A novel transducible chimeric phage from Escherichia coli O157:H7 Sakai strain encoding Stx1 production

Infection, Genetics and Evolution 29 (2015) 42–47

Contents lists available at ScienceDirect

Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid

A novel transducible chimeric phage from Escherichia coli O157:H7 Sakai strain encoding Stx1 production Domonkos Sváb a, Balázs Bálint b, Gergely Maróti c, István Tóth a,⇑ a

Institute for Veterinary Medical Research, Centre for Agricultural Research, Hungarian Academy of Sciences, H-1143, Hungária krt. 21, Budapest, Hungary Seqomics Biotechnology Ltd., H-6782, Vállalkozók útja 7, Mórahalom, Hungary c Institute of Biochemistry, Biological Research Centre, Hungarian Academy of Sciences, H-6726, Temesvári krt. 62, Szeged, Hungary b

a r t i c l e

i n f o

Article history: Received 7 July 2014 Received in revised form 22 October 2014 Accepted 23 October 2014 Available online 4 November 2014 Keywords: O157:H7 Sakai strain Stx phages Phage recombination Lysogenic conversion

a b s t r a c t Shiga toxin-producing Escherichia coli (STEC), and especially enterohaemorrhagic E. coli (EHEC) are important, highly virulent zoonotic and food-borne pathogens. The genes encoding their key virulence factors, the Shiga toxins, are distributed by converting bacteriophages, the Stx phages. In this study we isolated a new type of inducible Stx phage carrying the stx1 gene cluster from the prototypic EHEC O157:H7 Sakai strain. The phage showed Podoviridae morphology, and was capable of converting the E. coli K-12 MG1655 strain to Shiga toxin-producing phenotype. The majority of the phage genes originate from the stx2-encoding Sakai prophage Sp5, with major rearrangements in its genome. Beside certain minor recombinations, the genomic region originally containing the stx2 genes in Sp5 was replaced by a region containing six open reading frames from prophage Sp15 including stx1 genes. The rearranged genome, together with the carriage of stx1 genes, the morphology and the capability of lysogenic conversion represent a new type of recombinant Stx1 converting phage from the Sakai strain. Ó 2014 Elsevier B.V. All rights reserved.

1. Introduction Shiga toxin-producing Escherichia coli strains (STEC), particularly the subset producing intimin termed as enterohaemorrhagic E. coli (EHEC), are important pathogens capable of causing diarrhea, bloody diarrhea and the life-threatening condition known as haemolytic uraemic syndrome (HUS, reviewed by Caprioli et al., 2005). Their key virulence factors, the Shiga-toxins (Stx1 and Stx2) are encoded by a set of converting lambdoid bacteriophages termed Stx phages (reviewed by Schmidt, 2001). Because of their significant pathogen status, genomes of EHEC strains have been extensively characterised (Hayashi et al., 2001; Perna et al., 2001). These studies revealed that EHEC strains tend to harbour several prophages, some of which – including Stx1 and Stx2 – are inducible or transducible (Schmidt et al., 1999; Tóth et al., 2003). It was also demonstrated that Stx phages show remarkable diversity regarding genome composition, genome size, morphology and host specificity (Schmidt, 2001; Allison et al., 2003; Muniesa et al., 2004). A study of the prophages in the genome of the prototypic EHEC strain O157:H7 Sakai revealed that Stx phages are capable of recombination between each other (Asadulghani et al., 2009). The diversity and versatility of bacteriophages capable of transmitting a potent ⇑ Corresponding author. Tel.: +36 1 2522455; fax: +36 1 2521069. E-mail address: [email protected] (I. Tóth). http://dx.doi.org/10.1016/j.meegid.2014.10.019 1567-1348/Ó 2014 Elsevier B.V. All rights reserved.

cytotoxin is of concern (Allison et al., 2003), as it may also lead to the emergence of new virulent strains, and even new pathotypes, as exemplified by the 2011 German outbreak of Shiga toxinproducing enteroaggregative strains, termed ‘EAHEC’ strains (Brzuszkiewicz et al., 2011). Here we report a new type of Stx1 converting phage released from the prototypic E. coli O157:H7 Sakai strain, with the majority of its genome derived originally from the stx2-encoding prophage Sp5 in a rearranged gene order, which is capable of converting the K-12 strains.

2. Materials and methods 2.1. Bacterial strains The source of the phage was the EHEC O157:H7 Sakai strain (Hayashi et al., 2001). As a positive control for phage induction, the E. coli O157:H7 strain 34 (Tóth et al., 2009), and the prototypic strain EDL933 of the same serotype (Perna et al., 2001), harbouring an inducible Stx2 phage was used. For propagation and transduction purposes E. coli K-12 strains C600, DH5-alpha and MG1655 were used, together with strains of the E. coli Reference Collection (ECOR). In the cytotoxicity assays, besides the parental and transductant strains, EDL933 was also used as positive control.

43

D. Sváb et al. / Infection, Genetics and Evolution 29 (2015) 42–47

2.2. Phage induction experiments In order to mobilise the phage, induction experiments were carried out according to Strauch et al. (2001). Briefly, one characteristic colony of the phage-carrying strains was picked and incubated overnight at 37 °C in lysogeny broth (LB) with shaking by 200 rpm. The resulting overnight culture was diluted 50-fold, and grown for 2.5 h under the same conditions, and induced afterwards using mitomycin-C in 0.5 lg ml1 final concentration. Cultures were centrifuged with 13,000g and the supernatant was filtered on a sterile 220 nm pore filter (Millipore). The filtered supernatant was used in layered soft agar (0.5% V/V agarose) platings with E. coli strain C600 used as propagating strain. After overnight incubation, plaques were recovered and incubated with shaking in LB overnight. The liquid phase of these cultures was centrifuged and filtered as described above, and was used as phage suspension in later experiments. Phage titer was evaluated by spot test on streaks of the propagating K-12 strains and the ECOR strains after overnight incubation. The same induction protocol was used for testing the inducibility of the phage from the transductant strains. 2.3. Phage DNA isolation and PCR For PCR purposes, phage suspension was treated with Amplification Grade DNase I (Sigma–Aldrich) as per the manufacturer’s instructions, and incubated at 99.9 °C for 20 min for deactivation of the enzyme and the lysis of phage particles, the treated suspension was used as PCR template. Reactions for detecting stx genes were performed according to (China et al., 1996) using DreamTaq (Fermentas, Vilnius, Lithuania) and PCRBIO Taq Mix Red (PCR Biosystems, London, United Kingdom). 2.4. Transduction of the Stx1-encoding phage in E. coli K-12 strains In order to investigate the transduction capabilities of the phage, drops of the phage suspension were placed on layered soft agar plates containing the propagating strains. After overnight incubation, surviving colonies within the lysed patches were picked and grown independently. The resistance of these colonies to the phage was tested by spot test with the original phage suspension. DNA was isolated by boiling the cultures and PCRs specific for stx genes were performed as described by China et al. (1996). Three additional phage-specific genes were detected with the primers listed in Table 1. The integrity of characteristic Stx1 and Stx2 phage integration sites were investigated by PCR using primers specific for wrbA (Tóth et al., 2003) yehV, yecN (Shaikh and Tarr, 2003) sbcB (Ohnishi et al., 2002), and argW (Shringi et al., 2012). 2.5. Phage genome sequencing To determine its nucleotide sequence, phage DNA was isolated with a protocol similar to that described in Sambrook et al. (1982) with some modifications. Briefly, phage suspension was treated with DNAse, RNAse and proteinase K (Sigma–Aldrich) per the manufacturer’s instructions, lysed, and mixed with a 1:1 mixture of

phenol and chloroform. The aqueous phase was separated by centrifugation and DNA was precipitated with 2-propanol. Sequencing was performed using an IonTorrent PGM instrument (Life Technologies, USA). De novo genome assembly has been carried out by Mira 3.9.16 (Chevreux et al., 1999) with a subsampled set of raw reads (approximately 2%). Subsequently, all quality-trimmed PGM reads were mapped back to the obtained 61 kb contig using CLC Genomics Workbench Tool (V.6.0.1) yielding a consensus genome sequence with an average read coverage of 1660. Finally, the RAST online genome annotation service (Overbeek et al., 2014) was used to identify and annotate open reading frames (ORFs) of the novel phage genome. 2.6. Nucleotide sequence accession number Whole genome sequence of the Stx1 converting phage was deposited under GenBank accession number KJ909655. 2.7. Transmission electron microscopy 5 ll of phage suspension was placed on a carbon-coated grid. The excess liquid was removed using filter paper. The samples were contrasted with 2% phospho wolframic acid and was examined with JEOL (JEM-1011) electronmicroscope at 80 kV. 2.8. Cytotoxicity assay For the investigation of Shiga toxin production by transductant lines of strain MG1655, semi-confluent Vero-cell cultures were incubated with the supernatant of bacterial cultures. Bacterial cultures of Sakai, EDL933 MG1655 and the transductant line MG1655 ⁄ 4 were grown as described in Tóth et al. (2003). Briefly, after shaking them overnight in tryptic soy broth, cultures were divided and one aliquot was supplemented with mitomycin-C to a concentration of 0.5 lg ml1. After this addition, all cultures were shaken overnight again. Based on the OD600 values of the cultures, the bacterium-free supernatants were equalized, and added in a dilution range from 10 to 1600 to the Vero-cell cultures, which were incubated for 2 days at 37 °C in 5% CO2 atmosphere. Cells were fixed and stained using Giemsa’s method and evaluated by light microscopy. 3. Results 3.1. Phage induction In order to isolate and characterise Stx phages from prototypic E. coli O157:H7 Sakai strain, phage induction experiments were conducted and isolated plaques were tested for the presence of stx1 and stx2 genes by PCR. Interestingly, only stx1-positive phages were found (7/20), in contrast to the EDL933 strain, from which only stx2-positive phages were identified (8/10). An stx1-positive lytic phage from the Sakai strain, originating from one plaque, was selected for characterisation.

Table 1 Phage-specific primers designed and used in this study. Positions refer to GenBank KJ909655. Primer name

Sequence 50 –>30

Position

Gene amplified

ptp_fw ptp_rev phage_integrase_fw phage_integrase_rev phage_hypo_fw phage_hypo_rev

AAAGGTGAGCGTGGTGACG CCGCGCTCTCCCTTATCAC TTGCTGGTGCCAGAAGATGT TGAACTGGCACAGAAATGGC ACTGGTTGACCCGATGATGG CCCCCTGTTTGATCCCAAGT

112–130 716–734 23,717–23,736 24,290–24,309 59,818–59,837 60,355–60,374

Phage tail fiber protein (ORF1) Phage integrase (ORF25) Hypothetical protein (ORF93)

44

D. Sváb et al. / Infection, Genetics and Evolution 29 (2015) 42–47

3.2. Morphology and host specificity of stx1-carrying phage We isolated a bacteriophage from the E. coli O157:H7 Sakai strain after induction with mitomycin C, which carries the stx1 gene, has the morphology of Podoviridae (Fig. 1) and is capable of propagating on E. coli K-12 strain C600, MG1655 and DH5alpha and is also capable of the lysogenic conversion of C600 and MG1655. In addition, we tested all of the E. coli Reference Collection (ECOR) strains as potential hosts, but the phage could not propagate on any of them. 3.3. Transduction capabilities Besides E. coli C600 K-12, the Sakai Stx1 converting phage is capable to propagate on and convert the K-12 line MG1655 and C600. Five transductant colonies of MG1655 and three of C600 were purified. After induction, no lytic phage was detected from these transductants. The converted strains all carried the stx1 gene and three other investigated phage-specific genes (Table 1), and were resistant to lysis with the original phage. PCR investigation has shown that the wrbA, as well as the yecN-yecD and sbcB genomic site was disrupted in one of the C600-derived transductant lines, but these integration sites were intact in the remaining seven transductants, and yehV was intact in all transductant lines.

phage was deposited under KJ909655, as stated earlier.

GenBank

accession

number

3.6. Sequence features The total length of the prophage genome is 61,138 bp. When compared to the original Sp5 and Sp15, ten SNPs were identified in the investigated recombinant phage genome of Sakai origin. Seven of these were located in ORF73, which are possibly results of recombination with a non-coding sequence of Sp5 in position 1,271,671–1,271,943 of the Sakai genome. The SNP in position 23,232, within a non-coding region can be a result of a similar recombination, in this case between the non-coding region from 1,246,012 to 1,246,039 in the Sakai genome (GenBank No. BA000007, a non-coding region immediately preceding Sp5) and the region between positions 23,225–23,252 of the phage. The SNP in ORF50 in position 34,155, which encodes a CI repressor protein, can also be explained by a partial recombination. The Sakai genome carries a close homologue of this gene in positions 301,939–302,652. In this repressor gene, the corresponding nucleotide (position 301,968) is the same as in the phage, although in other positions it differs from ORF50. Additionally, there is an SNP in ORF5 (position 3135) which possibly represents a random mutation.

3.4. Stx production of transductant E. coli K-12 lines It was also demonstrated using cultures of Vero-cells that a converted strain of MG1655 showed a Shiga toxin producing phenotype, with a titer of at least 800 in all cases, which was equal to those shown by the Sakai and EDL933 strains. There was no detectable difference between the toxin titer of bacterial cultures grown with and without mitomycin C. 3.5. Genome sequence of the Stx1 phage Determination of the nucleotide sequence of the Sakai Stx1 converting phage confirmed that it only contains genes originating from the E. coli O157:H7 Sakai strain. The list of ORFs and their putative functions is shown in Table 2, and the original positions of phage genomic regions in the Sakai genome are indicated in Fig. 2. The phage genome contains 93 ORFs, of which two genes encode Stx1, as well as five surrounding genes (ORFs 67–73) originate from the Stx1-encoding Sp15 prophage of the Sakai strain, the other genes are from Sp5. ORF73 contains seven single nucleotide polymorphisms (SNP) when compared to the Sakai genome. ORFs 5, 50 and position 23,232 in a non-coding region also contain one SNP, respectively. There are also major rearrangements in the order of genes originating from Sp5, as indicated in Table 2 and Fig. 2. The genome sequence of the recombinant Stx1 converting

Fig. 1. Transmission electronmicrograph of the novel Sakai Stx1 converting phage. Phage particles show the typical Podoviridae-like morphology, indicating Sp5 origin. The bar corresponds to 80 nm.

4. Discussion We identified and sequenced a novel, inducible, recombinant phage from the E. coli O157:H7 Sakai strain, which carries the stx1 gene, but originates from the stx2-carrying prophage Sp5, and is capable of lysogenising E. coli K-12 strains and converting them to Shiga-toxin producing phenotype. The morphology of the new recombinant Sakai Stx1 converting phage is very similar to the VT-1 phage of the EHEC O157:H7 Morioka strain (Sato et al., 2003) and the Sp5-derived Sakai phages reported by Asadulghani et al. (2009), showing Podoviridae-like morphology (Fig. 1), which is different from the Myoviridae or Siphoviridae-like morphology typical to phages released by the other prototypic EHEC O157:H7 strain EDL933 (Schmidt, 2001). Although it has been reported that mitomycin C increases Stx-production (Mühldorfer et al., 1996), our phenotypic experiments with a transductant line of MG1655 showed no observable difference between bacterial cultures grown without mitomycin C or those supplemented with it. In contrast to the several inducible and transducible stx2carrying phages (Muniesa et al., 2004; García-Aljaro et al., 2006, 2009), there have been fewer reports of inducible or transducible bacteriophages carrying stx1 (Acheson et al., 1998; Strauch et al., 2001; Sato et al., 2003), but the present study is the first to characterise such a phage from the prototypic Sakai strain with the morphology typical to Sp5-derived phages (Asadulghani et al., 2009) in detail. The fact that the new recombinant Sakai Stx1-converting phage was able to propagate only on E. coli K-12 strains, moreover it becomes non-inducible in the transductant lines, indicates that these strains could be ‘terminal’ hosts of the phage. Similar phenomenon was observed by Tóth et al. (2003), who could not induce stx2-carrying phages from enteropathogenic E. coli (EPEC) strains lysogenised with a Stx2 phage. The occupied status of the wrbA integration site of the phage in the one of the transductant C600-derived K-12 lines is also typical for Stx2 phages (Shaikh and Tarr, 2003; Serra-Moreno et al., 2007), and is in harmony with our finding that the majority of its genes originate from Sp5 of the Sakai genome. The disruption of further integration sites in the

45

D. Sváb et al. / Infection, Genetics and Evolution 29 (2015) 42–47

Table 2 List of ORFs in the genome of the stx1-carrying phage (GenBank KJ909655). ORFs 1–25 correspond to positions 1,285,496–1,308,182, ORFs 26–66 to position 1,246,040–1,264,958, and ORFs 74–93 to position 1,271,940–1,285,495 in the Sakai genome (GenBank BA000007). These three regions originate from Sp5, the Stx2 prophage. ORFs 67–73 correspond to position 2,927,446–2,922,033 in the Sakai genome, and they originate from Sp15, the Stx1 prophage. ORF

Beginning

End

Length

Function

Corresponding gene in Sakai genome

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44

85 1187 1581 1890 2118 3740 5023 5307 6015 6982 7179 7674 8333 8789 9051 10,386 19,053 19,318 19,782 20,228 20,623 21,303 21,508 21,789 22,058 23,253 24,616 24,986 25,357 25,634 26,261 26,550 26,770 26,987 27,327 28,097 28,417 28,709 29,052 29,729 30,520 30,891 31,003 31,240

1224 1495 1823 2003 3743 5008 5301 5924 6749 7122 7580 8330 8779 9040 10,316 18,767 19,238 19,662 19,937 20,623 21,282 21,521 21,792 22,010 22,687 24,563 24,900 25,285 25,641 26,257 26,548 26,768 26,985 27,193 28,100 28,318 28,632 28,900 29,732 30,514 30,816 31,034 31,167 31,608

1140 309 243 114 1626 1269 279 618 735 141 402 657 447 252 1266 8382 186 345 156 396 660 219 285 222 630 1311 285 300 285 624 288 219 216 207 774 222 216 192 681 786 297 144 165 369

Putative tail fiber protein Putative tail fiber protein Hypothetical protein Putative outer membrane protein Putative tail tip fiber protein Hypothetical protein Putative outer membrane protein Hypothetical protein Putative outer membrane precursor Unnamed protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein MokW protein Hypothetical protein Hypothetical protein Hypothetical protein Unknown, identical to hypothetical protein [Bacteriophage VT2-Sakai] C4-type zinc finger protein (TraR family) Putative anti-repressor protein Putative integrase Putative excisionase Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein C4-type zinc finger protein (TraR family) Hypothetical protein Hypothetical protein Exonuclease Recombination protein Bet Host-nuclease inhibitor protein Gam Kil protein Regulatory protein cIII Single strand binding protein Ea10

45 46 47 48 49 50 52 53 54 55 56 58 59 60 61 62 63 64 65 66

31,791 32,101 32,351 33,103 33,847 34,126 34,897 35,254 35,583 35,722 36,611 38,047 38,387 38,798 39,024 39,358 39,660 40,184 40,641 41,450

32,042 32,223 32,533 33,624 33,981 34,821 35,112 35,550 35,729 36,621 38,047 38,316 38,665 39,013 39,260 39,663 40,187 40,366 41,375 42,172

252 123 183 522 135 696 216 297 147 900 1437 270 279 216 237 306 528 183 735 723

67 68 69 70 71 72

42,172 42,774 42,961 43,902 44,859 45,509

42,777 42,968 43,395 44,849 45,128 45,640

606 195 435 948 270 132

Phage tail fiber protein Phage tail fiber protein Hypothetical protein Hypothetical protein Hypothetical protein Phage tail fiber protein Putative outer membrane protein Hypothetical protein Attachment invasion locus protein Hypothetical protein Phage protein Hypothetical protein Hypothetical protein Phage protein Hypothetical protein Phage protein Phage protein Protein ygiW precursor MokW protein Phage protein Phage EaA protein Hypothetical protein Unknown protein encoded by prophage Hypothetical zinc-finger containing protein Phage antirepressor protein Phage integrase Phage excisionase Phage protein Phage protein Phage EaA protein Phage protein Hypothetical protein Phage protein Phage protein Hypothetical protein Hypothetical zinc-finger containing protein Phage protein Recombinational DNA repair protein Phage exonuclease Recombinational DNA repair protein recT Mobile element protein Kil protein Phage regulatory protein Single-stranded DNA binding protein, phageassociated Phage protein Phage antitermination protein N Hypothetical protein Phage protein Hypothetical protein Putative cI repressor protein for prophage CP933H Putative repressor protein Phage repressor Phage protein Phage replication initiation protein DNA helicase ORF30 Phage protein Phage protein Phage protein Protein NinB Putative DNA N-6-adenine methyltransferase Phage NinE Hypothetical protein Putative DNA binding protein Roi of bacteriophage BP-933 W Phage NinG rap recombination Phage NinH Antitermination protein Q Shiga-toxin A chain precursor Shiga-toxin I subunit B precursor Hypothetical protein

Hypothetical protein Putative anti-termination protein N Hypothetical protein Hypothetical protein (Not annotated) Putative CI repressor protein Putative regulatory protein Regulatory protein cII Hypothetical protein Hypothetical protein Replication protein O Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Putative DNA methylase NinE protein Putative antirepressor protein DNA binding protein, identical to Roi Hypothetical protein, similar to NinG Hypothetical protein Antitermination protein Shiga-toxin I subunit A precursor Shiga-toxin I subunit B precursor Hypothetical protein (continued on next page)

46

D. Sváb et al. / Infection, Genetics and Evolution 29 (2015) 42–47

Table 2 (continued) ORF

Beginning

End

Length

Function

Corresponding gene in Sakai genome

73

45,639

47,585

1947

Hypothetical protein

74 75 76 77 78 79 80

47,582 47,720 47,940 48,298 48,509 49,162 49,313

47,707 47,899 48,212 48,504 49,042 49,281 49,882

126 180 273 207 534 120 570

81

50,036

50,500

465

82 83 84 85 86 87 88 89 90 91 92 93

50,532 50,975 51,234 52,066 53,727 55,914 56,029 57,060 58,330 58,769 59,214 59,777

50,825 51,178 52,040 53,727 55,871 56,039 57,036 58,274 58,719 59,230 59,777 60,427

294 204 807 1662 2145 126 1008 1215 390 462 564 651

Unknown protein encoded within prophage CP933V Phage protein Phage protein Phage protein Phage holin lysis protein S Lysosime Hypothetical protein Phage antirepressor protein #of cryptic prophage CP-933 M Phage outer membrane lytic protein Rz, endopeptidase Lipoprotein Bor Phage protein Hypothetical protein Phage protein Phage protein Hypothetical protein Hypothetical protein Conserved phage protein Hypothetical protein Hypothetical protein Phage protein Hypothetical protein

Fig. 2. Genomic comparison of Shiga toxin encoding phages from the E. coli O157:H7 Sakai strain. (A) Sp5 (VT-2 Sakai phage, Makino et al., 1999), (B) novel recombinant Stx1 converting phage and (C) Sp15. The positions indicated for the brackets refer to the Sakai genome (GenBank No. BA000007). Bars filled with the same pattern have 100% identity except for the ten SNPs indicated in 3.6.

same transductant could indicate multiple infection, while in other transductants the phage utilised different integration site(s). In an earlier study it was also reported that converted strains generated by infection with Sp15 carry chimeras of Sp5 and Sp15, but the complete genome of the phages was not determined (Asadulghani et al., 2009). The Sakai Stx1 converting phage described here is indeed a chimera of Sp5 and Sp15, with some short elements from other regions of the Sakai genome. The gene content of the phage is largely identical to Sp5, except ORFs 67–73, which are from Sp15 (positions 2927446–2922033 in the Sakai genome, GenBank BA000007), containing the stx1 genes. These ORFs are very similar to the corresponding genes in Sp5, and the switch does not seem to affect neither the transduction capability of the phage, nor the Stx-production in the transductant strains. There are also major rearrangements in the

(not annotated) Hypothetical protein Hypothetical protein Putative holin protein Putative endolysin (Not annotated) Putative antirepressor protein Probable endopeptidase Bor protein precursor Hypothetical protein Putative small subunit terminase Putative terminase large subunit Putative portal protein (Not annotated) Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Hypothetical protein Probable tail fiber protein, identical to putative tail fiber protein [Bacteriophage 933 W]

gene order of the Sp5 genes, with three major regions switched, and recombinations in three ORFs and in a non-coding region were observed, which may explain the indicated SNPs found in the respective regions (see Table 2 and Fig. 2 for details). This type of genetic plasticity is considered characteristic for EHEC O157:H7 strains (Kaper and Karmali, 2008). Therefore, while the basic genetic content of the phage is quite similar to the VT-1 phage isolated from the Morioka strain (Sato et al., 2003), the rearrangements and minor recombinations clearly represent a new genotype among Stx1-converting phages. It has been shown that lambdoid phages are capable of extensive recombination and are prone to mosaicism, in large part due to their encoded recombinase enzyme systems (De Paepe et al., 2014). Because of the status of EHEC strains as important pathogens, and the role of Stx phages in the distribution of their key virulence factors, the Shiga toxins, Stx phages have been widely characterised (García-Aljaro et al., 2009; Smith et al., 2012). The possibility of the emergence of new phages from STEC strains by recombination has been suggested by multiple works (Allison et al., 2003; Smith et al., 2012), with one of them attributing this possibility mainly to the existence of the lambda-red recombinase system encoded by Stx phages (Smith et al., 2012). It has been demonstrated by Asadulghani et al. (2009) that the recombination of Sakai phages does indeed occur. It is most likely that our finding of this new type of Stx1 converting phage is a result of such recombination events. Recombination can be a major factor in the evolution of Stx phages, as it is probable that similar recombinant and transducible phages are also released among natural conditions, and may play a role in the wide dissemination of stx genes, contributing to the existence of STEC strains which represent more than 400 serotypes up to date (Blanco et al., 2004). The detailed study of the genetics and modes of transmission of Stx phages from a wider range of STEC strains should shed more light on the transmission and recombination processes of this important group of bacteriophages. Acknowledgments We thank Renáta Pop (Department of Pathology, Faculty of Veterinary Medicine, Szent István University, Budapest, Hungary)

D. Sváb et al. / Infection, Genetics and Evolution 29 (2015) 42–47

for the assistance in transmission electron microscopy, and Emília Szállás (Veterinary Diagnostic Directorate, National Food Chain Safety Office, Budapest, Hungary) for providing Vero-cell cultures. This study was supported by the Hungarian Research Fund (OTKA) grant number K 81 252. References Acheson, D.W., Reidl, J., Zhang, X., Keusch, G.T., Mekalanos, J.J., Waldor, M.K., 1998. In vivo transduction with Shiga toxin 1-encoding phage. Infect. Immun. 66, 4496–4498. Allison, H.E., Sergeant, M.J., James, C.E., Saunders, J.R., Smith, D.L., Sharp, R.J., Marks, T.S., McCarthy, A.J., 2003. Immunity profiles of wild-type and recombinant Shiga-like toxin-encoding bacteriophages and characterization of novel double lysogens. Infect. Immun. 71, 3409–3418. Asadulghani, M., Ogura, Y., Ooka, T., Itoh, T., Sawaguchi, A., Iguchi, A., Nakayama, K., Hayashi, T., 2009. The defective prophage pool of Escherichia coli O157: prophage-prophage interactions potentiate horizontal transfer of virulence determinants. PLoS Pathog. 5, e1000408. Blanco, M., Blanco, J.E., Mora, A., Dahbi, G., Alonso, M.P., González, E.A., Bernárdez, M.I., Blanco, J., 2004. Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from cattle in Spain and identification of a new intimin variant gene (eae-n). J. Clin. Microbiol. 42, 645–651. Brzuszkiewicz, E., Thürmer, A., Schuldes, J., Leimbach, A., Liesegang, H., Meyer, F., Boelter, J., Petersen, H., Gottschalk, G., Daniel, R., 2011. Genome sequence analyses of two isolates from the recent Escherichia coli outbreak in Germany reveal the emergence of a new pathotype: entero-aggregative-haemorrhagic Escherichia coli (EAHEC). Arch. Microbiol. 193, 883–891. Caprioli, A., Morabito, S., Brugère, H., Oswald, E., 2005. Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet. Res. 36, 289–311. Chevreux, B., Wetter, T., Suhai, S., 1999. Genome sequence assembly using trace signals and additional sequence information. In: Computer science and biology: proceedings of the German conference on bioinformatics (GCB) 99, pp. 45–56. China, B., Pirson, V., Mainil, J., 1996. Typing of bovine attaching and effacing Escherichia coli by multiplex in vitro amplification of virulence-associated genes. Appl. Environ. Microbiol. 62 (9), 3462–3465. De Paepe, M., Hutinet, G., Son, O., Amarir-Bouhram, J., Schbath, S., Petit, M., 2014. Temperate phages acquire DNA from defective prophages by relaxed homologous recombination: the role of rad52-like recombinases. PLoS Genet. 10, e1004181. García-Aljaro, C., Muniesa, M., Jofre, J., Blanch, A.R., 2006. Newly identified bacteriophages carrying the stx2g Shiga toxin gene isolated from Escherichia coli strains in polluted waters. FEMS Microbiol. Lett. 258, 127–135. García-Aljaro, C., Muniesa, M., Jofre, J., Blanch, A.R., 2009. Genotypic and phenotypic diversity among induced, stx2-carrying bacteriophages from environmental Escherichia coli strains. Appl. Environ. Microbiol. 75, 329–336. Hayashi, T., Makino, K., Ohnishi, M., Kurokawa, K., Ishii, K., Yokoyama, K., Han, C.G., Ohtsubo, E., Nakayama, K., Murata, T., Tanaka, M., Tobe, T., Iida, T., Takami, H., Honda, T., Sasakawa, C., Ogasawara, N., Yasunaga, T., Kuhara, S., Shiba, T., Hattori, M., Shinagawa, H., 2001. Complete genome sequence of enterohaemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12. DNA Res. 8, 11–22. Kaper, J.B., Karmali, M.A., 2008. The continuing evolution of a bacterial pathogen. Proc. Natl. Acad. Sci. U.S.A. 105, 4535–4536. Makino, K., Yokoyama, K., Kubota, Y., Yutsudo, C.H., Kimura, S., Kurokawa, K., Ishii, K., Hattori, M., Tatsuno, I., Abe, H., Iida, T., Yamamoto, K., Onishi, M., Hayashi, T.,

47

Yasunaga, Honda, T., Sasakawa, C., Shinagawa, H., 1999. Complete nucleotide sequence of the prophage VT2-Sakai carrying the verotoxin 2 genes of the enterohaemorrhagic Escherichia coli O157:H7 derived from the Sakai outbreak. Genes Genet. Syst. 74, 227–239. Muniesa, M., Blanco, J.E., De Simón, M., Serra-Moreno, R., Blanch, A.R., Jofre, J., 2004. Diversity of Stx2 converting bacteriophages induced from Shiga-toxinproducing Escherichia coli strains isolated from cattle. Microbiology 150, 2959–2971. Mühldorfer, I., Hacker, J., Keusch, G.T., Acheson, D.W., Tschäpe, H., Kane, A.V., Ritter, A., Olschläger, T., Donohue-Rolfe, A., 1996. Regulation of the shiga-like toxin ii operon in Escherichia coli. Infect. Immun. 64, 495–502. Ohnishi, M., Terajima, J., Kurokawa, K., Nakayama, K., Murata, T., Tamura, K., Okura, Y., Watanabe, H., Hayashi, T., 2002. Genomic diversity of enterohaemorrhagic Escherichia coli O157 revealed by whole genome PCR scanning. Proc. Natl. Acad. Sci. U.S.A. 99, 17043–17048. Overbeek, R., Olson, R., Pusch, G.D., Olsen, G.J., Davis, J.J., Disz, T., Edwards, R.A., Gerdes, S., Parrello, B., Shukla, M., Vonstein, V., Wattam, A.R., Xia, F., Stevens, R., 2014. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res. 42, D206–D214. Perna, N.T., Plunkett 3rd, G., Burland, V., Mau, B., Glasner, J.D., Rose, D.J., Mayhew, G.F., Evans, P.S., Gregor, J., Kirkpatrick, H.A., Pósfai, G., Hackett, J., Klink, S., Boutin, A., Shao, Y., Miller, L., Grotbeck, E.J., Davis, N.W., Lim, A., Dimalanta, E.T., Potamousis, K.D., Apodaca, J., Anantharaman, T.S., Lin, J., Yen, G., Schwartz, D.C., Welch, R.A., Blattner, F.R., 2001. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 409, 529–533. Sambrook, J., Fritsch, E.F., Maniatis, T., 1982. Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. Sato, T., Shimizu, T., Watarai, M., Kobayashi, M., Kano, S., Hamabata, T., Takeda, Y., Yamasaki, S., 2003. Genome analysis of a novel Shiga toxin 1 (Stx1)-converting phage which is closely related to Stx2-converting phages but not to other Stx1-converting phages. J. Bacteriol. 185, 3966–3971. Schmidt, H., 2001. Shiga-toxin-converting bacteriophages. Res. Microbiol. 152, 687– 695. Schmidt, H., Bielaszewska, M., Karch, H., 1999. Transduction of enteric Escherichia coli isolates with a derivative of Shiga toxin 2-encoding bacteriophage phi3538 isolated from Escherichia coli O157:H7. Appl. Environ. Microbiol. 65, 3855– 3861. Serra-Moreno, R., Jofre, J., Muniesa, M., 2007. Insertion site occupancy by stx2 bacteriophages depends on the locus availability of the host strain chromosome. J. Bacteriol. 189, 6645–6654. Shaikh, N., Tarr, P.I., 2003. Escherichia coli O157:H7 Shiga toxin-encoding bacteriophages: integrations, excisions, truncations, and evolutionary implications. J. Bacteriol. 185, 3596–3605. Shringi, S., Schmidt, C., Katherine, K., Brayton, K.A., Hancock, D.D., Besser, T.E., 2012. Carriage of stx2a differentiates clinical and bovine-biased strains of Escherichia coli O157. PLoS One 7, e51572. Smith, D.L., Rooks, D.J., Fogg, P.C.M., Darby, A.C., Thomson, N.R., McCarthy, A.J., Allison, H.E., 2012. Comparative genomics of Shiga toxin encoding bacteriophages. BMC Genomics 13, 311. Strauch, E., Lurz, R., Beutin, L., 2001. Characterization of a Shiga toxin-encoding temperate bacteriophage of Shigella sonnei. Infect. Immun. 69, 7588–7595. Tóth, I., Schmidt, H., Dow, M., Malik, A., Oswald, E., Nagy, B., 2003. Transduction of porcine enteropathogenic Escherichia coli with a derivative of a Shiga toxin 2encoding bacteriophage in a porcine ligated ileal loop system. Appl. Environ. Microbiol. 69, 7242–7247. Tóth, I., Schmidt, H., Kardos, G., Lancz, Z., Creuzburg, K., Damjanova, I., Pászti, J., Beutin, L., Nagy, B., 2009. Virulence genes and molecular typing of different groups of Escherichia coli O157 strains in cattle. Appl. Environ. Microbiol. 75, 6282–6291.