymes targeted to cleave HIV-1 TAT/Rev RNA, Biochem. J. 357 (2001) 147–155. [23] L. Zhang, W.J. Gasper, S.A. Stass, O.B. Ioffe, M.A. Davis, A.J. Mixson, Angiogenic inhibition mediated by a DNAzyme that targets vascular endothelial growth factor receptor 2, Cancer Res. 62 (2002) 5463–5469. [24] L.M. Khachigian, R.G. Fahmy, G. Zhang, Y.V. Bobryshev, A. Kaniaros, c-Jun regulates vascular smooth muscle cell growth and neointima formation after arterial injury. Inhibition by a novel DNA enzyme targeting c-Jun, J. Biol. Chem. 277 (2002) 22985– 22991.
A novel single-stranded DNA enzyme expression system using HIV-1 reverse transcriptase Akiko Kusunoki,a Naoko Miyano-Kurosaki,a,b and Hiroshi Takakua,b,* a b
Department of Industrial Chemistry, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016, Japan High Technology Research Center, Chiba Institute of Technology, 2-17-1 Tsudanuma, Narashino, Chiba 275-0016, Japan Received 19 December 2002
Abstract In this study, we exploited a DNA enzyme expression system using the mechanism of HIV-1 reverse transcription in vitro. HIV-1 reverse transcription is initiated when its cognate primer tRNA (Lys-3) binds to the primer binding site (PBS) of the viral RNA template. Therefore, this RNA contains the HIV-1 PBS, the DNA enzyme, and a tRNA (Lys-3) at the 30 -end of its RNA transcript, such that a single-stranded DNA (ssDNA) is synthesized by the HIV-1 reverse transcriptase. We constructed RNA expression vectors including the HIV-1 PBS, the DNA enzyme, and either a native tRNA (Lys-3) or one of two truncated tRNAs (Lys-3), DtRNA (Lys-3) and DDtRNA (Lys-3). The reactions of the pVAX1-Dz-tRNA (Lys-3), pVAX1-Dz-DtRNA (Lys-3), and pVAX1Dz-DDtRNA (Lys-3) vectors with T7 RNA polymerase in vitro gave the corresponding RNAs. The liberated RNAs were treated with HIV-1 reverse transcriptase (HIV-1 RT) in vitro, which yielded the corresponding ssDNA. The cleavage assay results demonstrated that the expressed DNA enzyme has cleavage ability against the target sequence. Thus, we have found a new DNA enzyme oligonucleotide expression system using the HIV-1 reverse transcriptase in vitro. Ó 2003 Elsevier Science (USA). All rights reserved. Keywords: ssDNA expression vector; DNA enzyme; tRNA (Lys-3); Primer binding site (PBS); HIV-1 reverse transcriptase
Antisense and ribozyme technologies are major tools in gene inactivation for gene therapy. Approaches mediated by RNA-cleaving ribozymes are more attractive, because of their ability to cleave the target RNA catalytically [1–6]. However, these molecules (both as native nucleic acids and in modified forms) are highly susceptible to enzymatic hydrolysis, and have the potential for side effects in a cellular environment, thus limiting their pharmaceutical applications in a direct delivery mode. Recently, a new class of catalytic molecules, made of single-stranded DNA (deoxyribozyme or DNA enzyme), was obtained through in vitro selection [7–14]. One model, denoted as the deoxyribozyme, was especially useful because of its ability to bind and cleave any single-stranded RNA at purine/pyrimidine junctions [13]. The DNA enzyme is similar to hammerhead ribo-
* Corresponding author. Fax: +81-474-71-8764. E-mail address: [email protected] (H. Takaku).
zymes, at least in terms of its secondary structure, with two binding arms and a catalytic loop that captures the indispensable catalytic metal ions. The sequence-specific cleavage activities of short DNA molecules possessing two previously identified catalytic motifs (10–23 and 8– 17) [13] have recently been recognized as a powerful biological tool to interfere with gene expression. Furthermore, these RNA-cleaving DNA enzymes are expected to be more stable than short catalytic RNAs (ribozymes), which are inherently less stable. A number of investigators have reported the sequence-specific cleavage of a variety of target RNAs, including HIV-1 RNA [15–24]. The inhibition of infection by an incoming HIV-1 was reported earlier by Zhang et al. [16], who used DNA enzymes that were targeted against the V3 loop of the envelope region. Generally, DNA enzymes are synthesized chemically. However, an enzyme-associated method of expressing the DNA enzyme has not yet been reported. In this study, we describe a new system design for single-stranded DNA expression using HIV-1 RT. We
0006-291X/03/$ - see front matter Ó 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S0006-291X(02)03067-X
536
A. Kusunoki et al. / Biochemical and Biophysical Research Communications 301 (2003) 535–539
found that the expressed DNA enzymes have sitespecific cleavage activity in vitro.
Results and discussion Single-stranded DNA enzyme expression by using HIV-1 reverse transcriptase
Materials and methods Construction of plasmids. After digestions with KpnI and BamHI, the synthesized DNA enzyme complementary sequences and the PBS sequence, including the KpnI and BamHI restriction sites, were inserted into the RNA transcription vector, pVAX1 (Ca. No. V260-20; Invitrogen, Groningen, Netherlands). Then, the native tRNA (Lys-3), DtRNA (Lys-3), and DDtRNA (Lys-3), which include BamHI and EcoRI restriction sites, were each subcloned into pVAX1, bearing the DNA enzyme complementary sequence and the PBS sequence. Moreover, the native tRNA (Lys-3) was subcloned into pVAX1, bearing the DNA enzyme complementary sequence that has two binding arms composed of random sequences and the PBS sequence, as a control. These plasmids (pVAX1-Dz-tRNA (Lys-3), pVAX1-DzDtRNA (Lys-3), pVAX1-Dz-DDtRNA (Lys-3), and pVAX1-RantRNA (Lys-3)) were used to generate the in vitro template RNA transcripts. DNA enzyme and its target. Based on Santoro and JoyceÕs report, we designed an RNA cleaving DNA enzyme using the described catalytic active site. This DNA enzyme includes an AU in the V3 loop region (7196–7210, according to the GenBank Accession No. AF324493) of the NL4-3 env mRNA, as reported by Zhang et al. [16]. In vitro transcription reaction by T7 RNA polymerase and reverse transcription reaction by HIV-1 reverse transcriptase. The RNA transcription plasmids were used as templates with a T7 transcription kit (EPICENTRE Tech., Wisconsin, USA) to produce the RNA transcripts. The integrity of the RNA transcripts was routinely monitored on 8% polyacrylamide gels containing 7 M urea, prior to use in the reverse transcription reaction. The RNA transcripts (30 pmol) were annealed onto themselves by incubations at 65 °C for 5 min and room temperature for 30 min, in a 5 ll reaction mixture containing 40 mM Tris–HCl (pH 8.0) and 50 mM KCl. These annealed tRNA (Lys-3)template RNA complexes were directly subjected to the following in vitro reverse transcription reaction. The primer tRNA was extended by HIV-1 reverse transcriptase in a 10 ll reaction, containing 50 mM Tris– HCl (pH 8.0), 50 mM KCl, 8 mM MgCl2 , 2 mM dithiothreitol, 10 U RNase inhibitor (TOYOBO, Tokyo, Japan), 2 mM dNTPs, and 5 U HIV-1 Reverse transcriptase (SEIKAGAKU, Tokyo, Japan) at 37 °C for 2 h. After an RNase A (SIGMA, Missouri, USA) digestion at 37 °C for 2 h, a phenol:chloroform extraction was performed. Equal volumes of the reverse-transcribed ssDNA, used as the DNA enzyme for the in vitro cleavage reaction, were monitored on 12% polyacrylamide gels containing 7 M urea. Detection of ssDNA by PCR. To confirm the expressed ssDNA in vitro, a PCR was carried out using the expression ssDNA-specific primers, 50 -GTTACAAGGCTAGCTACAAC-30 and 50 -AGACCCAA GCTGGCT-30 . ssDNA was used as the template and was pretreated with either RNase A or S1 nuclease (Promega, Madison, USA) for 30 min at 37 °C. The pretreated ssDNA samples were then PCR amplified at 94 °C for 2 min, and then for 30 cycles: 94 °C for 15 s, 45 °C for 30 s, and 68 °C for 30 s. The PCR products were analyzed on a 12% polyacrylamide gel. In vitro cleavage reaction using the expression DNA enzyme. The 50 FITC labeled substrate RNA (50 -FITC-HIV-1-env-mRNA), 50 -UGA GACAAGCACAUUGUAACAUUAG-30 (7191–7215, according to the GenBank Accession No. AF324493), was incubated for 1 h at 37 °C with an expression ssDNA enzyme, in a buffer containing 50 mM Tris– HCl (pH 7.5) and 25 mM MgCl2 , in a reaction volume of 10 ll. The products were then denatured at 95 °C for 3 min. The cleaved, labeled RNA products were resolved by electrophoresis on an 18% polyacrylamide gel and were analyzed by a fluorescent image reader (FLA2000G; FUJIFILM, Tokyo, Japan).
We have designed a novel DNA enzyme oligonucleotide expression system using the HIV-1 reverse transcriptase in vitro. We constructed ssDNA expression vectors (pVAX1Dz-tRNA (Lys-3), pVAX1-Dz-DtRNA (Lys-3), and pVAX1-Dz-DDtRNA (Lys-3)) including the DNA enzyme, the HIV-1 primer binding site (HIV-1 PBS), and either a native tRNA (Lys-3), or one of two truncated tRNAs, DtRNA (Lys-3) and DDtRNA (Lys-3) (Fig. 1A). We also constructed a control vector, pVAX1-RantRNA (Lys-3). The DtRNA (Lys-3) lacked the D-stemloop, the anticodon-stem loop, and the variable loop, while the DDtRNA (Lys-3) lacked the D-stem-loop, the anticodon-stem loop, the variable loop, and the 50 -end strand from the full-length tRNA (Lys-3) (Fig. 1B). The native tRNA (Lys-3) was subcloned into pVAX1, bearing the DNA enzyme complementary sequence that has two binding arms with random sequences and the PBS sequence, as a control vector, pVAX1-Ran-tRNA. Sequences encoding an active fragment of the DNA enzyme that contained the 10–23 catalytic motif, as described by Santoro and Joyce [13], the HIV-1 PBS, and three different lengths of tRNAs (Lys-3) were inserted between the KpnI and EcoRI restriction sites of the RNA transcription vector, pVAX1. The DNA enzyme sequence was placed between two oligonucleotide arms that are complementary and able to target the V3-loop of the HIV-1 env mRNA specifically (7196–7210, according to the GenBank Accession No. AF324493) (env-Dz of Figs. 1C and 4A), as reported by Zhang et al. [16], or two arms composed of random sequences, as a control (Ran-Dz of Fig. 1C). These ssDNA expression vectors were linearized at the EcoRI site. When the reaction mixture was subjected to in vitro transcription, the corresponding RNAs, 183, 142, and 122 nt transcripts, were synthesized from immediately after the T7 promoter (Fig. 2A). We made use of the HIV-1 reverse transcription mechanism to construct DNA enzyme expression vectors against HIV-1. The HIV-1 reverse transcription is initiated when its cognate primer tRNA (Lys-3) binds the PBS of the viral RNA template. Therefore, this expression plasmid contains the HIV-1 PBS and the tRNA (Lys-3) at the 30 -end of its RNA transcript, so that a ssDNA would be synthesized by the HIV-1 reverse transcriptase (Fig. 1). The RNA transcripts were incubated to allow selfannealing. The tRNA (Lys-3)-template RNA complexes were directly subjected to the following in vitro reverse transcription reaction. The reaction mixture was treated with RNase A and then a phenol:chloroform extraction was performed.
A. Kusunoki et al. / Biochemical and Biophysical Research Communications 301 (2003) 535–539
537
Fig. 1. Schematic representations of in vitro transcription and reverse transcription. (A) The DNA enzyme, the HIV-1 primer binding site (PBS), and either the native tRNA (Lys-3), DtRNA (Lys-3) or DDtRNA (Lys-3) were sub-cloned into the pVAX1 vector downstream of the T7 promoter. (B) The predicted secondary structure of the T7 transcript. (C) The strategy used to generate an in vitro reverse transcript using HIV-1 RT.
As shown in Fig. 1B, the native tRNA (Lys-3), DtRNA (Lys-3), and DDtRNA (Lys-3)-PBS complexes played the role as the primer for the HIV-1 reverse transcriptase. Furthermore, the reverse transcripts, the ssDNA from the template RNA (Fig. 2A), were showed the production of the expected 69 base band (Fig. 2B). These results suggest that the three different tRNA (Lys3) primers can express the expected size of the DNA enzyme (69 bases) from the corresponding pVAX1-Dz vectors. Furthermore, we found that the native tRNA (Lys-3) has higher DNA enzyme expression than those of the DtRNA (Lys-3) and DDtRNA (Lys-3) (Fig. 2B).
Detection of ssDNA by PCR analysis To confirm the in vitro ssDNA expression from the pVAX1-Dz-tRNA (Lys-3), pVAX1-Dz-DtRNA (Lys-3), and pVAX1-Dz-DDtRNA (Lys-3) plasmids, PCR methods were used to detect ssDNA. The PCR amplification was carried out using the expressed ssDNA specific primers 50 -GTTACAAGGCTAGCTACAAC-30 and 50 -AGACCCAAGCTGGCT-30 . The PCR products were pretreated with RNase A. The results are shown in Fig. 3A. The bands of the expected size (env DNA enzyme: 69 bp; 50 -GTTACAAGGCTAGCTACAAC
538
A. Kusunoki et al. / Biochemical and Biophysical Research Communications 301 (2003) 535–539
tions treated with S1 nuclease, a highly specific ssDNA endonuclease, resulted in no amplified products (Fig. 3B, lanes 3–5). Furthermore, the 100% homologous DNA enzyme sequence was confirmed with a Gene sequencer (ABI PRISM 310, genetic analyzer, Perkin– Elmer/Applied Biosystems, Foster, CA).
Sequence-specific cleavage activities of the expressed DNA enzyme for the env-mRNA substrate
Fig. 2. Detection of the RNA and ssDNA transcripts. (A) The RNA transcripts from pVAX1-Dz-tRNA (lane 2) (183 nt), pVAX1-DzDtRNA (lane 3) (142 nt), and pVAX1-Dz-DDtRNA (lane 4) (122 nt) were routinely checked on 8% polyacrylamide gels containing 7 M urea. Lane 1 is RNA Markers (Novagen, Germany). (B) The reverse transcripts from template RNA transcripts from pVAX1-Dz-tRNA (lane 1), pVAX1-Dz-DtRNA (lane 2), and pVAX1-Dz-DDtRNA (lane 3) were checked on 12% polyacrylamide gels containing 7 M urea. Lane 4 is a 10 bp DNA step Ladder Marker (Promega, Madison, USA). Lane 5 is a 50 bp DNA step Ladder Marker (Promega, Madison, USA).
Fig. 3. Detection of ssDNA using PCR. To confirm the ssDNA expression in vitro, a PCR was carried out using the expressed ssDNAspecific primer. The ssDNA used as the template was pretreated with either RNase A (A) or S1 nuclease for 30 min at 37 °C (B). PCR products were analyzed on a 12% polyacrylamide gel. Lane 1, 100 bp DNA step Ladder Marker (Promega, Madison, USA). Lane 2, 10 bp DNA step Ladder Marker (Promega, Madison, USA). Lane 3, pVAX1-Dz-tRNA; lane 4, pVAX1-Dz-DtRNA; and lane 5, pVAX1Dz-DDtRNA. The band of the expected size is marked by an arrow.
GAGTGCTTGGGTACCAAGCTTAAGTTTAAAC GCTAGCCAGCTTGGGTCT-30 ) of the pVAX1Dz-tRNA (Lys-3), pVAX1-Dz-DtRNA (Lys-3), and pVAX1-Dz-DDtRNA (Lys-3) plasmids were produced with RNase A (Fig. 3A, lanes 3–5). Control prepara-
To test the possible application of the expressed envDNA enzyme (env-Dz) against the target sequence, we investigated their cleavage activities against the env mRNA substrate in vitro. To determine whether the DNA enzyme cleaved the RNA, we synthesized a substrate composed of 25 nucleotides (50 -UGAGACAA GCACAUUGUAACAUUAG-30 ; 7191–7215), including the V3-loop of the env mRNA region. Reactions were performed in 50 mM Tris–HCl (pH 7.5) and 25 mM MgCl2 under single turnover conditions at 37 °C. The env-DNA enzyme cleaved this 25 nucleotide RNA (labeled with FITC at the 50 end, 50 -FITC-HIV-1-envmRNA) (Fig. 4A). The product fragments and the unreacted substrate in these samples were resolved by electrophoresis on an 18% polyacrylamide gel. The extent of the reaction at each time point was determined by densitometry of the gel image produced through FLA-2000G images (FUJIFILM, Tokyo, Japan) (Fig. 4B). As shown in Fig. 4, after treatment of the 50 -FITCHIV-1-env-mRNA with env-Dz, the strength of the substrate env-mRNA band became weak, whereas the strength of the cleavage product band increased in intensity (Fig. 4B, lanes 2 and 4). In contrast, the control Ran-Dz band did not yield any cleavage product (Fig. 4B, lane 6). Furthermore, with the env-Dz treatment, an increase in the cleavage product was found with an increase in the env-Dz concentration (Figs. 4B and C). These results suggest that the expressed ssDNA, from the pVAX1-Dz-DtRNA (Lys-3), pVAX1-Dz-DtRNA (Lys-3), and pVAX1-Dz-DDtRNA (Lys-3) plasmids, contains the sequence for the env-DNA enzyme function as well as the flanking arms complementary to the HIV1 V3-loop of the env mRNA. Thus, the expressed envDNA enzyme can cleave the target RNA substrate. In this study, we constructed a ssDNA expression vector including the HIV-1 PBS, the DNA enzyme, and either a native tRNA (Lys 3) or one of two truncated tRNAs (Lys-3), (DtRNA (Lys-3) and DDtRNA (Lys-3)). The reactions of the pVAX1-Dz-tRNA (Lys-3), pVAX1-Dz-DtRNA (Lys-3), and pVAX1-DzDDtRNA (Lys-3) vectors with T7 RNA polymerase in vitro gave the corresponding RNAs. The liberated RNAs were treated with the HIV-1 reverse transcriptase in vitro, which gave the corresponding ssDNA. The cleavage assay results demonstrated that the expressed
A. Kusunoki et al. / Biochemical and Biophysical Research Communications 301 (2003) 535–539
Fig. 4. Cleavage of substrate RNA by the expressed DNA enzyme. (A) Proposed structure of the in vitro cleavage of substrate RNA with the expressed DNA enzyme. (B) The substrate RNA (50 -FITC-HIV-1-envmRNA) was treated with 20 pmol env-Dz (lanes 1 and 2) or 200 pmol env-Dz (lanes 3 and 4) or 200 pmol Ran-Dz as a control (lanes 5 and 6), in the presence of 25 mM MgCl2 in 50 mM Tris–HCl (pH 7.5) buffer for 0 or 60 min. The cleavage labeled RNA products were resolved by electrophoresis on an 18% polyacrylamide gel. (C) The percentage of substrate at 0 min was normalized as 100%. The cleavage labeled RNA products were analyzed by a fluorescent image reader (FLA-2000G).
DNA enzyme has cleavage ability against the target sequence. This novel system may be applied to ssDNA expression in vivo.
Acknowledgments This work was supported in part by a Grant-in-Aid for High Technology Research, from the Ministry of Education, Science, Sports and Culture, Japan, a Grant from the Japan Society for the Promotion of Science in the ‘‘Research for the Future’’ program (JSPSRFTF97L00593), and a Sasagawa Scientific Research Grant from The Japan Science Society.
References [1] J. Goodchild, Hammerhead ribozymes: biochemical and chemical considerations, Curr. Opin. Mol. Ther. 2 (2000) 272–281. [2] A.S. Lewin, W.W. Hauswirth, Ribozyme gene therapy: applications for molecular medicine, Trends Mol. Med. 7 (2001) 221–228.
539
[3] R. Shippy, R. Lockner, M. Farnsworth, A. Hampel, The hairpin ribozyme. Discovery, mechanism, and development for gene therapy, Mol. Biotechnol. 12 (1999) 117–129. [4] L.Q. Sun, J.A. Ely, W.L. Gerlach, G. Symonds, Anti-HIV ribozymes, Mol. Biotechnol. 7 (1997) 241–251. [5] R.H. Symonds, Small catalytic RNAs, Annu. Rev. Biochem. 61 (1992) 641–671. [6] N.K. Vaish, A.R. Kore, F. Eckstein, Recent developments in the hammerhead ribozyme field, Nucleic Acids Res. 26 (1998) 5237– 5242. [7] R.R. Breaker, G.F. Joyce, A DNA enzyme that cleaves RNA, Chem. Biol. 1 (1994) 223–229. [8] R.R. Breaker, G.F. Joyce, A DNA enzyme with Mg2þ -dependent RNA phosphoesterase activity, Chem. Biol. 2 (1995) 655–660. [9] R.R. Breaker, DNA enzymes, Nat. Biotechnol. 15 (1997) 427–431. [10] R.R. Breaker, Catalytic DNA: in training and seeking employment, Nat. Biotechnol. 17 (1999) 422–423. [11] C.R. Geyer, D. Sen, Evidence for the metal-cofactor independence of an RNA phosphodiester-cleaving DNA enzyme, Chem. Biol. 4 (1997) 579–593. [12] Y. Li, R.B. Breaker, Deoxyribozymes: new players in the ancient game of biocatalysis, Curr. Opin. Struct. Biol. 9 (1999) 315–323. [13] S.W. Santoro, G.F. Joyce, A general purpose RNA-cleaving DNA enzyme, Proc. Natl. Acad. Sci. USA 94 (1997) 4262–4266. [14] L.Q. Sun, M.J. Cairns, E.G. Saravolac, A. Baker, W.L. Gerlach, Catalytic nucleic acids: from lab to applications, Pharmacol. Rev. 52 (2000) 325–347. [15] F.S. Santiago, H.C. Lowe, M.M. Kavurma, C.N. Chesterman, A. Baker, D.G. Atkins, L.M. Khachigian, New DNA enzyme targeting Egr-1 mRNA inhibits vascular smooth muscle proliferation and regrowth after injury, Nat. Med. 11 (1999) 1264–1269. [16] X. Zhang, Y. Xu, H. Ling, T. Hattori, Inhibition of infection of incoming HIV-1 virus by RNA-cleaving DNA enzyme, FEBS Lett. 458 (1999) 151–156. [17] L.Q. Sun, M.J. Cairns, W.L. Gerlach, C. Witherington, L. Wang, A. King, Suppression of smooth muscle cell proliferation by a cmyc RNA-cleaving deoxyribozyme, J. Biol. Chem. 274 (1999) 17236–17241. [18] Y. Wu, L. Yu, R. McMahon, J.J. Rossi, S.J. Forman, D.S. Snyder, Inhibition of bcr-abl oncogene expression by novel deoxyribozymes (DNAzymes), Hum Gene Ther. 10 (1999) 2847– 2857. [19] S. Basu, B. Sriram, R. Goila, A.C. Banerjea, Targeted cleavage of HIV-1 coreceptor-CXCR-4 by RNA-cleaving DNA-enzyme: inhibition of coreceptor function, Antiviral Res. 46 (2000) 125– 134. [20] T. Toyoda, Y. Imamura, H. Takaku, T. Kashiwagi, K. Hara, J. Iwahashi, Y. Ohtsu, N. Tsumara, H. Kato, N. Hamada, Inhibition of influenza virus replication in cultured cells by RNAcleaving DNA enzyme, FEBS Lett. 481 (2000) 113–116. [21] B. Sriram, A.C. Banerjea, In vitro-selected RNA cleaving DNA enzymes from a combinatorial library are potent inhibitors of HIV-1 gene expression, Biochem. J. 352 (2000) 667–673. [22] H. Unwalla, A.C. Banerjea, Inhibition of HIV-1 gene expression by novel macrophage-tropic DNA enzymes targeted to cleave HIV-1 TAT/Rev RNA, Biochem. J. 357 (2001) 147–155. [23] L. Zhang, W.J. Gasper, S.A. Stass, O.B. Ioffe, M.A. Davis, A.J. Mixson, Angiogenic inhibition mediated by a DNAzyme that targets vascular endothelial growth factor receptor 2, Cancer Res. 62 (2002) 5463–5469. [24] L.M. Khachigian, R.G. Fahmy, G. Zhang, Y.V. Bobryshev, A. Kaniaros, c-Jun regulates vascular smooth muscle cell growth and neointima formation after arterial injury. Inhibition by a novel DNA enzyme targeting c-Jun, J. Biol. Chem. 277 (2002) 22985– 22991.