A one-step microbial DNA extraction method using “Chelex 100” suitable for gene amplification

© Itqs'rl~v PASTEUR/ELsEVIER Pafi_'s 1992

Res, MicrobioL 1992, 143, 785-790

A one-step microbial DNA extraction method using "Chelex 100" suitable for gene amplification X. de Lambailerie (*), C. Zandotti, C. Vignoli, C. BolLlet and P. de Micco Laboratoire de Microbiologie et d'Hygi~ne Hospitali~res, itOpital S~ivator, 13009 Marseil!e (France)

SUMMARY

"'Chelex 100"" chelating resin has been previously proposed for the rapid exlraction of human DNA for polymerasQ chain reaction. Protocols are given for the rapid el(traction of bacterial and viral DNA from cultures or clinical saml~es. The DMA samples obta[ned were suitable for use in polymerase chain reaction.

Key'-words: PeR, DNA; Extraction, Chelating resin, Bacteria. INTRODUC~£1ON

Procedures utilizing '"Chelex 100" (Bio-Rad, Richmond, CA) chelating resin have been previously develoIJed for extracting human DNA from forensic-type samples for use with the polymerase chain reaction (PCR) (Walsh et aL, 1991). Human cells were ]ysed by hearing at 100°C in 5 % Cheiex suspensions in watcr. Under these conditions, the protective effect of Chelex against the degradation of DNA at high temperature was dem~,nstrated. However, since most of the human cells that were studied could be lysed by a simple thermal shc.ck at 100°C, it was not possible to determine whether the presence o f Chelex had a real ~ytic effect on cellular structures. Postulating that the chelating ion exchange resin would help in disrupting cellular external struetur~.s at high temperature, we have adapted this method to microorganisms from which DNA could not be efficiently extracted by a sire-

Submitted May 15. 1992, accepted August 7. 1992. (*) Corrcsponcling author.

pie thermal shock : Gram-positive bacteria (including Corynebacterium) and acid-fast bacteria. The quantity of extracted DNA and its ability to be amplified by PCR were studied as functions of the Chelex concentration in the lysis solution. "Fragile" Gram-negative bacteria, easily lysed by thermal shock, were studied in the sa~me manner. The results presented below enabled us to propose a one-step method making it possible to obtain a DNA solution suitable for PCR from bacterial pellets or pathological products. This method could be an alternative to alkaline or enzymatic bacterial lysis followed by phenolchloroform extraction and ethanol precipitation of nucleic acids. The lysis protocol was also extended to the DNA ~xtraction for PCR of HIV-infeeted ceils. The efficiency of the Chelex treatment for the recovery of human cytomegalovirus DNA from viral cuitures or clinical sa~p!es waz ~-w,,tea elsewhere (Zandotti et aL, 1992).

X. DE L A M B A L L E R I E El" AL.

786

MATERIALS AND METHODS "Chelex 100" D N A extraction from bacteria

Centrifugation pellets from cultured bacteria suspensions were carefully mixed with a 5-voiumc suspend;on of Chelex-100 and incubated for 30 rain at 100°C. The suspensions used were 5, 10, 15, 20 and 40 % w/w Chelex-100 sodium form (100-200 mesh) in water or in a 0. 1 % w/v sodium dodecyl sulphate (SDS), I 070 v/v Nonidet-P40 (NP40), 1 % v/v Tween-20 (T20) aqueous solution. After centrifusation (5 mix, 14,500 g) the supernatants were collected and studied by spectrophotometry and PCR. The volume of recove.red solution was noted. These DNA solutions were adjusted to a final concemration of 10 mM Tris-HCI and 1 mM EDTA with a 20-fold concentrated solution of TE buffer (200 mM Tris-I--!CI, 20 mM EDTA, pH 8.4). As the Chelex treatment results in complete denaturation of DNA, the solutions were incubated for at least 2 h at room temperatLre to ensure a complete renaturation of the DNA. The concentration in DNA was given by spectrometric mesurement at 260 nm and the quantity of extracted DNA was calculated. DNA purity was estimated through the A2~0/Azs0 absorbanc¢ ratio. PCR we~'e performed for Mycobacterium, Streptococcus agalactiae and Legia~ella pneumophila as described below. Microwave-oven DNA extraction from bacteria

Briefly, bacterial pellets from cultured bacteria P:.spension~ ".,~.reresu~pendcd in 10 ~tl TE and 56 10 % SDS and incubated for 30 min at 65°C. After centrifugation, the pellet was submitted to microwave lysis (3 x I rain, 750 W) (Bollet et al. 1991). After phenol-chloroform extraction and ethe no] precipitalion, the DNA samples were dissolved i~ 1 × TE solution. The DNA conccmrafioa and quality were estimed by spectrophotometry. For a given bacterial suspension, the efficiency of each method w ~ compared through the comparative )ieid = quantity of Chelex extracted DNA/quantity of microwave-oven-extracted DNA. In this study, acid-fast or Gram-positive tested bacteria were: Mycobacterium tuberculosis, M.

NP~

= ethylenediamine tettaacetic acid. = huraa~ irnmunodefic~encyvirus. = Nunidet-P40,

PCR 595

=

EDTA HIV

polymera~e chain reacllon, sodium dodeeyl sulphate.

avium, Corynebat terium xerosis and Streptoeoccua agalactiae. Gram-negative tested bacteria were: Pseudomohas aeruginosa, Es :herichia cell and Legionella pneumophila. D N A extraction from clinical samples

A total o f 150 =-linical samples were searched for mycobacteria by I)CR. The centrifugation pellets of dithiothreitol-flui4ified sputa were submitted to either an alkaline lysis method (NaOH 0,1 M, SDS 0.5 %, 20 rain at 95°C) (Brisson-No~l et aL, 1989) followed by phenol-chloroform extraction and DNA precipitation, c.r to DNA extraction with 15 ~'0 Chelex-100 suspension in 0 . 1 % w/~ SDS, 1 % v/v NP46, 1 W0 v/~ T20, for 30 min at I00°C. The same lysis protocol was used in the treatment of clinical samples or viral cultures for the PCR of HIV. We used mononuclear-enriched blood fractions {20 samples) or infected lymphocyte co-cultures (20 samples). This protocol was compared with lysis by proteinase K (0.5 mg/ml: I h at 55°C in the presence of 0.l 070 w/v SDS, 0.5 % v/v NP40 and 0.5 ~7ov/v T20) followed by phenol-chloroform extraction and ethanol precipitation of L)NA. P e R procedures

All amplification reactions were performed in a total volume of 50 ~1, with a DNA tEermal cycler (TR 1, Cera-Labo, Aubervilliers, France). Five F1 of DNA solution were added to 45 ~.1 of the reaction mix. F~nal concentrations were: 200 0tM for each deoxyadenosine triphosphate, deoxythymidine triphosphate, dcoxyguanosine triphosphate, deoxycytosine triphosphat¢; 3 ptM for each primer; 10 mM Tris-HCI; 50 mM KC1; 2 mM MgCI2; 0.001% w/v gelatin; 2 0 U / m l Taq polymerase (AmpliTaq, Pcrkin-Elmer Cetus Corp., Norwalk, CT). For Mycobacterium, amplifications were performed with two sets of primers located in the gene of the 65-kDa antigen as previously described (Bollet et al., 1992). For S. agalaetiae, a 565-bp fragment of th~ transposon IS861 (Rubens et aL, 1989) was amplified (fig. 3) using primers SAGA l and SAGA2 (~;AGA1 :

T20 = Tween~20. Taq polymerase = Thermusaquaticus DNA polymerase. TE = Tris-EDTAbuffer. UV - ultraviolet,

A ONE-STEP MICROBIAL DNA EXTRACTION METHOD

5'GGGACGAAGCCTTACAGAGC3'; SAGA2: 5'CCCGAAAAGGACGCCGAAGTY). Cycling parameters were as follows : initial denaturation at 90°C for 10 min ; 35 cycles (95°C for 20 s, 60~C for 30 s, 75°C for 30 s); final extension step at 75°C for 10 rain. For L, pneumophila, a 700-bp fragment was amplified using primers LEGi and LEG2 (Starnbach et al,, 1989). For HIV, DNA samples were submitted to PCR with the primer pair SK38 and SK39 according to Ou et at. (1988). All amplified DNA were run on agarose gels in TAE buffer (40 mM Tris acetate, 1 mM EDTA, pH 8), stained by ethidium bromide, and visltalized with a UV transilluminator.

787

not inhibit the Taq polymerase when diluted 10 times in the PCR buffer due to the presence o f NP40 and T20 (Gelfand and White, 1990). The best results were obtained with concentrations of Chelex between 10 ~0 and 20 % depending on the different bacteria: using a 0 . 1 %

1.2

1.0

>.

O,O'

o

?.

0.~1'

RESULTS 0,4

From Gram-pofitive and acid-fast cultured bacteria, the amount of extracted DNA increased with the Chelex-100 concentrations of the suspension up to a maximal value. Beyond this limit, the quantity of D N A that could be recovered decreased (fig. 1). The D N A concentration o f the supernatant remained simi -lm', but the volume o f the resin centrifugation pellet increased as well as the volume of DNA solution retained into this pel!et.

0

For a given concentration of Chelex-100, extraction efficiency was increased by approximately 25 % in the presence of 0.l °7o w/v SDS, 1 070 NP40 and 1 % "I'20 (table I). Such a solution was more lyric because of the SDS, but did

Fig. !. Extraction efficiency o f Chele,~-100 treatment for acid-fast and Gram-positive bacteria.

0.9

IL)

•,

O

....

10

-

,

r

20

30

40

% Chelex-lO0

Nyeob~rterium a v i u m Corynebacrerlum xerosis StFCplOCOCCU$ asalac~iae

Comparati~x yield=Cheicx 109 extructe~ D N A / m i c r ~ ' a v c - ~ v e n cxz, a c ~ d ~ N A ; ~e Chele×-lO0 is % Chelex in a 0 . 1 % w/v SDS, 1 % v/v T20 and 1 % v/v NP40 aqueous solution.

Table I. Effect of SDS, T20 and NP40 on comparative yield durin8 Chelex-100 extraction. % Chetex-I00 l0 15

0

5

M . tuberct~losis M . avium

0 . 1 5 ; 0.15 u.55; 0.40

0 . 2 0 ; 0.15 0 . 9 5 ; 0.75

0.55; 0.40 1.15; 0.95

C. S. E. P, L.

0.05; 0.30; 0.70; i.10; 0.90;

0.20; 0.40; 0,75; 1.10; 1.00;

0.35; 0.65; 0.75; 0.95; 0.95;

xerosis agalactiae colt aeruginosa pneumopnilu

0.05 0.25 0.75 1.10 0.95

0.10 0.35 0.75 1.00 1.00

0.25 0.50 0.70 1.00 0.95

20

40

0 . 5 5 ; 0.40 1.05; 0.95

0 . 3 5 ; 0.25 0 . 8 5 ; 0.65

0 . 2 0 ; 0.15 0.60; 0.40

0.65; 0.65; 0.60; 0.95; 0.85;

0.65; 0.70; 065; 0.70; 0.85;

0.50; 0.55; 0.55; 0.60; 0.65;

0.50 0.55 0.65 0.85 0.85

0.45 0.60 0.70 0.75 0.80

0.40 0.40 0.50 0.60 0.70

Comparati~ yield = Ch¢lcr.-100 extracted DNA/microwave-ovewexteaered DNA. First value is coutp-,rative yield ushlg Chelex-100 in a O.1% w/v SD$, 1 % v/v T20 and 1 % ~./v hiP40 aqueous solution. Second value [.~compara~.iveyield using Chelex-ICOin distilled water.

788

X. DE LAMBALLERIE ET AL.

w/v SDS, 1 % NP40 and 1 % T20 solution, the optimal concentrations o f Chetex were I0 % for M. avium, 20 % for 8. agulactiae, 10-15 % for M. tuberculosis and 10-20 % for C. xerosis (fig. 1).

1.11

.~

I.D

i

It was noted that M. tuberculosis strains whose culture colonies are difficult to dissociate gave the poorest results with Chelex-100 under the conditions described (fig. 1). The A2~/A2~ 0 spectrometric ratio was above 2 for each bacteria at its best Chelex-100 concentration. Extraction by heating in distilled waler or ~t 0 . 1 % w/v SDS, 1 070 NP40 and 1 07o T20 solution alone provided low but measurable amounts of DNA. However, the A260/Az80 ratio o f these solutions was below 2 and they were often inactive in PCR, as previously reported (Walsh et aL, 1991). In the present study, this never occurred either with microwave-oven-extracted DNA or with Chelex-extracted DNA, even at a low concentration of the resin. Moreover, we were able to verify that the Chelex-extracted D N A was still suitable for P C R after a 200-min lysis at 16t3°C. The amount of Chelex-extracted DNA (utilizing the optimal resin concentration) was 55 to 115 % o f the amount extracted by microwave oven lysis, depending on the bacteria (fig. l). From Gram-negative cultured bacteria, Ci,elex did not increase the amount of extracted D N A (fig. 2). These bacteria are "fragile" and the simple heating in boiling water effidently extracted the bacterial DNA. As the Chelex concentration increased, the >Seld of recovered DNA decreased as a function of the volume of the supernatant that could bc collected, while the DNA concentration of the supernatant remained unchanged. No significant improvement was noted when SDS, NP40 and T20 were added (table I). The amount of extracted D N A in water was 75 to 119 % of the amount extracted by microwave oven tysis, depending on the bacteria ~fig. 2). However, the DNA extracted in distilled water alone or in a 0 . 1 % w / v SDS, 1 % v / v NP40, t % v / v T20 solution gave irregular

0.6

0q4

'

2'0

,,

g6 (:helex- 100

~'scherickda -

Pseudomonas

Leglo.ella

cold aeruglnisa pneumophlla

Fig. 2. Extraction efficiency of Chelex-[00 treatment for Gram-negative bacteria. Comparative yield=Chelex-t00-extraeted D N A / microwave-oven-extracted DNA, % Chelex-100 is % Chelex in distilled water.

results when submitted to P C R . The best amplifications were obtained by boiling for 30 rain in a 5 °70 Chelex-100 suspension in water or after microwave oven extraction. Among the 150 dithiothreitol-fluidified sputa tested, 24 samples were positive with the two extraction methods tested, giving 11 positive cultures for Mycobacterium. One was positive only with the classic method, and 5 only after Chelex lysis. Three of these 5 specimens led to a positive culture for Mycobacterium. The results of P C R were identical with the two extraction methods tested when the searched for H I V in lymphocyte co-cultures. On the other hand, results were discordant for 2 mononuclcar-enriched blood fractious: they were positive after Chelex extraction and negative after enzymatic treatment. These 2 samples gave positive viral cultures. In this study, no negative control (lambda phage D N A solutions treated by Chelex-100) gave a false-positive result with any amplification system that was tested.

A ONE-STEP M I C R O B I A L D N A E X T R A C T I O N M E T H O D

789

sis as well as loss o f DNA in the resin centrifu-

234

gation pellet. For a given concentration of Chelex, a higher extraction efficiency was obtained in the presence o f 0. 1 % w / v SDS, ! % v / v NP40 and 1 070 v/v T20,

I

=

/

I

653 bp 565 bp

II it

517 bp

I

I

Fig. 3. PCR amplification of S. agalactiae DNA. 1 -negative control; 2 -565-bp fragment after amplification of Chele×-100-extracted DNA from S. agalactiae; 3= 565-bp fragment after amplification of microwaveoven-extracted DNA from 5;. agalactiae; 4 = pBR328 DNA cut by Bgll and HinfI.

DISCUSSION

For Gram-positive and acid-fast cultured bacteria, the efficiency of D N A extraction with Chelex-100 increased with the cationic chelating capacity o f the suspension used. Since the oH of the various Chelex suspensions was very similar (8,25_+0.25 at 25°C), this effect could not be explained by p H variations. It was shown that the optimal concentration o f Chelex to be used should be determined regarding bacterial susceptibility to Chelex ly-

For Gram-negative cultured bacteria, Chelex did not increase the amount of extracted DNA, but the use of low concentrations of Chelex was fo:md to be of interest, since D N A extracted in aqaeous solutions alone gave poor results in PCR. In that case, Chelex was of use, not in promoting DNA extraction, but to protect the extracted DNA from degradation at high temperature. This situation is very similar to that o f extraction of DNA from human cells as described by Walsh et al. In that way, the protoeols used were identical (5 % Chelex in water at 100°C). These results demonstrated that CheIex-100 improves the lysis of Gram-positive and acid-fast bacteria at 100°C. The use of Chelex improved the P C R results compared to water alone for both Gram-positive, acid-fast and Gramnegative bacteria. This result is apparently due to the protective effect o f Chelex at high temperature. We consequently propose the use of low concentrations (approximately 5 °70) of Chelex-100 in water for DNA preparation from Gramnegative bacteria for use with the PCR. Acidfast and Gram-positive bacteria should be lysated by 10 to 20 % Chelex-100 suspensions in a 0.1 070 w/v SDS, 1 °70 v/v NP40 and l 07o v / v T20 aqueous solution. The study of 150 specimens for the PCR o f M y c o b a c t e r i u m showed that the Chefex treat-

ment could be of great interest for the treatment o f clinical samples. The protocol that was used enabled detection of more positive samples (5) than alkaline lysis followed by classic extraction o f DNA. Three of these 5 samples gave positive cultures for Mycoh~,rierium. As no lack of DNA was noted after classic t ~eatment of samples, we a s s , m e that the presence of polymerase inhibitors led to false-negativ(: PCR results in the alkaline lysis methad. Thi~ -~ems to confirm that the Chelex preparation of the samples leads to fewer

X. DE LAM£IALLERIE E T AL.

790

p r o b l e m s o f p o l y m e r a s e inhibitors t h a n with t r a d i t i o n a l m e t h o d s ( Z a n d o t t i et at., 1992). T h e study o f viral cultures and clinical samples for the P C R o f H I V led to similar conclusions. Results o b t a i n e d in P e R after Chelex a n d classic extraction were the same for viral cultures. T w o clinical samples were positive only after Chelex t r e a t m e n t . As these samples gave positive cultures, we s u p p o s e d that the presence o f a polymerase inhibitor caused a false-negative P C R result in the proteinase K lysis a s s a y . b~ conclusion, Chelex-100 efficiently lysed m i c r o o r g a n i s m s that were tested u n d e r the described cortditions, and yielded D N A that was a m p l i f i a b l e for a variety o f bacteria, Chelex led to m o r e successful amplification than with traditional D N A e x t r a c t i o n m e t h o d s , p a r t i c u l a r l y in the t r e a t m e n t o f clinical samples. This c o u l d be explained by p r o t e c t i o n o f D N A by Che!ex-100 at high t e m p e r a t u r e a n d b y the i n a c t i v a t i o n o f polymerase inhibitors during Chelex-100 protocol.

Chelex-100 lysis would seem to be a very simple, fast a n d low-cost m e t h o d for p r e p a r a t i o n o f a D N A solution for P e R f r o m cultures a n d clinical samples c o n t a i n i n g b a c t e r i a a n d s o m e viruses, It is routinely e m p l o y e d a n d a v o i d s t h e use of hazardous reagents such as phenol, as well as c o m p l i c a t e d m a n i p u l a t i o n s such as e t h a n o l p r e c i p i t a t i o n o f very small quantities o f D N A .

Acknowledgements

We thank Vital Galicher and Catherine lvars for their technical assistance.

Methode d'extraction des A D N pour la PCR en une ~tape par le a C h d e x 100>) en mierobiologie

Des protocoles pour I'e×traction rapide par le < de I'ADN de cellules humaines en rue de r~aliser une amplification g~nique ayant &~ d&rits

reeemment, nous avons cherch6 ~tsavoir si cette r(}sine chdatrice possddait une action tytique sur les structures cellulaires externes a haute temp6rature, et le present travail nous a permis de proposer des protocoles pour la preparation rapide de so[,,itions d ' A D N pour la PCg, en microbiologie. Ces ADN peuvent provenir dc cultures bactdriennes ou vJrales, ou d'~chantillons cliniqucs infeet~s. Mots-clds: P e R , ADN; Extraction, R6sine eh¢latrice, Batteries.

References

Bollet, C., G~vaudan, M.J., de Lamballerie, X., Zandotti, C. & De Mieco, P. (1991), A simple method for the isolation of chromosomal DNA from Gram-positive or acid-fast bacteria. Nucl. Acids Res., 19, 1955. Bollet, C., de Lamballerie, X., Zandotti, C., Vignoli, C., G6vaudan, M.J. & De Micco, P. (1992), Detection and identification of Mycobucterium tuberculosis, M. bovis/BCG and M. aviura by two.step polymerase chain reaction. Comparison with ELISA using A60 antigen. Mkrobiologica (in press). Brisson-No~l, A., Gicquei, B., Leeossier, B., L6vyFr~bault, V., Nassif, X. & Hance, A.J. (1989), Rapid diagnosis of tuberculosis by amplification of mycobacterial DNA in clinical samples. Lancet, 4, 1069. Gelfand, D.H. & White, T.J. (1990), ThermostabIe DNA polymerases, in "PER protocols {a guide to methods and applications)" (M.A. lnnis, D.H. Gelfand, J.J. Sninsky & T.J. White) (pp. 129-141). Academic Press, London, New York. Ou, C.Y., Kwok, S., Mitchell, S.W., Mack, D.H., Sninsky, J.J., Krebs, J.W., Feorino, P., Warfield, D. & Schotetman, G. (198g), DNA amplification for direct detection of HIV-I in DNA of peripheral blood mononuclcar cells. Science, 238, 295-297. Rubens, C.E., Heggen, L.M. & Kuypers (1989), IS86L a group B streptococcal insertion sequence related to 1SISO and IS3 of Escherichia colt. J. Bact., 17i, 5531-5535. Starnbach, M., Falkow, S. & Tompkins, L.S. (1989), Species specific detection of Legionella pneumophila in water by DNA amplification and hybridization. J. Clin. Microbiol., 25, t257-1261. Walsh, P.S., Metzger, D.A. & Higuchi, R. (1991), Chelex 100 as a medium for simple extraction of DNA for PeR-based typing from forensic material. Biotechniques, 10, 506-513. Zandotti, C., de Lamballerie, X., Guignolte-Vignnli, C., Bollet, C. & De Mieco, P, (1992), A rapid DNA extraction method from culture and clinical samples. Applicatiun to the detection of human cytomegalovirus by polymerase chain reaction. Acfa ViroL (in press).