A novel snapback primer probe assay for the detection and discrimination of sympatric Haemonchus species using DNA melting analysis

G Model

ARTICLE IN PRESS

VETPAR-8261; No. of Pages 10

Veterinary Parasitology xxx (2017) xxx–xxx

Contents lists available at ScienceDirect

Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar

Research paper

A novel snapback primer probe assay for the detection and discrimination of sympatric Haemonchus species using DNA melting analysis Rudolf Pichler a , Katja Silbermayr a,b , Kathiravan Periasamy a,∗ a Animal Production and Health Laboratory, Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture, International Atomic Energy Agency, Vienna, Austria b Institute of Parasitology, Department of Pathobiology, University of Veterinary Medicine, Vienna, Austria

a r t i c l e

i n f o

Article history: Received 17 August 2016 Received in revised form 12 February 2017 Accepted 14 February 2017 Keywords: Haemonchus qPCR Melting curve analysis Snapback primer probe Hairpin loop Limit of detection

a b s t r a c t Different sympatric species of Haemonchus parasites infecting ruminants and camels can be distinguished morphologically, but involves tedious microscopic examinations, measurements and several other limitations. Information on internal transcribed spacer-2 (ITS-2) sequence provides confirmatory differentiation of sympatric Haemonchus species. The present study introduces a novel, snapback primer probe based, real time PCR assay for the differentiation of three sympatric Haemonchus species, H. contortus (Hco), H. placei (Hpl) and H. longistipes (Hlo). The assay was designed to amplify a region of 130 bp within the ITS-2 gene that included three diagnostic mutational sites capable of discriminating Hco, Hpl and Hlo. Following melt curve analysis, species-specific diagnostic melt peaks were obtained for Hco, Hpl and Hlo with a mean melting temperature of 56.6 ± 0.3 ◦ C, 64.4 ± 0.1 ◦ C and 54.4 ± 0.1 ◦ C respectively. The test for analytical sensitivity revealed the ability of the assay to detect up to 5 copies per reaction. To evaluate the discriminating power of the assay, 174 samples from adult worms and 3rd stage larvae belonging to different Haemonchus species and various other nematode species including Cooperia curticei, Trichostrongylus axei, Trichostrongylus colubriformis, and Teladorsagia circumcincta were tested. Additionally, DNA extracted from 25 fecal egg samples was also tested and the specificity of the assay was verified by sequencing the ITS-2 gene of all the Haemonchus positive and non-Haemonchus samples. The assay worked accurately with 100% specificity in at least three real time PCR platforms. The assay is an effective alternative to the sequencing approach and is expected to be helpful for the screening of individual adult and larval Haemonchus parasites. However, caution needs to be applied while interpreting the results from fecal egg samples due to varying levels of sympatric co-infections from different Haemonchus species. The present study is the first report on the application of snapback primer probe methodology for the differentiation of nematode parasites. © 2017 Elsevier B.V. All rights reserved.

1. Introduction Haemonchosis is one of the major parasitic infections affecting cattle, sheep, goats and camel worldwide and pose a major threat to their productivity, particularly in tropical and subtropical regions. Haemonchus is a trichostrongylid blood-sucking nematode

∗ Corresponding author at: Animal Production and Health Laboratory, Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture, International Atomic Energy Agency, IAEA Seibersdorf Laboratories, P.O. Box 100, A1400, Vienna, Austria. E-mail addresses: [email protected] (R. Pichler), [email protected] (K. Silbermayr), [email protected], [email protected] (K. Periasamy).

that infects abomasum and cause hemorrhage, anorexia, depression, severe chronic anaemia, loss of body weight and eventually death of the affected animals (Getachew et al., 2007; Roeber et al., 2013). It causes significant morbidity as well as mortality resulting in major economic losses to the livestock industry (Morgan et al., 2013; Roeber et al., 2013; Charlier et al., 2014). The control and treatment of Haemonchosis primarily relies on the use of anthelmintic drugs, however this approach is becoming less reliable due to the development of anthelmintic resistance. Particularly, the propensity of H. contortus in developing resistance to anthelmintic drugs rapidly is remarkable (Kaplan, 2004; Gilleard, 2013) and is widely accepted as a model to study the genetics of drug resistance among parasites.

http://dx.doi.org/10.1016/j.vetpar.2017.02.012 0304-4017/© 2017 Elsevier B.V. All rights reserved.

Please cite this article in press as: Pichler, R., et al., A novel snapback primer probe assay for the detection and discrimination of sympatric Haemonchus species using DNA melting analysis. Vet. Parasitol. (2017), http://dx.doi.org/10.1016/j.vetpar.2017.02.012

G Model VETPAR-8261; No. of Pages 10 2

ARTICLE IN PRESS R. Pichler et al. / Veterinary Parasitology xxx (2017) xxx–xxx

About 12 species of Haemonchus have been reported to infect a range of host species including bovidae, camelidae, antilocapridae, giraffidae and cervidae (Hoberg et al., 2004; Amarante, 2011). Among these, four sympatric species H. contortus, H. placei, H. similis and H. longistipes have been reported to commonly infect ruminants and camels. Although the primary host associations for H. contortus include Caprinae (domestic and wild small ruminants), these parasites can infect a broad cosmopolitan range of hosts. H. placei and H. similis have predominant associations with bovines although they can infect sheep and goats. Similarly, H. longistipes is predominantly the parasite of camel although there are reports of infection in goats and sheep (Jacquiet et al., 1996; Achi et al., 2003; Hoberg et al., 2004; Kumsa et al., 2008; El Hassan et al., 2011; Hussain et al., 2014; Morsy et al., 2014). Occurrences of co-infections of two or more of these species are common, particularly when different host species share the pastures or grazing lands (Kumsa et al., 2008; Akkari et al., 2013; Hussain et al., 2014). Genetic hybridization between the sympatric species has been reported among the field isolates (Brasil et al., 2012; Hussain et al., 2014; Chaudhry et al., 2015) suggesting the potential for inter-species introgression of genes including those involved in pathogenicity and drug resistance. Recently, Chaudhry et al. (2014) reported the presence of benzimidazole resistance mutations in multiple independent H. placei populations isolated from US cattle, indicating the potential risk for emergence of drug resistance in these parasites. Hence, the correct identification of Haemonchus species, as well as knowledge regarding the epidemiology and genetic characteristics of the principal circulating species, is essential for the establishment of sustainable control strategies. Different sympatric species of Haemonchus parasites infecting ruminants and camels can be distinguished morphologically based on attributes like vulvar process, body length of males, female tail length, spicule length, synlophe (longitudinal cuticular ridges), bursa and dorsal ray (Hoberg et al., 2004). In order to identify the species of male Haemonchus worms, a discriminant function that combines three different parameters on spicules (total length, distance from the tip to the barb of the right spicule and the distance from the tip to the barb of the left spicule) has been described (Jacquiet et al., 1997; Achi et al., 2003). However, morphological identification of Haemonchus species has its own limitations. Although male characteristics are relatively more reliable, overlap between measurements of H. contortus and H. placei often complicate the correct identification. About 6.09% of adult male parasites have been reported to be misclassified based on the discriminant function (Santos et al., 2014). Similarly, in case of females, the vulvar flaps and their shapes are variable and dependent on several factors making them unreliable characteristics for species differentiation (Amarante, 2011). Enumeration of longitudinal surface cuticular ridges may provide additional information in doubtful cases, but requires cumbersome histological preparations for the analysis. Sequencing internal transcribed spacer 2 gene can provide confirmatory differentiation of H. contortus and H. placei (Stevenson et al., 1995; Chaudhry et al., 2014). Stevenson et al. (1995) attempted to utilize restriction enzymes for identifying diagnostic mutational sites. Recently, Chaudhry et al. (2014) reported differentiation of these two species based on a pyro sequencing method described by Hoglund et al. (2009). Both these methods involve either sequencing or restriction enzymes which are relatively expensive for routine investigations. Hence, a simple and fast DNA test that differentiates Hco, Hpl and other sympatric species provide many important competitive advantages like accuracy and time for high throughput genotyping. In addition to H. contortus and H. placei, H. longistipes is also a commonly reported sympatric Haemonchus species circulating among ruminants and camels in Asia and Africa (Kumsa et al., 2008; El Hassan et al., 2011; Hussain et al., 2014; Morsy et al., 2014). However, no assay is currently available for

routine genotyping to differentiate all the three species in a single reaction tube. In this paper, we report the design, performance and application of a novel, unlabeled, snapback primer probe based real time PCR assay for detection and differentiation of H. contortus, H. placei and H. longistipes. 2. Material and methods 2.1. Ethics statement All sample materials were collected from animal carcasses in slaughter houses. No experimental infections were performed for the study. 2.2. Study area, parasite material and DNA extraction A total of 159 samples of adult worms belonging to H. contortus (Hco), H. placei (Hpl), H. longistipes (Hlo), Teladorsagia circumcincta (Tci) and Hco X Hpl hybrids from four countries, Argentina, Austria, Nigeria and Pakistan were utilized for the present study. Adult Haemonchus and Teladorsagia worms were collected from the viscera of three major domestic ruminant species (sheep, goats and cattle) slaughtered at a municipal slaughterhouse located in Lahore, Pakistan, a private slaughter house located in lower Austria and institutional flocks at Instituto Nacional de Tecnología Agropecuaria, Buenos Aires, Argentina and National Animal Production Research Institute, Zaria, Nigeria. In addition to single adult worms, 3rd stage larval samples from other nematode species, Cooperia curticei (Ccu), Trichostrongylus colubriformis (Tco), Dictyocaulus viviparous (Dvi), Oesophagostomum dentatum (Ode) and Teladorsagia circumcinta (Tci) were also utilized. The number of adult/larval samples from each of these parasite species and the country of origin of the samples are provided in Table 1. Worm samples collected from slaughter houses were washed in physiological saline and stored in eppendorf tubes at −20 ◦ C before further processing. Total genomic DNA was extracted from each individual adult worm using either QIAmp DNA Mini Kit or DNeasy Blood and Tissue Kit (Qiagen Inc, Hilden, Germany) following manufacturer’s protocol. The DNA of larval cultures was extracted with SbeadexTM forensic kit (LGC, Middlesex, UK) for better DNA yield. Extracted DNA was measured in a Nanodrop spectrophotometer to ascertain the concentration and quality. Apart from adult worm and larval samples, DNA was also extracted from 25 fecal egg samples (5 sheep from Instituto Nacional de Investigaciones Agropecuaria, Uruguay and 20 goats from University of Veterinary Medicine, Vienna, Austria). Briefly, 5 g of fecal samples were homogenized in tap water and poured through the 100 ␮m sieve to collect the filtrate. The filtrate was poured through 20–25 ␮m sieve to collect the eggs on the surface of the sieve. The eggs were washed off and centrifuged at 300g for 5–7 min. The supernatant was removed and the saturated sodium chloride solution was added to centrifuge again at 300 g for 5–7 min. The egg solution was poured through 20–25 ␮m sieve and the eggs were collected by washing gently with deionized water. The eggs were transferred to fresh falcon tubes and the washing procedure was repeated. 50 ␮l of the resultant egg solution was used as starting material to extract DNA using QIAmp DNA Mini Kit (Qiagen Inc, Hilden, Germany) following manufacturer’s protocol. 2.3. ITS-2 amplification, cloning and sequencing For species identification, differentiation and confirmation, all the DNA samples extracted from adult worms, larval cultures and fecal egg samples were subjected to PCR amplification of internal transcribed spacer 2 (ITS-2) gene. A 321 bp fragment of ITS-2 located between 5.8S and 28S rRNA genes was amplified using

Please cite this article in press as: Pichler, R., et al., A novel snapback primer probe assay for the detection and discrimination of sympatric Haemonchus species using DNA melting analysis. Vet. Parasitol. (2017), http://dx.doi.org/10.1016/j.vetpar.2017.02.012

G Model

ARTICLE IN PRESS

VETPAR-8261; No. of Pages 10

R. Pichler et al. / Veterinary Parasitology xxx (2017) xxx–xxx

3

Table 1 Details of parasite sample type, geographic origin and accession numbers of ITS2 sequences submitted to NCBI-GenBank. Country

Geographic region

Species

Species code

Sample type

No. Samples

Accession Numbers

Reference

Argentina Austria

Latin America Europe

Nigeria

Africa

Uruguay Pakistan

L. America Asia

Haemonchus contortus Haemonchus contortus Teladorsagia circumcincta Cooperia curticei Dictyocaulus viviparus Oesophagostomum dentatum Teladorsagia circumcincta Trichostrongylus colubriformis Haemonchus contortus Haemonchus longistipes Haemonchus placei Haemonchus contortus Haemonchus contortus Haemonchus placei Haemonchus longistipes Hco X Hpl hybrid

Hco ARG Hco AUT Tci AUT Ccu AUT Dvi AUT Ode AUT Tci AUT Tco AUT Hco NIG Hlo NIG Hpl NIG Hco URY Hco PAK Hpl PAK Hlo PAK Hyb PAK

Adult Adult Adult Larvae Larvae Larvae Larvae Larvae Adult Adult Adult Eggs Adult Adult Adult Adult

25 23 7 3 3 3 3 3 3 3 3 5 74 15 2 4

KU891852–KU891876 KU891877–KU891899 KU891921–KU891927 KU891909–KU891911 KU891912–KU891914 KU891915–KU891917 KU891918–KU891920 KU891928–KU891930 KU891900–KU891902 KU891903–KU891905 KU891906–KU891908 – KJ724250–KJ724323 KJ724326–KJ724340 KJ724324–KJ724325 KJ724341–KJ724344

This study This study This study This study This study This study This study This study This study This study This study This study Hussain et al. (2014) Hussain et al. (2014) Hussain et al. (2014) Hussain et al. (2014)

the primers NC1F (5 ACGTCTGGTTCAGGGTTGTT 3 ) and NC1R (5 TTAGTTTCTTTTCCTC CGCT 3 ) (Stevenson et al., 1995). PCR was performed in a 40 ␮l reaction volume and the composition of reaction mixture included 20 ng of template DNA, 1.2 ␮l each of forward and reverse primers at 5 pmol/␮l, 4 ␮l of 2 mM dNTP mix, 4 ␮l of 10X PCR buffer, 1.5 mM MgCl2 and 1.5 units of Taq polymerase (Solis Biodyne, Estonia). The cycling conditions were as follows: 95 ◦ C for 15 min, followed by 35 cycles of 95 ◦ C for 50s, 55 ◦ C for 45 s and 72 ◦ C for 45 s and a final extension at 72 ◦ C for 10 min. The PCR amplicons from individual adult worms and fecal egg samples were sequenced from both ends using forward and reverse PCR primers (LGC Genomics, Germany). The PCR amplicons from larval cultures were cloned using ® ® TOPO TA Cloning Kit (Thermo Fisher Scientific, CA, USA) following manufacturer’s protocol. At least three colonies were picked for each of the parasite species and the plasmid DNA was extracted from the respective bacterial cultures using PureYieldTM Plasmid Midiprep System (Promega, Madison, WI, USA) following manufacturer’s protocol. The recombinant clones were sequenced from both ends using M13 forward and reverse primers. The raw ITS2 sequences derived from PCR amplicons as well as clones were trimmed and edited using Codoncode Aligner version 4.1.1. All the sequences were subjected to BLAST (Basic Local Alignment Search Tool) search to confirm the parasite species. The diagnostic mutational motifs within ITS-2 region were used to assign the sympatric species of Haemonchus parasites (Hco, Hpl and Hlo). 2.4. High resolution melting (HRM) analysis of ITS-2 PCR amplicons Precision high resolution melting analysis was performed to evaluate the power of 321 bp ITS-2 fragment to discriminate the three sympatric Haemonchus species (Hco, Hpl and Hlo) and to generate species-specific melt curve profiles. Primers NC1F and NC1R were used for PCR amplification with EvaGreen as saturating DNA binding dye on a CFX96 TouchTM Real-Time PCR Detection System (BioRad, CA, USA). PCR was performed in a 20 ␮l reaction volume and the composition of reaction mixture included 20 ng of template DNA, 0.6 ␮l each of forward and reverse primers at 5 pmol/␮l and 10 ␮l of 2× SsoFast EvaGreen supermix (BioRad, CA, USA, Cat. No. 172-5200). The cycling conditions were as follows: 95 ◦ C for 5 min, followed by 40 cycles of 95 ◦ C for 30s, 55 ◦ C for 30 s and 72 ◦ C for 30 s. The high resolution melting analysis at the end of the amplification consisted of one cycle starting at 38 ◦ C for 20 s, the temperature subsequently being increased to 85 ◦ C in 0.2 ◦ C/s increments. The Precision Melt Analysis Software 1.1 (Bio-Rad, CA, USA) was used to plot the melting profile of the three species with the acquisition of normalized melt curves and difference in curves.

2.5. Snapback primer probe assay The snapback primer probe assay for Haemonchus species differentiation was designed to amplify a region of 130 bp within the ITS-2 gene. The amplicon included two diagnostic mutational sites at positions 67 and 81 that discriminated Hco and Hpl while the mutational motif at position 66 differentiated these two species from Hlo. The sequences of the snapback primer probe and reverse primer are: HCO HPL SBF (5 GTTTATACAAATGACAAAAGAACATCATGTTGCCACTATTTGAGTGT 3 ) and MCA1R (5 AAGTTCAGCGGGTAATCACG 3 ). The snapback primer probe consisted of two parts, the snapback probe at the 5 end and the conventional annealing primer at the 3 end. Thus, during the PCR, 3 primer anneals to the template DNA for subsequent extension while the 5 snapback probe combines with the target sequence of the amplicon to form the stem-loop secondary structure. The snapback primer probe assay follows asymmetric polymerase chain reaction procedure with concentration of snapback primer 13.3 times higher than the conventional reverse primer, thus limiting the synthesis of double strand amplicons. To eliminate the unfavorable extension of the snapback probe, 5 terminal was blocked with two nucleotides that mismatched the target sequence. The secondary structures of the primers and the amplicons were studied using the Mfold Web Server (http://mfold. rna.albany.edu/?q=mfold). PCR was performed in a 10 ␮l reaction volume and the composition of reaction mixture included 20 ng of template DNA, 0.3 ␮l of snapback primer (5 pmol/␮l), 0.225 ␮l of reverse primers (0.5 pmol/␮l) and 5 ␮l of 2× SsoFast EvaGreen supermix (BioRad, CA, USA). The cycling conditions were as follows: 95 ◦ C for 5 min, followed by 40 cycles of 95 ◦ C for 45s, 58 ◦ C for 30 s and 72 ◦ C for 30s. The amplification product was then denatured at 95 ◦ C for 1 min and the melting curve analysis consisted of one cycle starting at 38 ◦ C for 20 s, the temperature subsequently being increased to 85 ◦ C in 0.5 ◦ C/s increments. Every PCR run included no-template and positive controls from Hco, Hpl and Hlo. The melting temperatures were analyzed using melting curve module implemented in Bio-Rad CFX Manager Software version 2.0 (Bio-Rad, CA, USA) and the correspondent curves were displayed as negative first derivative plots of fluorescence with respect to temperature. 2.6. Sensitivity and specificity of snapback primer probe assay The analytical sensitivity was assessed by determining the Limit of Detection (LoD) for each of the three Haemonchus species. PCR amplicons derived from NC1F and NC1R primers that are 321 bp long and containing the complete ITS-2 gene sequence ® ® were inserted into the plasmid vector using TOPO TA Cloning

Please cite this article in press as: Pichler, R., et al., A novel snapback primer probe assay for the detection and discrimination of sympatric Haemonchus species using DNA melting analysis. Vet. Parasitol. (2017), http://dx.doi.org/10.1016/j.vetpar.2017.02.012

G Model VETPAR-8261; No. of Pages 10

ARTICLE IN PRESS R. Pichler et al. / Veterinary Parasitology xxx (2017) xxx–xxx

4

Kit (Thermo Fisher Scientific, MA, USA). The positive clones were selected and the plasmids were purified to be used as positive controls. The initial concentrations of these plasmids were determined by fluorometry using the Quant-iT PicoGreen dsDNA assay kits (Invitrogen, Austria) with a NanoDrop ND-3300 fluorospectrometer (PeqLab, USA) before preparing the appropriate dilutions. The copy number was calculated as follows: number of copies = [amount (ng) × 6.022 × 1023 ]/[length (plasmid + insert) × 1 × 109 × 650]. The plasmid of each Haemonchus species was serially diluted in 10-folds starting from 107 copies to 103 copies and kept at −20 ◦ C until analysis. Below 103 , the plasmids were diluted in such a way to obtain a copy number of 500, 250, 125, 50, 25, 10, 5 and 3 to determine the limit of detection of the assay in an accurate way. Diluted plasmid samples with above copy numbers were analyzed in triplicate for each of the three Haemonchus species respectively. The copy number and Cq data were subjected to linear regression analysis using SPSS version 10.5. The analytical specificity of the assay was evaluated by testing DNA samples extracted from individual Haemonchus worms, larval cultures and fecal egg samples belonging to different geographical regions (Table 1). 174 samples from adult worms and 3rd stage larvae belonging to different Haemonchus species and various other nematode species were tested. Additionally, DNA extracted from 5 sheep and 20 goat fecal egg samples were tested. 130 of these were classified as H. contortus (Hco), 18 were classified as H. placei (Hpl), 5 were classified as H. longistipes (Hlo) and 4 were classified as Hco X Hpl hybrids. Moreover the specificity of the assay was also evaluated by testing DNA samples extracted from adult Tci and larval cultures of Ccu, Tco, Dvi, Ode and Tci. Samples were blinded to the operator and analyzed in duplicate. The accuracy of species identification was confirmed by sequencing, the sequences of which had been submitted to NCBI-GenBank and is available under the accession numbers as mentioned in Table 1. 2.7. Cross-platform compatibility All standard experiments were performed in the CFX96TM touch real time PCR detection system (Bio-Rad, CA, USA). However, to evaluate the applicability of the assay across different real time PCR platforms, the same conditions were tested on QuantstudioTM 6 Flex (Applied Biosystems, Life Technologies, Thermo Fisher Scientific Corporation, CA, USA) and LightCycler 480 II (Roche, Basel, Switzerland). A subset of 48 samples representing all the three Haemonchus species (Hco (n = 22); Hpl (n = 8); Hlo (n = 5); Hco X Hpl hybrid (n = 4)) including negative controls (Ccu, Tci, Tco, Ode, Dvi), no-template and positive controls were utilized for this purpose. Additionally, the snapback primer probe assay was performed in two steps: (i) asymmetrical polymerase chain reaction was performed on a conventional PCR machine (BioRad C1000) using the snapback primer probe and 2X SsoFast EvaGreen supermix and (ii) the resultant PCR amplicons were transferred to BioRad CFX96TM touch real time PCR detection system to perform the melt curve analysis. 3. Results 3.1. High resolution melting analysis of ITS-2 PCR amplicons High resolution melting (HRM) analysis measures the dissociation of double stranded DNA in the presence of a saturating fluorescent dye. The dissociation curves plotted following a melt protocol are normalized and similar melt profiles are clustered together to identify like sequences. In the present study, HRM analysis of a 321 bp PCR amplicon resulted in three clusters, each specific to one of the three sympatric Haemonchus species. All the parasite samples originating from Pakistan, Argentina and Austria

and belonging to Hco, Hpl and Hlo were assigned to each of these clusters consistently. However, accurate clustering and species identification was not achievable for Hco samples originating from Nigeria as they formed a distinct sub-cluster indicating significant difference in the thermal profile of these amplicons (Fig. 1).

3.2. Snapback primer probe assay design and optimization The 23nt long snapback probe was primarily designed to differentiate Hco and Hpl. The probe presented nucleotide “C” (at nucleotide position 15 of snapback probe) to complement nucleotide “G” of Hpl (nucleotide position 81 of the amplicon and indicated as position 106 in Fig. 2) during the formation of stem-loop secondary structure. On the contrary, the probe had a mismatch with nucleotide “A” of Hco at the same position (Fig. 2). Further, nucleotide “T” at position 6 of the amplicon (indicated as position 31 in Fig. 2) complemented nucleotide “A” at position 67 of the amplicon (indicated as position 92 in Fig. 2) from Hpl while it mismatched with nucleotide “G” from Hco at the same position, thus leading to significant probe melting temperature difference between the two species. On top of it, nucleotide difference at position 66 of the amplicon within the snapback stem (indicated as position 91 in Fig. 2) was used to differentiate Hlo (nucleotide “T”) from Hco and Hpl (nucleotide “C”). All the three diagnostic mutation sites (C/A, T/G and T/C) can be classified under SNP class I and II (Liew et al., 2004), thus providing significant differences (at least 2 ◦ C) among melting temperatures of species-specific peaks. The snapback primer probe assay followed asymmetric PCR procedure with the absolute quantity of snapback primer optimized at 150 nM for 10 ␮l reaction while the absolute quantity of reverse primer optimized at 11.25 nM. Thus, with the optimization of primer concentration and primer annealing temperature, it was possible to produce an efficient amplification strategy, clear melting curve differences among the species and species-specific melting peaks for snapback stems (Fig. 3). Based on the positive control and the parasite samples derived from wide geographic regions (Argentina, Austria, Pakistan and Nigeria), the following mean melting temperatures were obtained for each of the three Haemonchus species on BioRad CFX96TM real time PCR system: Hco (56.6 ± 0.3 ◦ C), Hpl (64.4 ± 0.1 ◦ C) and Hlo (54.4 ± 0.1 ◦ C). The mean melting temperatures (Tm ) of full length double strand amplicons were 78.6 ± 0.2 ◦ C, 78.8 ± 0.0 ◦ C and 78.2 ± 0.1 ◦ C for Hco, Hpl and Hlo respectively. Thus, identification of all the three sympatric species of Haemonchus was accurately determined based on the Tm of snapback stems.

3.3. Discriminating power of the assay All Haemonchus positive DNA samples showed species-specific melting peaks while no amplification was observed for nonHaemonchus sp. DNA that included Cooperia curticei, Trichostrongylus axei, Trichostrongylus colubriformis, Dictyocaulus viviparus and Oesophagostomum dentatum. Teladorsagia circumcincta samples produced a weak amplification but no species-specific melting peaks were observed (Fig. 3). The species-specific melting peaks as well as double strand melting peaks were absent in the negative samples and controls. The specificity of the snapback primer probe assay was further verified by sequencing the ITS-2 region of all the Haemonchus positive and non-Haemonchus samples. Further, to confirm the negative results, the amplification cycles were increased to 50 without any effect. Thus, the novel snapback primer probe assay provided a specificity of 100% with respect to the discrimination of the three sympatric Haemonchus species.

Please cite this article in press as: Pichler, R., et al., A novel snapback primer probe assay for the detection and discrimination of sympatric Haemonchus species using DNA melting analysis. Vet. Parasitol. (2017), http://dx.doi.org/10.1016/j.vetpar.2017.02.012

G Model VETPAR-8261; No. of Pages 10

ARTICLE IN PRESS R. Pichler et al. / Veterinary Parasitology xxx (2017) xxx–xxx

5

Fig. 1. High resolution melting analysis of 321 bp fragment containing complete internal transcribed spacer 2 gene of three sympatric Haemonchus species with Nigerian (NGA) isolates (A) Differential melting of the PCR products forming four clusters (Hco, Hco-NGA, Hpl and Hlo) (B) Normalization of the melt curves.

Table 2 Analytical sensitivity and limit of detection of snapback primer probe assay; Triplicate samples were analyzed for each copy number of plasmids and mean Cq ± SD values are provided for each Haemonchus species. Copy number

1000 500 250 125 50 25 10 5 3

Mean Cq ± SD (n = 3) Hco (R2 = 0.842)

Hpl (R2 = 0.818)

Hlo (R2 = 0.817)

23.4 ± 1.3 26.1 ± 0.07 27.0 ± 0.07 28.8 ± 0.08 30.3 ± 0.06 32.3 ± 0.16 33.6 ± 0.33 35.2 ± 0.09 36.6 ± 0.21

25.8 ± 0.55 28.9 ± 0.31 29.1 ± 0.15 31.4 ± 0.14 33.2 ± 0.11 34.8 ± 0.35 37.1 ± 0.05 38.8 ± 0.18 40.4 ± 0.53

24.4 ± 0.26 26.4 ± 0.09 27.6 ± 0.03 28.9 ± 0.28 31.0 ± 0.22 32.3 ± 0.14 33.9 ± 0.25 35.8 ± 0.07 37.3 ± 0.28

3.4. Limit of detection of the assay The detection of parasite DNA down to 3 copies per reaction for all the three species was recorded. The mean Cq ± SD values obtained for various copy numbers of plasmids are presented in Table 2 and the graphical representation of the results are presented in Supplementary Fig. SF1. The mean Cq values for Hco and Hlo were more or less similar for various copy numbers of plasmids, while the values were relatively higher for Hpl. All the three species (Hco, Hpl and Hlo) were correctly determined at 5 copies per reaction with a mean Cq value of 35.2 ± 0.09, 38.8 ± 0.18 and 35.8 ± 0.07 respectively. Species determination was also accurate at three copies per reaction, when the amplification was increased from 40 to 45 cycles without compromising the specificity of the

assay. With a Cq threshold of 40, the limit of detection of the assay can be safely concluded as 5 copies per reaction. 3.5. Cross-platform compatibility The temperatures for species-specific diagnostic melt peaks and double strand melt peak for Hco, Hpl and Hlo were recorded in both QuantstudioTM 6 Flex and LightCycler 480 II instruments, the mean values of which are presented in Table 3. The mean temperatures for diagnostic melt peaks were found to vary across platforms, although the difference in melting temperatures between the species within each real time PCR instrument was consistent. Among the three instruments, the mean temperatures of diagnostic melt peaks specific to Hco and Hlo were lowest in QuantstudioTM 6 Flex while they were highest in LightCycler 480 II. The mean tem-

Please cite this article in press as: Pichler, R., et al., A novel snapback primer probe assay for the detection and discrimination of sympatric Haemonchus species using DNA melting analysis. Vet. Parasitol. (2017), http://dx.doi.org/10.1016/j.vetpar.2017.02.012

G Model VETPAR-8261; No. of Pages 10

ARTICLE IN PRESS R. Pichler et al. / Veterinary Parasitology xxx (2017) xxx–xxx

6

Fig. 2. Species-specific diagnostic motifs and secondary structure of ITS-2 amplicon with the snapback stem and loop (Nucleotides 1–25 show the snap back primer probe; 26–155 show the amplicon (Size–130 bp); 26–47 show the forward primer; 137–155 show the reverse primer).

Table 3 Mean ± SD (◦ C) values for species-specific diagnostic melt peak and common double strand melt peak on three real time PCR platforms. Platform

Melt peak (Mean ± SD) ◦ C

Melt peak

TM

Bio Rad CFX

96

ABI Quantstudio 6TM Flex Roche LightCycler 480 II

◦

Diagnostic melt peak ( C) Double strand melt peak (◦ C) Diagnostic melt peak (◦ C) Double strand melt peak (◦ C) Diagnostic melt peak (◦ C) Double strand melt peak (◦ C)

perature for the diagnostic melt peak, specific to Hpl was lowest in BioRad CFX96 while it was highest in LightCycler 480 II. Similar shift in melting temperatures of diagnostic melt peaks was observed across real time PCR platforms while using snapback primer probes for the differentiation of capripoxvirus genotypes (Gelaye et al., 2013). The combined results indicated the assay was

Hco (n = 22)

Hpl (n = 8)

Hlo (n = 5)

56.6 ± 0.3 78.6 ± 0.2 55.4 ± 0.3 78.3 ± 0.3 57.6 ± 0.4 80.4 ± 0.3

64.4 ± 0.1 78.8 ± 0 64.5 ± 0.2 78.9 ± 0.2 65.8 ± 0.2 80.8 ± 0.1

54.4 ± 0.1 78.2 ± 0.1 52.8 ± 0.3 78.1 ± 0.2 55.6 ± 0.3 80.1 ± 0.1

capable of discriminating the sympatric Haemonchus species in all the three real time PCR systems with a high degree of accuracy (Fig. 4A and B). Additionally, the sympatric Haemonchus species were also successfully discriminated by the two-step PCR (conventional PCR amplification followed by real time melt curve analysis) approach as well.

Please cite this article in press as: Pichler, R., et al., A novel snapback primer probe assay for the detection and discrimination of sympatric Haemonchus species using DNA melting analysis. Vet. Parasitol. (2017), http://dx.doi.org/10.1016/j.vetpar.2017.02.012

G Model VETPAR-8261; No. of Pages 10

ARTICLE IN PRESS R. Pichler et al. / Veterinary Parasitology xxx (2017) xxx–xxx

7

Fig. 3. Melt curve profile of three sympatric Haemonchus species after snapback primer probe assay (A) Absence of peaks for other related species (Ccu, Dvi, Ode, Tci, Tco) confirms the specificity of the assay (B) Normalization of the melt curves.

4. Discussion High resolution melting of 321 bp amplicons derived from ITS-2 primers was initially attempted by the authors to differentiate the three sympatric Haemonchus species. Hpl and Hlo isolates were consistently differentiated with the formation of distinct clusters for each species, even if individuals within the species were derived from different geographic locations. However, Hco isolates from different geographic regions were not able to cluster together as Nigerian Hco isolates formed a distinct sub-cluster from others. This could be due to additional differences in the nucleotide sequences of Nigerian Hco isolates as compared to Pakistani, Argentinian and Austrian Hco isolates. The PCR amplicons included 70 bp of the 28S gene at the 5 end, 231 bp of the ITS-2 gene and 20 bp of the 5.8S

gene at the 3 end. Single nucleotide polymorphisms (SNPs) at positions 24, 205 and 219 within ITS-2 region can discriminate Hco and Hpl species (Stevenson et al., 1995). Further, a six nucleotide insertion of “TATTAA” between nucleotide positions 59 and 60, insertion of nucleotide “A” between positions 107 and 108 and insertion of nucleotide “T” between positions 173 and 174 are specific for Hlo isolates (Hussain et al., 2014). The PCR amplicons from Nigerian Hco isolates might have other polymorphic sites in addition to species-specific diagnostic mutational sites within the ITS-2 region. Successful and accurate HRM analysis for species discrimination is highly dependent not only on variations in the amplicon between species but also within species. Apart from the speciesspecific nucleotide differences, several ITS-2 genotypes have been reported among Hco isolates from Brazil (Brasil et al., 2012), Yemen

Please cite this article in press as: Pichler, R., et al., A novel snapback primer probe assay for the detection and discrimination of sympatric Haemonchus species using DNA melting analysis. Vet. Parasitol. (2017), http://dx.doi.org/10.1016/j.vetpar.2017.02.012

G Model VETPAR-8261; No. of Pages 10 8

ARTICLE IN PRESS R. Pichler et al. / Veterinary Parasitology xxx (2017) xxx–xxx

Fig. 4. Compatibility of snapback primer probe assay to differentiate Haemonchus species in (A) ABI QuantstudioTM 6 Flex real time PCR system and (B) Roche Lightcycler 480 II real time PCR system.

and Malaysia (Gharamah et al., 2012), China (Yin et al., 2013) and Pakistan (Hussain et al., 2014) based on other polymorphic sites. Polymorphisms in these regions appear to have significantly affected single distinct clustering of Hco isolates from different regions (Shen et al., 2005; Grattapaglia et al., 2011). Decreasing amplicon size from 321 bp to around 100–150 bp might have helped to significantly improve the accuracy, but even one or few changes in the sequence flanking the diagnostic motifs can result in relatively large and easily measurable differences. Further, differentiation of Haemonchus parasites from other closely related nematodes amplified using universal ITS-2 primers will be difficult, as the users need to apply several positive controls to compare unknown PCR amplicons with that of known species. Also, the technical difficulty in interpreting the results using the HRM software needs to be noted. The software investigates the relative ratios between the fluorescence curves of different parasite species and the technical complexity is expected to increase with increasing number of positive controls (Somogyvari et al., 2012).

The potential interference from polymorphic nucleotides flanking the diagnostic sites can be avoided by unlabeled probe melting approach, where a short unlabeled probe is added to an asymmetric PCR (Zhou et al., 2004; Dames et al., 2007; Liew et al., 2007; Birrer et al., 2014). The unlabeled probes provide the option of targeting only a short region of interest (diagnostic mutational sites) rather than genotyping the entire amplicon containing additional DNA sequence polymorphisms (Birrer et al., 2014). Alternatively, snapback primers consisting of unlabeled probes attached to the 5’end of PCR primers can be utilized to form an intramolecular hairpin stem that includes diagnostic polymorphic nucleotide sites (Zhou et al., 2008; Farrar et al., 2011; Wu et al., 2014). During the melting process, two melt peaks are observed, first dissociation of snapback primer probe from the full length amplicon and second the dissociation of double strand amplicon itself. Thus, species calling can either focus on the snapback primer probe melting (intra molecular hairpin melting) or the amplicon melting (inter molecular duplex melting). The success of snapback primer probe assays depend on

Please cite this article in press as: Pichler, R., et al., A novel snapback primer probe assay for the detection and discrimination of sympatric Haemonchus species using DNA melting analysis. Vet. Parasitol. (2017), http://dx.doi.org/10.1016/j.vetpar.2017.02.012

G Model VETPAR-8261; No. of Pages 10

ARTICLE IN PRESS R. Pichler et al. / Veterinary Parasitology xxx (2017) xxx–xxx

the hairpin loop size, amplicon size and stem length. Shorter loops result in more stable hairpins and the intensity of the hairpin to the amplicon signal is maximal at an amplicon length of around 120 bp (Zhou et al., 2008). The present study introduces a highly sensitive assay for the differentiation of three sympatric Haemonchus species, Hco, Hpl and Hlo. The assay was designed with an amplicon size of 130 bp and a probe length of 23 bases in order to maximize the temperature differences between the species-specific melt peaks. The intramolecular hairpin loop covered two diagnostic mutational sites that differentiated Hco and Hpl and also a third site distinguishing Hlo from Hco and Hpl. The assay utilized the melting of snapback primer probe and hence highly specific to the targeted diagnostic mutational sites. The assay was readily able to type all the 199 investigated parasite samples derived from wide geographic locations (Asia-Pakistan; Africa-Nigeria; Europe-Austria and Latin AmericaArgentina, Uruguay), thus showing 100% specificity. The highest level of assay specificity obtained after the analysis of above samples indicated the highly conserved nature of the probe binding domain of the amplicon. To further evaluate variations in the probe binding domain, 159 additional ITS-2 sequences available at NCBI-GenBank database were utilized. These sequences were derived from Haemonchus isolates (133 Hco, 22 Hpl and 4 Hlo) originating from 19 countries and distributed across Africa, Australia, Europe, Central Asia, East Asia, West Asia, South Asia, South East Asia and North America. The host species of these Haemonchus isolates included a wide range consisting of cattle, sheep, goats, camel, goat antelope (Rupicarpa rupicarpa) Giraffe and humans. The details of the country and region of origin, accession numbers, host species and the references of the ITS-2 sequences are presented in Supplementary Table ST1. Multiple alignments of these diverse ITS-2 sequences revealed the probe binding domain of the amplicon being highly conserved. Further, the short region of the snapback stem that covered the diagnostic mutational site for Hlo was also found to be highly conserved across these Haemonchus isolates indicating the potential discriminating power of the assay. The snapback primer probe assay can be successfully used to discriminate adult worms and individual larval samples of Haemonchus species. The assay was also sensitive enough to identify Haemonchus species from the fecal egg samples. In the present study, five out of 25 fecal samples that were scored microscopically positive for strongyle eggs (∼300 to 900 eggs per gram) showed Hco specific melting peaks. The species of all these five samples were confirmed to be H. contortus based on ITS-2 gene sequences. However, it is important to exercise caution while interpreting the results of the assay when fecal samples are used. In situations of sympatric co-infections, the proportion of Hco, Hpl and Hlo eggs may vary widely leading to significant differences in the copy number of their DNA available as templates for PCR amplification. Evaluation of the assay performance with mixtures of positive DNA controls (from the three species) in varying proportions (1:10:100) revealed mixed results. The assay was able to detect both Hco and Hpl when present in equal quantities or when Hpl was higher than Hco (e.g. 10Hpl:1Hco or 100Hpl:1Hco). However, the assay was able to detect only Hco when Hpl was lower than Hco (e.g. 100Hco:1Hpl or 10Hco:1Hpl). The results were similar with respect to mixtures of Hco and Hlo as well. This could be due to relatively higher PCR efficiency of Hco in relation to Hpl and Hlo as indicated by their respective Cq values for different copy numbers (Table 2). Hence, it is safe to conclude that the assay performs accurately to discriminate Haemonchus species among adult worms and individual larval samples, but caution needs to be applied while interpreting the results from fecal egg samples.

9

5. Conclusion To the best of our knowledge, the present study is the first report on the application of snapback primer probe methodology for the differentiation of nematode parasites. The assay works accurately with a high level of sensitivity and specificity across three real time PCR platforms. The results showed the assay to be an effective alternative to the sequencing approach for the differentiation of sympatric Haemonchus species. The assay is expected to be helpful for the screening of individual adult and larval Haemonchus parasites, particularly in the context of differences in the evolution of anthelmintic resistance among the sympatric Haemonchus species. Acknowledgements The present study is part of the Coordinated Research Project D3.10.26 of Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture, International Atomic Energy Agency, Vienna, Austria. The authors thank Mario Poli, Instituto Nacional de Tecnología Agropecuaria, Instituto de Genética Ewald A. Favret, Castelar, Buenos Aires, Argentina; Hussaina Makun, National Animal Production Research Institute, Zaria, Nigeria; Tanveer Hussain, Virtual University of Pakistan, Lahore, Pakistan, America Mederos, Instituto Nacional de Investigaciones Agropecuaria (INIA), Uruguay and Anja Joachim, Institute of Parasitology, Department of Pathobiology, University of Veterinary Medicine, Vienna, Austria for generously providing DNA and fecal samples, adult worms and larval cultures for the present study. Thanks are also due to Tirumala Settypalli Bharani Kumar, Animal Production and Health Laboratory, Joint FAO/IAEA Division, IAEA for useful technical discussions during the study. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.vetpar.2017.02. 012. References Achi, Y.L., Zinsstag, J., Yao, K., Yeo, N., Dorchies, P., Jacquiet, P., 2003. Host specificity of Haemonchus spp. for domestic ruminants in the savanna in northern Ivory Coast. Vet. Parasitol. 116, 151–158. Akkari, H., Jebali, J., Gharbi, M., Mhadhbi, M., Awadi, S., Darghouth, M.A., 2013. Epidemiological study of sympatric Haemonchus species and genetic characterization of Haemonchus contortus in domestic ruminants in Tunisia. Vet. Parasitol. 193, 118–125. Amarante, A.F.T., 2011. Why is it important to correctly identify Haemonchus species? Braz. J. Vet. Parasitol. 20, 263–268. Birrer, M., Kolliker, R., Manzanares, C., Asp, T., Studer, B., 2014. A DNA marker assay based on high-resolution melting curve analysis for distinguishing species of the Festuca-Lolium complex. Mol. Breed. 34, 421–429. Brasil, B.S., Nunes, R.L., Bastianetto, E., Drummond, M.G., Carvalho, D.C., Leite, R.C., Molento, M.B., Oliveira, D.A., 2012. Genetic diversity patterns of Haemonchus placei and Haemonchus contortus populations isolated from domestic ruminants in Brazil. Int. J. Parasitol. 42, 469–479. Charlier, J., van der Voort, M., Kenyon, F., Skuce, P., Vercruysse, J., 2014. Chasing helminths and their economic impact on farmed ruminants. Trends Parasitol. 30, 361–367. Chaudhry, U., Miller, M., Yazwinski, T., Kaplan, R., Gilleard, J., 2014. The presence of benzimidazole resistance mutations in Haemonchus placei from US cattle. Vet. Parasitol. 204, 411–415. Chaudhry, U., Redman, E.M., Abbas, M., Muthusamy, R., Ashraf, K., Gilleard, J.S., 2015. Genetic evidence for hybridization between Haemonchus contortus and Haemonchus placei in natural field populations and its implications for interspecies transmission of anthelmintic resistance. Int. J. Parasitol. 45, 149–159. Dames, S., Margraf, R.L., Pattison, D.C., Wittwer, C.T., Voelkerding, K.V., 2007. Characterization of aberrant melting peaks in unlabeled probe assays. J. Mol. Diagn. 9, 290–296. El Hassan, E.M., Fatani, A., Zagawa, A., Hawsawi, F., 2011. The occurrence and prevalence of Haemonchus longistipes in Dromedaries (Camelus dromedaries) in Al-Ahsa Area, Saudi Arabia. Sci. J. King Faisal Univ. (Basic Appl. Sci.) 12, 157–164.

Please cite this article in press as: Pichler, R., et al., A novel snapback primer probe assay for the detection and discrimination of sympatric Haemonchus species using DNA melting analysis. Vet. Parasitol. (2017), http://dx.doi.org/10.1016/j.vetpar.2017.02.012

G Model VETPAR-8261; No. of Pages 10 10

ARTICLE IN PRESS R. Pichler et al. / Veterinary Parasitology xxx (2017) xxx–xxx

Farrar, J.S., Palais, R.A., Wittwer, C.T., 2011. Snapback primer genotyping of the Gilbert Syndrome UGT1A1 (TA)n promoter polymorphism by high-resolution melting. Clin. Chem. 57, 1303–1310. Gelaye, E., Lamien, C.E., Silber, R., Tuppurainen, E.S., Grabherr, R., Diallo, A., 2013. Development of a cost-effective method for capripoxvirus genotyping using snapback primer and dsDNA intercalating dye. PLoS One 8 (10), e75971. Getachew, T., Dorchies, P., Jacquiet, P., 2007. Trends and challenges in the effective and sustainable control of Haemonchus contortus infection in sheep. Review. Parasite 14, 3–14. Gharamah, A.A., Siti Azizah, M.N., Rahman, W.A., 2012. Genetic variation of Haemonchus contortus (Trichostrongylidae) in sheep and goats from Malaysia and Yemen. Vet. Parasitol. 188, 268–276. Gilleard, J.S., 2013. Haemonchus contortus as a paradigm and model to study anthelmintic drug resistance. Parasitology 140, 1506–1522. Grattapaglia, D., Silva, O.B., Kirst, M., de Lima, B.M., Faria, D.A., Pappas, G.J., 2011. High-throughput SNP genotyping in the highly heterozygous genome of Eucalyptus: assay success, polymorphism and transferability across species. BMC Plant Biol. 11, 65, http://dx.doi.org/10.1186/1471-2229-11-65. Hoberg, E.P., Lichtenfels, J.R., Gibbons, L.M., 2004. Phylogeny for species of Haemonchus (Nematoda: Trichostrongyloidea): considerations of their evolutionary history and global biogeography among Camelidae and Pecora (Artiodactyla). J. Parasitol. 90, 1085–1102. Hoglund, J., Gustaffson, K., Ljungstrom, B.L., Engstrom, A., Donnan, A., Skuce, P., 2009. Anthelmintic resistance in Swedish sheep flocks based on a comparison of the results from the fecal egg count reduction test and resistant allele frequencies of the beta-tubulin gene. Vet. Parasitol. 161, 60–68. Hussain, T., Periasamy, K., Nadeem, A., Babar, M.E., Pichler, R., Diallo, A., 2014. Sympatric species distribution, genetic diversity and population structure of Haemonchus isolates from domestic ruminants in Pakistan. Vet. Parasitol. 206, 188–199. Jacquiet, P., Cabaret, J., Cheikh, D., Thiam, E., 1997. Identification of Haemonchus species in domestic ruminants based on morphometrics of spicules. Parasitol. Res. 83, 82–86. Jacquiet, P., Cabaret, J., Dia, M.L., Cheikh, D., Thiam, E., 1996. Adaptation to arid environment: Haemonchus longistipes in dromedaries of Saharo-Sahelian areas of Mauritania. Vet. Parasitol. 66, 193–204. Kaplan, R.M., 2004. Drug resistance in nematodes of veterinary importance: a status report. Trends Parasitol. 20, 477–481. Kumsa, B., Tolera, A., Abebe, R., 2008. Vulvar morphology and sympatry of Haemonchus species in naturally infected sheep and goats of Ogaden region, eastern Ethiopia. Vet. Archiv. 78, 331–342. Liew, M., Seipp, M., Durtschi, J., Margraf, R.L., Dames, S., Erali, M., Voelkerding, K., Wittwer, C., 2007. Closed-tube SNP genotyping without labeled probes a comparison between unlabeled probe and amplicon melting. Am. J. Clin. Pathol. 127, 341–348.

Liew, M., Pryor, R., Palais, R., Meadows, C., Erali, M., Lyon, E., Wittwer, C., 2004. Genotyping of single-nucleotide polymorphisms by high-resolution melting of small amplicons. Clin. Chem. 50, 1156–1164. Morgan, E.R., Charlier, J., Hendrickx, G., Biggeri, A., Catalan, D., von Samson-Himmelstjerna, G., Demeler, J., Müller, E., van Dijk, J., Kenyon, F., Skuce, P., Höglund, J., O’Kiely, P., van Ranst, B., de Waal, T., Rinaldi, L., Cringoli, G., Hertzberg, H., Torgerson, P., Wolstenholme, A., Vercruysse, J., 2013. Global change and helminth infections in grazing ruminants in europe: impacts, trends and sustainable solutions. Agriculture 3, 484–502. Morsy, K., Bashtar, A.-R., Fol, M., 2014. Haemonchus longistipes Railliet & Henry, 1909 (Nematoda, Trichostrongyloidae) from the Egyptian dromedary, Camelus dromedaries (Artiodactyla: Camelidae), first identification on the basis of light and ultrastructural data. Parasitol. Res. 113, 4579–4585. Roeber, F., Jex, A.R., Gasser, R.B., 2013. Impact of gastrointestinal parasitic nematodes of sheep, and the role of advanced molecular tools for exploring epidemiology and drug resistance-an Australian perspective. Parasites Vectors 6, 153. Santos, M.C., Amarante, M.R.V., Silva, M.R., Amarante, A.F.T., 2014. Differentiation of Haemonchus placei from Haemonchus contortus by PCR and by morphometrics of adult parasites and third stage larvae. Braz. J. Vet. Parasitol. 23, 495–500. Shen, R., Fan, J.-B., Campbell, D., Chang, W., Chen, J., Doucet, D., Yeakley, J., Bibikova, M., Wickham Garcia, E., McBride, C., Steemers, F., Garcia, F., Kermani, B.G., Gunderson, K., Oliphant, A., 2005. High-throughput SNP genotyping on universal bead arrays. Mutat. Res. 573, 70–82. Somogyvari, F., Horvath, A., Serly, J., Majoros, H., Vagvolgyi, C., Peto, Z., 2012. Detection of invasive fungal pathogens by real-time PCR and high-resolution melting analysis. In Vivo 26, 979–984. Stevenson, L.A., Chilton, N.B., Gasser, R.B., 1995. Differentiation of Haemonchus placei from H. contortus (Nematoda: Trichostrongylidae) by the ribosomal DNA second internal transcribed spacer. Int. J. Parasitol. 25, 483–488. Wu, Z., Zhang, Y., Zhang, X., Xu, X., Kang, Z., Li, S., Zhang, C., Su, B., Guan, M., 2014. A multiplex snapback primer system for the enrichment and detection of JAK2 V617 and MPL W515L/K mutations in Philadelphia-Negative myeloproliferative neoplasms. BioMed Res. Int. 458457, http://dx.doi.org/10. 1155/2014/458457. Yin, F., Gasser, R.B., Li, F., Bao, M., Huang, W., Zou, F., Zhao, G., Wang, C., Yang, X., Zhou, Y., Zhao, J., Fang, R., Hu, M., 2013. Genetic variability within and among Haemonchus contortus isolates from goats and sheep in China. Parasites Vectors 6, 279. Zhou, L.M., Myers, A.N., Vandersteen, J.G., Wang, L., Wittwer, C.T., 2004. Closed-tube genotyping with unlabeled oligonucleotide probes and a saturating DNA dye. Clin. Chem. 50, 1328–1335. Zhou, L., Errigo, R.J., Lu, H., Poritz, M.A., Seipp, M.T., Wittwer, C.T., 2008. Snapback primer genotyping with saturating DNA dye and melting analysis. Clin. Chem. 54, 1648–1656.

Please cite this article in press as: Pichler, R., et al., A novel snapback primer probe assay for the detection and discrimination of sympatric Haemonchus species using DNA melting analysis. Vet. Parasitol. (2017), http://dx.doi.org/10.1016/j.vetpar.2017.02.012