- Email: [email protected]
A one-step quantitative reverse transcription polymerase chain reaction procedure
Brain Research Protocols 6 (2001) 100–107 www.elsevier.com / locate / bres
Protocol
A one-step quantitative reverse transcription polymerase chain reaction procedure a, a a b Kim L Kelleher *, Kwong-Joo Leck , Ian A Hendry , Klaus I Matthaei b
a Division of Neuroscience, John Curtin School of Medical Research, Australian National University, Canberra ACT 2601, Australia Division of Biochemistry and Molecular Biology, John Curtin School of Medical Research, Australian National University, Canberra ACT 2601, Australia
Accepted 1 September 2000
Abstract Our laboratory has developed a one-step quantitative reverse transcription polymerase chain reaction (RT-PCR) procedure in which the reverse transcriptase enzyme and Taq DNA polymerase are combined in the one tube and a single, non-interrupted, thermal cycling program is performed. In the past, RT-PCR has been carried out with two separate steps: (1) reverse transcription of RNA to generate a cDNA pool and (2) polymerase chain reaction amplification of the cDNA. The two-step method can affect the accuracy of the procedure as the total number of manipulations is greater, thereby allowing a greater chance for pipetting errors. Quantitation by our method is achieved in a single reaction by the use of a competitive internal standard that is identical in sequence to the target RNA except for a deletion of 107 base pairs and uses identical primers and cycling conditions. Using this method, we have been able to quantify the amount of message of a G protein (G za ), in small amounts of tissue, such as dorsal root ganglia, from embryonic as well as postnatal mice. 2001 Elsevier Science B.V. All rights reserved. Theme: Cellular and molecular biology Topic: Gene structure and function: general Keywords: Quantitative RT-PCR; Competitive internal standard; Mouse; Nervous system; G proteins; mRNA developmental expression
1. Type of research Measurement of G za mRNA levels in a variety of mouse peripheral and central nervous system tissues over a range of embryonic and postnatal ages [6].
2. Time required Generation of cDNA internal standard: approximately 1 week due to designing primers, performing PCR, inserting into plasmid, digesting with restriction enzymes. Synthesis of RNA internal standard: 3 h RNA extraction: depends on how many animals and how many tissues samples there are to be processed, but, *Corresponding author. Tel.: 161-2-6279-8463; fax: 161-2-62492687. E-mail address: [email protected] (K.L Kelleher).
in general, a minimum of 6 h is required (longer if the isopropanol precipitation step is left overnight). RT-PCR: 1–2 h to set up dilutions, make reaction mix and fill capillary tubes. 2–3 h for reverse transcription and polymerase chain reaction cycling to take place. 1–1.5 h for agarose-gel preparation and gel electrophoresis 20 min for ethidium bromide staining and photography
3. Materials
3.1. Animals BALB / c mice were obtained from the specific pathogen-free facility at The John Curtin School of Medical Research at the Australian National University. The postnatal developmental ages that were examined for G za
1385-299X / 01 / $ – see front matter 2001 Elsevier Science B.V. All rights reserved. PII: S1385-299X( 00 )00042-8
K.L Kelleher et al. / Brain Research Protocols 6 (2001) 100 – 107
mRNA expression were birth, and postnatal days 7, 14, 21, 28 and 60. Embryos were also obtained from ether-anesthetized pregnant BALB / c mice at embryonic days 15, 16, 17, 18 and 19.
3.2. Equipment • Fast capillary thermal cycler (Corbett Research, Australia) • Tabletop centrifuge • UV spectrophotometer • Water bath • Gel electrophoresis equipment • storage space, 220 and 2708C • pipettes (Gilson pipetman P1000, P200, P20 and P2) • Agarose gel documentation system to record digital gel images after electrophoresis (Novaline or equivalent) • Image Quant software (Molecular Dynamics) • PC or Mac capable of running Image Quant software.
3.3. Chemicals and reagents • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •
aerosol-resistant pipette tips Agarose (type I) (ICN) Amplitaq DNA polymerase (Roche) Avian myeloblastosis virus reverse transcriptase (Promega) Alu I (NEB) Bromophenol Blue (Sigma) Bovine serum albumin (BSA) Chloroform–isoamyl alcohol (49:1, v / v) Deoxynucleotides (dTTP, dGTP, dATP, dCTP) (Promega) Diethylpyrocarbonate (DEPC) (Sigma) Dithiothreitol (Promega) EcoR I (NEB) EDTA Enzyme buffer (NEB2) (NEB) Eppendorf tubes (500 and 1500 ml) Ethanol (75%) Ethidium bromide (Sigma) Ficoll 400 (Pharmacia) Glacial acetic acid Isopropanol KKF (forward G za primer) KKR (reverse G za primer) Magnesium chloride Milli-Q H 2 O (Millipore) PCR capillary tubes (Bresatec) Potassium chloride pTZ19U DNA (Bio-Rad) RNAzol B (Bresatec) Sarcosyl (Sigma) Supertaq (Stehelin and Cie) Transfer RNA (Boehringer)
101
• Tris base (Sigma) • Triton X-100 • Xylene cyanol (Sigma)
4. Detailed procedure
4.1. Extraction of total mouse RNA (i) BALB / c mice of mixed sex at varying ages are anaesthetized with ether. (ii) Dissect out appropriate tissues, weigh and place into an homogenizer containing cold RNAzol B (2 ml / 100 mg tissue). In the case of ganglia for which an accurate weight cannot be determined, add 200 ml of RNAzol B. (iii) Homogenize the tissue samples on ice. Transfer the homogenate to a fresh eppendorf tube and leave on ice for 10–20 min. (iv) Add chloroform (1:10 of chloroform to homogenate), shake the sample vigorously (do not vortex-mix) and leave on ice for another 15 min. (v) Centrifuge the sample at 12 000 g at 48C for 20 min. Remove upper aqueous phase containing the RNA, being sure not to touch the interphase. (vi) Add an equal volume of isopropanol, invert to mix and store the samples at 48C for 15 min (freezing samples at 2208C overnight can give a better yield of RNA, especially when isolating RNA from a small amount of tissue). (vii) Recentrifuge the sample at 12 000 g at 48C for 20 min to precipitate the RNA. Decant the isopropanol carefully and air dry the pellet for approximately 15 min. (viii) Wash the RNA precipitate with 75% ethanol. Invert to mix a couple of times and centrifuge at 12 000 g at 48C for 8–10 min. Decant ethanol carefully and air dry the pellet for 15 min. (ix) Resuspend the RNA pellet in DEPC-treated water (*) and heat to 608C for 10 min. RNA should be stored at 2708C. Spectrophotometric measurements are made at 260, 280 and 320 nm, to determine the concentration and purity of the RNA. * Milli-Q water that had been treated with 0.1% DEPC at 378C overnight, then autoclaved for 15 min at 1348C [7].
4.2. Generation of cDNA internal standard The primers (4BF and 3R) used for the generation of the internal standard were predicted from the conserved regions of human and rat G za cDNA sequences, since these were the areas where the mouse G za cDNA sequence was most likely to be conserved (Table 1). At the same time, the primers were designed to show the greatest differences with other known mouse G protein a-subunit sequences, in order to avoid amplification of other G protein a-subunit mRNA (Table 2). The intron that exists in the human G za genomic DNA is located at position 723. This intron also
102
K.L Kelleher et al. / Brain Research Protocols 6 (2001) 100 – 107
Table 1 Oligonucleotide sequences of primers used to generate the competitive internal standard a 4BF 364 Human G Za cDNA Rat G Za cDNA
384
]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] 59 CCC GAG CTG CTG GGT GTC ATG 39 CCC GAG CTG CTG GGT GTC ATG
3R 1059 1036 ]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] 59 GCC AAT GTA CTT GAG ATT GTT CTG 39 GCC AAT GTA CTT GAG ATT GTT CTG
a
4BF (forward primer) and 3R (reverse primer) were designed to conserved regions of the human and rat G Za cDNA sequence that were most likely to be conserved. The numbers refer to the nucleotide position in the corresponding cDNA.
exists within the mouse genomic coding sequence and is located between each forward and reverse primer [9]. Amplifications of DNA contaminants during mRNA quantitation can thus be avoided since the amplification of the intron in the genomic sequence will result in a much larger PCR fragment. This was also confirmed by the lack of the formation of a product when reverse transcriptase was left out of the reaction, since the extension time (|20 base pairs per second) was too short to allow the amplification of the predicted genomic fragment. A partial mouse cDNA sequence was obtained by RTPCR from mouse cerebellum total RNA (see Section 4.1 for RNA extraction procedure) as follows: (i) Each 20 ml reaction mixture contained mouse cerebellum total RNA, 200 mM of each dNTP, RT-PCR buffer [67 mM Tris–HCl (pH 8.3), 0.5 mM dithiothreitol, 50 mM KCl, 0.1% Triton X-100, 6 mM EDTA and 2 mM MgCl 2 ], 2 units of Amplitaq DNA polymerase, 0.5 units of AMV-RT, 5 pmol of forward primer (4BF), 5 pmol of reverse primer (3R) and 2 mg of yeast tRNA. (ii) The RT-PCR procedure is then carried out on a fast capillary thermal cycler (Corbett Research) employing the following cycling conditions. Cycle 1, reverse transcriptase (428C, 59 min); cycle 2, DNA denaturation and AMV-RT inactivation (948C, 5 min), primer annealing (658C, 15 s), primer extension (728C, 90 s); cycles 3–7, DNA denaturation (948C, 15 s), primer annealing (658C, 15 s), primer extension (728C, 90 s); cycles 8–35, DNA denaturation (948C, 5 s), primer annealing (658C, 5 s), primer extension (728C, 90 s); cycle 36, DNA denaturation (948C, 5 s), primer annealing (658C, 5 s), primer extension (728C, 7 min), enzyme inactivation (998C, 10 min), cooling (258C, 5 min). The times given are ‘in tube’ times that reflect the actual times present in the reaction mixture. (iii) Agarose gels (1.5%) were prepared by dissolving
agarose in TAE electrophoresis buffer (40 mM Tris– acetate, 2 mM EDTA, pH 8.0). (iv) Add a 0.25 volume of 53 loading dye [50 mM Tris–HCl, pH 8.0, 100 mM EDTA, 1% (w / v) sarcosyl, 7.5% (w / v) Ficoll 400, 0.05% bromophenol blue and 0.05% xylene cyanol] to PCR products and place in 658C water bath for 5 min. Electrophoresis is carried out in a Bio-Rad wide mini-sub electrophoretic tank with TAE as the electrophoretic buffer. (v) Stain the agarose gel with ethidium bromide (0.5 mg / ml) for 15–20 min. (vi) The stained gel is viewed and photographed under ultraviolet light. The gel bands of the predicted size are excised using a sterile scalpel blade. (vii) The RT-PCR product was purified from the excised gel band using a PCR product purification kit (Boehringer Mannheim), and cloned into the phosphatased Sma I site in the multiple cloning site of pTZ19U (Bio-Rad). (viii) Plasmid DNA was prepared from transformed bacteria colonies and sequenced using the cycle sequencing kit from Applied Biosystems. Twenty-six clones were isolated, of which, eight were chosen at random and sequenced. All eight clones contained the full length mouse G za sequence and they were found to exhibit considerable homology to one another and to the human and rat G za cDNA in the region flanked by the primers. They differed from each other by only one or two base pairs. (ix) One of these clones containing the consensus sequence for the mouse G za cDNA was used for the generation of the cDNA internal standard. This was done by digesting the plasmid DNA with the restriction enzymes Stu I and Eco RV, which excise a 107-base-pair fragment from within the cloned G za cDNA, and then religating the plasmid.
Table 2 Comparison of 4BF and 3R primer sequences with other G protein subunits in the same region a Primer sequences Mouse G ia Mouse G oa A Mouse G oa B Mouse G ta Mouse G Sa a
364
CCCGAGCTGCTGGGTGTCATG 384 GAAGACCTGTCCGGTGTCATC 384 364 GCAGAACTTCTTTCTGCCATG 384 364 GCAGAACTTCTTTCTGCCATG 384 348 AAGGAGATGTCAGACATCATT 368 379 CCTGAATTCTATGAGCATGCC 399 364
1059
GCCAATGTACTTGAGATTGTTCTG 1036 GCCACAGTCCTTCAGGTTGTTCTT 1036 1056 GCCGCAGCCCCGGAGATTGTTGGC 1033 1056 TCCACAGCCCCGTAGGTTTTTGGC 1033 1043 CCCGCAGTCTTTGAGGTTCTCCTT 1020 1125 CTCGTATTGGCGGAGATGCATGCG 1102 1059
The primers were constructed to regions that were known to show differences at the same sites to other G protein a subunits, to avoid amplifications of the mRNAs of these other G protein a-subunits in the mouse tissue. Genbank accession codes for the other G proteins are M13963 for G ia , M13964 for Gs a , M36777 for G oa A, M36778 for G oa B and M25509 for G ta . The numbers refer to the nucleotide position in the corresponding cDNA.
K.L Kelleher et al. / Brain Research Protocols 6 (2001) 100 – 107
(x) The religated plasmid was again transformed, and plasmid DNA containing the G za internal standard was prepared.
4.3. Synthesis of RNA internal standard (i) Plasmid DNA containing the internal standard was linearised by restriction digestion downstream of the insert using EcoR I (40 units), and purified by ethanol precipitation after heat denaturation of the enzyme. (ii) The RNA competitive template was synthesized by in vitro transcription of the linearised plasmid, which contained a T7 RNA polymerase promoter upstream of the cDNA competitive template insert. Transcription was performed at 378C for 2 h in 100 ml of transcription buffer (final concentration: 40 mM Tris–HCl, pH 7.5, 6 mM MgCl 2 , 2 mM spermidine, 10 mM NaCl, 10 mM DTT, 0.5 mM dNTPs) using 2 mg of linearised plasmid with 40 units of T7 RNA polymerase (Promega) and 100 units of RNAase inhibitor (Bresatec). (iii) After transcription, the plasmid DNA template was degraded using 5 units of RQ1 RNAase-free DNAase (Promega) by incubating the transcription mixture for a further 15 min at 378C. (iv) The synthesized RNA was ethanol-precipitated, airdried and redissolved in DEPC water, and spectrophotometric measurements were made at 260 and 280 nm, to determine the concentration and purity of the RNA.
4.4. Reverse transcription-polymerase chain reaction ( RT-PCR) The partial mouse G za cDNA sequence had been obtained from cloned PCR products. The exact mouse sequence at the primer regions was, therefore, not known. Since the PCR product contained the synthetic predicted sequences, it was, therefore, possible that these primers may anneal better to the mimic than to the mouse G za cDNA, since the mimic sequence at these positions may not be identical to the mouse sequence. New primers
103
complementary to the mouse G za sequence, which could be expected to anneal specifically and with equal probability to both the target and mimic RNA, were synthesized. Blast alignment was also performed on the sequences of the new primers to be used for the RT-PCR procedure to ensure they were constructed to regions of G za that show maximal difference to other G protein a-subunit sequences, in order to avoid their amplification (Table 3). The primers were specifically chosen to have different annealing temperatures to other G protein a-subunit sequences so as to preferentially amplify G za . Moreover, in a number of cases, our primers have no homology to other G protein a-subunit sequences at the 39 end of the primer (Table 3), thereby preventing any amplification of these other genes. In addition, the specificity of our primers was verified during the cloning process where all eight randomly chosen clones contained full length mouse G z sequences that only varied by single base differences and no other G protein sequences were seen. We are confident therefore that our primers are specific for G za . A one-step RT-PCR was performed where both the reverse transcriptase enzyme and Taq DNA polymerase were combined in the same tube. The RT-PCR buffer contained 67 mM Tris– HCl (pH 8.3), 0.5 mM dithiothreitol, 50 mM KCl, 0.1% Triton X-100, 6 mM EDTA and 2.5 mM MgCl 2 [10]. Yeast transfer RNA (tRNA) was added to the DEPC-treated water (0.3 mg / ml) that was used to dilute the stock solution of mimic RNA. (i) Pipette 3 ml of mimic RNA into an appropriate number of tubes. The concentration of mimic RNA to be used needs to be determined depending on the range of target RNA dilutions expected. (ii) Add 3 ml of target RNA to a tube containing 3 ml of mimic RNA and mix well. (iii) From this, remove 3 ml and add to another tube containing a further 3 ml of mimic RNA. Repeat this process to perform a series of dilutions of target RNA in mimic RNA. We initially performed tenfold dilutions to determine approximately at what concentration the point of equilibrium between target RNA and mimic RNA is reached. A further twofold range of dilutions was then
Table 3 Comparison of oligonucleotide sequences of primers used for RT-PCR with other G protein a-subunits a
Mouse G za Mouse G ia Mouse G sa Mouse G qa Mouse G oa A Mouse G oa B Mouse G 12a Mouse G ta a
KKF
KKR
59 TGGGTGTCATGCGACGGCTCTG 39 CCGGTGTCATCCGGAGGCTCTG TATGAGTCATGCCAAGGCTCTG TAGATGCAATAAAGAGCTTGTG TTTCTGCCATGATGCGACTCTG TTTCTGCCATGATGCGACTCTG TACGTGCCAGCCCTGAGTGCCC TGGACGTCATCAGGAAGTTGTG
39 AACATCCAGTTTGTGTTTGACGCAG 59 AACGTGCAGTTTGTGTTCGATGCCG AACATCCGCCGTGTCTTCAACGACT AACATCCGCTTCGTCTTTGCAGCCG AATATCCAGGTGGTATTCGACGCCG AACATCCAATTCGTCTTTTGATGCCG AACATCCGCTTCGTGTTTCATGCTG AACGTCAAATTCGTGTTCGATGCAG
KKF (forward primer) and KKR (reverse primer) were the primers used in the RT-PCR study. They were constructed to regions that were known to show differences at the same sites to other G protein a subunits, to avoid amplifications of the mRNAs of the G protein a subunits in the mouse tissue. Genbank accession codes for the other G proteins are M13963 for G ia , M13964 for Gs a , M36777 for G oa A, M36778 for G oa B and M25509 for G ta . The numbers refer to the nucleotide position in the corresponding cDNA.
104
K.L Kelleher et al. / Brain Research Protocols 6 (2001) 100 – 107
performed as above, spanning the approximate equivalent point in a second PCR reaction. (iv) Add 9 ml of reaction mix that contains RT-PCR buffer, 200 mM of each dTTP, dGTP, dCTP and dATP, 5 pmol of forward primer, 5 pmol of reverse primer, 0.6 U AMV-RT and 1 U Supertaq (1 unit of Boehringer Taq DNA polymerase is equally effective) and DEPC-treated water. (v) The RT-PCR procedure is then carried out on a fast capillary thermal cycler (Corbett Research) employing the following cycling conditions. Cycle 1: reverse transcription (428C, 59 min); cycle 2: DNA denaturation and AMV-RT inactivation (958C, 3 min); cycles 3–40: DNA denaturation (958C, 10 s), primer annealing (658C, 15 s), primer extension (728C, 35 s); cycle 41: final primer extension (728C, 3 min), cooling (258C, 5 min). NB. The times given are ‘in tube’ times that reflect the actual times present in the reaction mixture. (vi) Agarose gels (1.5%) were prepared by dissolving agarose in TAE electrophoresis buffer (40 mM Tris– acetate, 2 mM EDTA, pH 8.0). Add a 0.25 volume of loading dye to PCR products and place in 658C water bath for 5 min. Electrophoresis is carried out in a Bio-Rad wide mini-sub electrophoretic tank with TAE as the electrophoretic buffer. The plasmid pTZ19U DNA digested with Alu I is run in parallel with the samples to serve as a molecular-size marker. (vii) Stain the agarose gel with ethidium bromide (0.5 mg / ml) for 15–20 min. (viii) The stained gel is viewed and photographed under ultraviolet light and recorded with the Novaline Gel Documentation System.
5. Results
5.1. Quantitation of PCR products The intensity of the respective bands was measured using Image Quant software (Molecular Dynamics). The values obtained enabled the level of G za mRNA in the initial total RNA sample to be calculated. Fig. 1A shows the amplification of G za after 38 cycles of a sample containing twofold dilutions of mouse brain RNA (645 bp) and a constant concentration of mimic RNA (538 bp). Fig. 1B shows a graph of the log ratio of RNA to mimic RNA, plotted against the log amount of initial RNA. An RNA / mimic RNA ratio of one,where the RNA and mimic RNA bands are of equal intensity, corresponds to an RNA concentration of 2.1 ng / assay. By combining the concentration of the mimic RNA (156 fg / ml per assay), the size of the human G za RNA sequence (3957 bp) [8] and the size of the mimic RNA sequence (538 bp), we determined that the mimic RNA represents 1.143 fg of G za mRNA. Applying this value with the RNA concentration
Fig. 1. Quantitation of G za mRNA levels in the initial total RNA sample. (A) Amplification of twofold dilutions of mouse brain RNA (645 bp, top row of bands) and a constant concentration of mimic RNA (538 bp, bottom row of bands) (lanes 1–9). PTZ19U /Alu I (lane M) was run in parallel to serve as a molecular-weight marker (621 and 521 bp). (B) Graph of the log ratio of RNA-to-mimic RNA, plotted against the log amount of initial RNA. An RNA / mimic RNA ratio of one (approximately lane 5) corresponds to an RNA concentration of 2.1 ng / assay. It was calculated that the G za mRNA concentration was 0.55 fg / ng total RNA (see text for discussion).
at equivalence (2.1 ng), we calculated the G za mRNA concentration to be 0.55 fg / ng of total RNA.
5.2. Quantitative RT-PCR: optimal cycling conditions The mimic RNA must be transcribed to DNA at the same rate as the target RNA if it is going to be suitable to be used as a competitive internal standard. Constant amounts of brain RNA and mimic RNA were amplified for varying numbers of cycles. Results from aliquots taken at the end of every two cycles, from 26 to 40 cycles of amplification, showed that the amplification rates of samples from adult mouse brain RNA and mimic RNA were exponential between 28 and 38 cycles (Fig. 2). The log of the DNA concentration was plotted against the number of cycles. Both the total RNA and mimic RNA were transcribed to DNA at the same rate, confirming that the mimic RNA was suitable as a competitive internal standard. In all later experiments, the samples were examined at the end of
K.L Kelleher et al. / Brain Research Protocols 6 (2001) 100 – 107
Fig. 2. Linearity of RT-PCR with cycle time. Known and constant amounts of brain RNA and mimic RNA were amplified for varying numbers of cycles, ranging from 26 to 40. Amplification rates for RNA and mimic RNA were exponential between 28 and 38 cycles. DNA concentration was determined by applying a standard curve that was generated from dilutions of pTZ19U /Alu I separated by electrophoresis in an agarose gel.
the 38 th cycle, the peak of the amplification efficiency. It is recommended that similar optimization experiments be performed for each target RNA.
6. Discussion Determining the mRNA levels of specific genes allows an estimation of gene expression. Northern or dot blot analysis and RNA protection assays have been the major techniques used in the past to determine mRNA levels. These techniques are limited in their usefulness since they require large amounts of total RNA to estimate the concentration of a specific transcript [13]. To examine mRNA expression in embryonic tissues or neuroendocrine tissues where the tissue sample is very small, using these techniques is not very useful since it is necessary to pool tissues from several animals. This not only results in large numbers of animals being used but also necessitates experiments being repeated to allow statistical analysis of the data. Pooling of tissues to obtain enough RNA also means that mRNA levels cannot be determined in individual animals [13]. The development of the RT-PCR procedure has provided a technique that is more specific and sensitive than traditional methods of RNA analysis and has therefore become the method of choice for studying gene expression since it can be performed with far less total RNA. Thus, RT-PCR is extremely useful for the detection of rare transcripts as well as for measuring mRNA levels in individual nuclei or embryonic tissues [13]. However, there are several variables that can affect the efficiency of the RT reaction and PCR amplification, which must be addressed in order to obtain reliable,
105
reproducible data. The polymerase enzyme used, the MgCl 2 concentration in the buffer, the primer sequences and the number of amplification cycles are important variables that can be easily controlled during the PCR process. RT-PCR is an exponential reaction, however, since small variations in the efficiency at an early cycle number during amplification can lead to dramatic variations in the amount of PCR product generated [5]. Alterations in the efficiency of RT-PCR have also been attributed to tube-to-tube variation and / or variations in the temperature across the block of the cycler. In order to limit these variations, a variety of internal standards have been designed. Housekeeping genes, such as b-actin and cyclophilin, are examples of endogenous internal standards [1,2], but exogenous internal standards have been proven more useful in the quantitation of mRNA levels. Exogenous internal standards are synthetic RNA or DNA sequences that are not present in the target sample but are added directly to the RT or PCR reaction [4,12]. Exogenous internal standards generally possess a sequence that is highly homologous to the target RNA sequence (they are also known as mimic RNA), but a portion of sequence will be added or deleted and, therefore, they utilize and compete for the same set of primers, but produce a product of a different size [11]. The target sequence can thus be differentiated from the internal standard by sizing, using electrophoresis [3]. Using an internal standard that utilizes the same set of primers as the target RNA is, therefore, highly advantageous over other internal standards, since differences in the reverse transcription and the amplification efficiencies of the target RNA and mimic RNA are avoided. Since the mimic RNA described here shares the same set of primers and almost identical nucleotide sequence with the target RNA, it is expected to undergo similar reverse transcription, primer annealing, extension and strand separation kinetics as the target RNA during RTPCR. Moreover, the addition of a known quantity of mimic into each reaction enables it to serve as an internal control for any variations that might occur between tubes. The average of the reactions then gives an accurate estimate of the target RNA concentration. Quantitation of the target with respect to known amounts of co-amplified mimic therefore allows a sensitive and reliable measurement of the number of target molecules in the original sample.
6.1. Troubleshooting 6.1.1. RNA isolation and cDNA synthesis The entire RNA isolation procedure needs to be performed under sterile conditions in order to obtain a pure, uncontaminated, RNA sample. Therefore, all dissecting tools, homogenizers, eppendorf tubes and pipette tips need to be sterile and only used for RNA isolation. Other reagents involved in RNA isolation, such as chloroform, isopropanol and ethanol should be used only for RNA
106
K.L Kelleher et al. / Brain Research Protocols 6 (2001) 100 – 107
isolation, in order to avoid contamination from other sources. If RNA is being isolated from small tissue samples, it may be possible to increase the yield by extending the isopropanol step to overnight at 2208C. There are two sources for reverse transcriptase, AMV or MMLV, both of which have different cDNA synthesis efficiencies. We have used AMV-RT for the current study and we found this enzyme to give accurate and reproducible experimental results.
(vi) Add an equal volume of isopropanol, store at 2208C overnight. (vii) Centrifuge sample at 12 000 g at 48C for 20 min. Decant isopropanol and air-dry the pellet for 15 min. (viii) Wash RNA pellet with 75% ethanol. Centrifuge at 12 000 g at 48C for 8 min. Decant ethanol and air-dry pellet for 15 min. (ix) Resuspend RNA pellet in DEPC-treated water and heat to 608C for 10 min. Store RNA at 2708C.
6.1.2. Amplification efficiencies It is essential that the target RNA and internal standard undergo similar RT-PCR kinetics in order for quantitation to be accurate. The target RNA and internal standard must be transcribed to cDNA and be amplified at the same rate for the internal standard to perform its role properly.
7.2. Generation of internal standard
6.2. Alternative and support protocols We isolated RNA using RNAzol B from Bresatec and we found this product to produce a high yield of pure RNA. All steps in the manufacturer’s procedure are suggested to be performed at 48C or on ice. For another reagent, Isogen, it is recommended that all steps be performed at room temperature. The temperature at which the RNA isolation is performed is obviously critical, but varies for different reagents from different suppliers. When generating the competitive internal standard, a proof-reading Taq DNA polymerase (Pfu) can be used, which will decrease the number of clones required to obtain a true clone of the gene. Since the development of the RT-PCR technique, many advances have been made whereby it is now possible to accurately measure mRNA levels in small amounts of tissues or even single cells. We have used a one-step method as opposed to the two-step method, as this minimizes the number of manipulations and limits the number of pipetting errors. We have also employed a competitive internal standard that resulted in a sensitive, accurate and reproducible means of measuring mRNA levels.
7. Quick procedure
The generation of an internal standard will vary with every gene but can be based on the methods below. (i) Obtain a partial mouse G za cDNA sequence by RT-PCR from mouse cerebellum using primers predicted from the conserved sequences of human and rat G za cDNA. (ii) Carry out RT-PCR procedure. (iii) Prepare a 1.5% agarose gel. (iv) Add loading dye to each PCR product and carry out electrophoresis. (v) Stain gel with ethidium bromide for 15–20 min. (vi) View gel under ultraviolet light and excise bands of the predicted size. (vii) Purify RT-PCR product and clone into the Sma I restriction site of pTZ19U (or similar plasmid). (viii) Sequence insert DNA. (ix) Digest DNA plasmid with Stu I and EcoR V restriction enzymes, gel purify and religate, resulting in the removal of the 107-base-pair fragment.
7.3. Synthesis of RNA internal standard (i) Plasmid DNA was linearised by restriction digestion and purified by ethanol precipitation after heat denaturation of the enzyme. (ii) The RNA competitive template was synthesized by in vitro transcription of the linearised plasmid in 100 ml of transcription buffer for 2 h at 378C. (iii) Digest plasmid DNA with 5 units of RQ1 RNAasefree DNAase for 15 min at 378C. (iv) Ethanol precipitate, air-dry and redissolve the synthesized RNA in DEPC-treated water.
7.1. Extraction of total mouse RNA (i) Anaesthetize mice with ether. (ii) Dissect out tissues, weigh and add an appropriate volume of RNAzol B. (iii) Homogenize tissue samples on ice, leave on ice for 10–20 min. (iv) Add chloroform, shake sample, leave on ice for 15 min. (v) Centrifuge sample at 12 000 g at 48C for 20 min. Remove upper aqueous phase.
7.4. Reverse transcription-polymerase chain reaction ( RT-PCR) (i) Pipette 3 ml of mimic RNA into an appropriate number of tubes. (ii) Add 3 ml of target RNA to a tube containing 3 ml of mimic RNA, mix well. (iii) Perform an appropriate number of dilutions. (iv) Add 9 ml of reaction mix to each tube (total 12 ml per tube).
K.L Kelleher et al. / Brain Research Protocols 6 (2001) 100 – 107
(v) Run RT-PCR procedure on a fast capillary thermal cycler. (vi) Prepare agarose gel. Carry out electrophoresis. (vii) Stain gel with ethidium bromide for 15–20 min. (viii) View stained gel under UV light and record image.
[5]
[6]
8. Essential literature references [7]
[8,10,12] [8]
References [1] J. Chelly, J.C. Kaplan, P. Maire, S. Gautron, A. Kahn, Transcription of the dystrophin gene in human muscle and non-muscle tissue, Nature 333 (1988) 858–860. [2] J. Chelly, D. Montarras, C. Pinset, Y. Berwald-Netter, J.C. Kaplan, A. Kahn, Quantitative estimation of minor mRNAs by cDNApolymerase chain reaction. Application to dystrophin mRNA in cultured myogenic and brain cells, Eur. J. Biochem. 187 (1990) 691–698. [3] E. de Kant, C.F. Rochlitz, R. Herrmann, Gene expression analysis by a competitive and differential PCR with antisense competitors, Biotechniques 17 (1994) 934–942. [4] R.A. Gadient, U. Otten, Differential expression of interleukin-6
[9] [10]
[11] [12]
[13]
107
(IL-6) and interleukin-6 receptor (IL-6R) mRNAs in rat hypothalamus, Neurosci. Lett. 153 (1993) 13–16. G. Gilliland, S. Perrin, K. Blanchard, H.F. Bunn, Analysis of cytokine mRNA and DNA: detection and quantitation by competitive polymerase chain reaction, Proc. Natl. Acad. Sci. USA 87 (1990) 2725–2729. K.L. Kelleher, K.I. Matthaei, K.J. Leck, I.A. Hendry, Developmental expression of messenger RNA levels of the alpha subunit of the GTP-binding protein, Gz, in the mouse nervous system, Brain Res. Dev. Brain Res. 107 (1998) 247–253. T. Maniatis, E.F. Fritsch, J. Sambrook, Molecular Cloning: A Laboratory Manual Vol 1 (1989) 7.3–7.4. M. Matsuoka, H. Itoh, Y. Kaziro, Characterization of the human gene for Gx alpha, a pertussis toxin-insensitive regulatory GTPbinding protein, J. Biol. Chem. 265 (1990) 13215–13220. A. Mellick, The characterization and in vivo targeting of Gz, in: Masters Thesis, Australian National University, 1995. L.N. Sellner, R.J. Coelen, J.S. Mackenzie, Reverse transcriptase inhibits Taq polymerase activity, Nucleic Acids Res. 20 (1992) 1487–1490. P.D. Siebert, J.W. Larrick, Competitive PCR, Nature 359 (1992) 557–558. A.M. Wang, M.V. Doyle, D.F. Mark, Quantitation of mRNA by the polymerase chain reaction, Proc. Natl. Acad. Sci. USA 86 (1989) 9717–9721. P.L. Zamorano, V.B. Mahesh, D.W. Brann, Quantitative RT-PCR for neuroendocrine studies. A minireview, Neuroendocrinology 63 (1996) 397–407.
Protocol
A one-step quantitative reverse transcription polymerase chain reaction procedure a, a a b Kim L Kelleher *, Kwong-Joo Leck , Ian A Hendry , Klaus I Matthaei b
a Division of Neuroscience, John Curtin School of Medical Research, Australian National University, Canberra ACT 2601, Australia Division of Biochemistry and Molecular Biology, John Curtin School of Medical Research, Australian National University, Canberra ACT 2601, Australia
Accepted 1 September 2000
Abstract Our laboratory has developed a one-step quantitative reverse transcription polymerase chain reaction (RT-PCR) procedure in which the reverse transcriptase enzyme and Taq DNA polymerase are combined in the one tube and a single, non-interrupted, thermal cycling program is performed. In the past, RT-PCR has been carried out with two separate steps: (1) reverse transcription of RNA to generate a cDNA pool and (2) polymerase chain reaction amplification of the cDNA. The two-step method can affect the accuracy of the procedure as the total number of manipulations is greater, thereby allowing a greater chance for pipetting errors. Quantitation by our method is achieved in a single reaction by the use of a competitive internal standard that is identical in sequence to the target RNA except for a deletion of 107 base pairs and uses identical primers and cycling conditions. Using this method, we have been able to quantify the amount of message of a G protein (G za ), in small amounts of tissue, such as dorsal root ganglia, from embryonic as well as postnatal mice. 2001 Elsevier Science B.V. All rights reserved. Theme: Cellular and molecular biology Topic: Gene structure and function: general Keywords: Quantitative RT-PCR; Competitive internal standard; Mouse; Nervous system; G proteins; mRNA developmental expression
1. Type of research Measurement of G za mRNA levels in a variety of mouse peripheral and central nervous system tissues over a range of embryonic and postnatal ages [6].
2. Time required Generation of cDNA internal standard: approximately 1 week due to designing primers, performing PCR, inserting into plasmid, digesting with restriction enzymes. Synthesis of RNA internal standard: 3 h RNA extraction: depends on how many animals and how many tissues samples there are to be processed, but, *Corresponding author. Tel.: 161-2-6279-8463; fax: 161-2-62492687. E-mail address: [email protected] (K.L Kelleher).
in general, a minimum of 6 h is required (longer if the isopropanol precipitation step is left overnight). RT-PCR: 1–2 h to set up dilutions, make reaction mix and fill capillary tubes. 2–3 h for reverse transcription and polymerase chain reaction cycling to take place. 1–1.5 h for agarose-gel preparation and gel electrophoresis 20 min for ethidium bromide staining and photography
3. Materials
3.1. Animals BALB / c mice were obtained from the specific pathogen-free facility at The John Curtin School of Medical Research at the Australian National University. The postnatal developmental ages that were examined for G za
1385-299X / 01 / $ – see front matter 2001 Elsevier Science B.V. All rights reserved. PII: S1385-299X( 00 )00042-8
K.L Kelleher et al. / Brain Research Protocols 6 (2001) 100 – 107
mRNA expression were birth, and postnatal days 7, 14, 21, 28 and 60. Embryos were also obtained from ether-anesthetized pregnant BALB / c mice at embryonic days 15, 16, 17, 18 and 19.
3.2. Equipment • Fast capillary thermal cycler (Corbett Research, Australia) • Tabletop centrifuge • UV spectrophotometer • Water bath • Gel electrophoresis equipment • storage space, 220 and 2708C • pipettes (Gilson pipetman P1000, P200, P20 and P2) • Agarose gel documentation system to record digital gel images after electrophoresis (Novaline or equivalent) • Image Quant software (Molecular Dynamics) • PC or Mac capable of running Image Quant software.
3.3. Chemicals and reagents • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •
aerosol-resistant pipette tips Agarose (type I) (ICN) Amplitaq DNA polymerase (Roche) Avian myeloblastosis virus reverse transcriptase (Promega) Alu I (NEB) Bromophenol Blue (Sigma) Bovine serum albumin (BSA) Chloroform–isoamyl alcohol (49:1, v / v) Deoxynucleotides (dTTP, dGTP, dATP, dCTP) (Promega) Diethylpyrocarbonate (DEPC) (Sigma) Dithiothreitol (Promega) EcoR I (NEB) EDTA Enzyme buffer (NEB2) (NEB) Eppendorf tubes (500 and 1500 ml) Ethanol (75%) Ethidium bromide (Sigma) Ficoll 400 (Pharmacia) Glacial acetic acid Isopropanol KKF (forward G za primer) KKR (reverse G za primer) Magnesium chloride Milli-Q H 2 O (Millipore) PCR capillary tubes (Bresatec) Potassium chloride pTZ19U DNA (Bio-Rad) RNAzol B (Bresatec) Sarcosyl (Sigma) Supertaq (Stehelin and Cie) Transfer RNA (Boehringer)
101
• Tris base (Sigma) • Triton X-100 • Xylene cyanol (Sigma)
4. Detailed procedure
4.1. Extraction of total mouse RNA (i) BALB / c mice of mixed sex at varying ages are anaesthetized with ether. (ii) Dissect out appropriate tissues, weigh and place into an homogenizer containing cold RNAzol B (2 ml / 100 mg tissue). In the case of ganglia for which an accurate weight cannot be determined, add 200 ml of RNAzol B. (iii) Homogenize the tissue samples on ice. Transfer the homogenate to a fresh eppendorf tube and leave on ice for 10–20 min. (iv) Add chloroform (1:10 of chloroform to homogenate), shake the sample vigorously (do not vortex-mix) and leave on ice for another 15 min. (v) Centrifuge the sample at 12 000 g at 48C for 20 min. Remove upper aqueous phase containing the RNA, being sure not to touch the interphase. (vi) Add an equal volume of isopropanol, invert to mix and store the samples at 48C for 15 min (freezing samples at 2208C overnight can give a better yield of RNA, especially when isolating RNA from a small amount of tissue). (vii) Recentrifuge the sample at 12 000 g at 48C for 20 min to precipitate the RNA. Decant the isopropanol carefully and air dry the pellet for approximately 15 min. (viii) Wash the RNA precipitate with 75% ethanol. Invert to mix a couple of times and centrifuge at 12 000 g at 48C for 8–10 min. Decant ethanol carefully and air dry the pellet for 15 min. (ix) Resuspend the RNA pellet in DEPC-treated water (*) and heat to 608C for 10 min. RNA should be stored at 2708C. Spectrophotometric measurements are made at 260, 280 and 320 nm, to determine the concentration and purity of the RNA. * Milli-Q water that had been treated with 0.1% DEPC at 378C overnight, then autoclaved for 15 min at 1348C [7].
4.2. Generation of cDNA internal standard The primers (4BF and 3R) used for the generation of the internal standard were predicted from the conserved regions of human and rat G za cDNA sequences, since these were the areas where the mouse G za cDNA sequence was most likely to be conserved (Table 1). At the same time, the primers were designed to show the greatest differences with other known mouse G protein a-subunit sequences, in order to avoid amplification of other G protein a-subunit mRNA (Table 2). The intron that exists in the human G za genomic DNA is located at position 723. This intron also
102
K.L Kelleher et al. / Brain Research Protocols 6 (2001) 100 – 107
Table 1 Oligonucleotide sequences of primers used to generate the competitive internal standard a 4BF 364 Human G Za cDNA Rat G Za cDNA
384
]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] 59 CCC GAG CTG CTG GGT GTC ATG 39 CCC GAG CTG CTG GGT GTC ATG
3R 1059 1036 ]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]]] 59 GCC AAT GTA CTT GAG ATT GTT CTG 39 GCC AAT GTA CTT GAG ATT GTT CTG
a
4BF (forward primer) and 3R (reverse primer) were designed to conserved regions of the human and rat G Za cDNA sequence that were most likely to be conserved. The numbers refer to the nucleotide position in the corresponding cDNA.
exists within the mouse genomic coding sequence and is located between each forward and reverse primer [9]. Amplifications of DNA contaminants during mRNA quantitation can thus be avoided since the amplification of the intron in the genomic sequence will result in a much larger PCR fragment. This was also confirmed by the lack of the formation of a product when reverse transcriptase was left out of the reaction, since the extension time (|20 base pairs per second) was too short to allow the amplification of the predicted genomic fragment. A partial mouse cDNA sequence was obtained by RTPCR from mouse cerebellum total RNA (see Section 4.1 for RNA extraction procedure) as follows: (i) Each 20 ml reaction mixture contained mouse cerebellum total RNA, 200 mM of each dNTP, RT-PCR buffer [67 mM Tris–HCl (pH 8.3), 0.5 mM dithiothreitol, 50 mM KCl, 0.1% Triton X-100, 6 mM EDTA and 2 mM MgCl 2 ], 2 units of Amplitaq DNA polymerase, 0.5 units of AMV-RT, 5 pmol of forward primer (4BF), 5 pmol of reverse primer (3R) and 2 mg of yeast tRNA. (ii) The RT-PCR procedure is then carried out on a fast capillary thermal cycler (Corbett Research) employing the following cycling conditions. Cycle 1, reverse transcriptase (428C, 59 min); cycle 2, DNA denaturation and AMV-RT inactivation (948C, 5 min), primer annealing (658C, 15 s), primer extension (728C, 90 s); cycles 3–7, DNA denaturation (948C, 15 s), primer annealing (658C, 15 s), primer extension (728C, 90 s); cycles 8–35, DNA denaturation (948C, 5 s), primer annealing (658C, 5 s), primer extension (728C, 90 s); cycle 36, DNA denaturation (948C, 5 s), primer annealing (658C, 5 s), primer extension (728C, 7 min), enzyme inactivation (998C, 10 min), cooling (258C, 5 min). The times given are ‘in tube’ times that reflect the actual times present in the reaction mixture. (iii) Agarose gels (1.5%) were prepared by dissolving
agarose in TAE electrophoresis buffer (40 mM Tris– acetate, 2 mM EDTA, pH 8.0). (iv) Add a 0.25 volume of 53 loading dye [50 mM Tris–HCl, pH 8.0, 100 mM EDTA, 1% (w / v) sarcosyl, 7.5% (w / v) Ficoll 400, 0.05% bromophenol blue and 0.05% xylene cyanol] to PCR products and place in 658C water bath for 5 min. Electrophoresis is carried out in a Bio-Rad wide mini-sub electrophoretic tank with TAE as the electrophoretic buffer. (v) Stain the agarose gel with ethidium bromide (0.5 mg / ml) for 15–20 min. (vi) The stained gel is viewed and photographed under ultraviolet light. The gel bands of the predicted size are excised using a sterile scalpel blade. (vii) The RT-PCR product was purified from the excised gel band using a PCR product purification kit (Boehringer Mannheim), and cloned into the phosphatased Sma I site in the multiple cloning site of pTZ19U (Bio-Rad). (viii) Plasmid DNA was prepared from transformed bacteria colonies and sequenced using the cycle sequencing kit from Applied Biosystems. Twenty-six clones were isolated, of which, eight were chosen at random and sequenced. All eight clones contained the full length mouse G za sequence and they were found to exhibit considerable homology to one another and to the human and rat G za cDNA in the region flanked by the primers. They differed from each other by only one or two base pairs. (ix) One of these clones containing the consensus sequence for the mouse G za cDNA was used for the generation of the cDNA internal standard. This was done by digesting the plasmid DNA with the restriction enzymes Stu I and Eco RV, which excise a 107-base-pair fragment from within the cloned G za cDNA, and then religating the plasmid.
Table 2 Comparison of 4BF and 3R primer sequences with other G protein subunits in the same region a Primer sequences Mouse G ia Mouse G oa A Mouse G oa B Mouse G ta Mouse G Sa a
364
CCCGAGCTGCTGGGTGTCATG 384 GAAGACCTGTCCGGTGTCATC 384 364 GCAGAACTTCTTTCTGCCATG 384 364 GCAGAACTTCTTTCTGCCATG 384 348 AAGGAGATGTCAGACATCATT 368 379 CCTGAATTCTATGAGCATGCC 399 364
1059
GCCAATGTACTTGAGATTGTTCTG 1036 GCCACAGTCCTTCAGGTTGTTCTT 1036 1056 GCCGCAGCCCCGGAGATTGTTGGC 1033 1056 TCCACAGCCCCGTAGGTTTTTGGC 1033 1043 CCCGCAGTCTTTGAGGTTCTCCTT 1020 1125 CTCGTATTGGCGGAGATGCATGCG 1102 1059
The primers were constructed to regions that were known to show differences at the same sites to other G protein a subunits, to avoid amplifications of the mRNAs of these other G protein a-subunits in the mouse tissue. Genbank accession codes for the other G proteins are M13963 for G ia , M13964 for Gs a , M36777 for G oa A, M36778 for G oa B and M25509 for G ta . The numbers refer to the nucleotide position in the corresponding cDNA.
K.L Kelleher et al. / Brain Research Protocols 6 (2001) 100 – 107
(x) The religated plasmid was again transformed, and plasmid DNA containing the G za internal standard was prepared.
4.3. Synthesis of RNA internal standard (i) Plasmid DNA containing the internal standard was linearised by restriction digestion downstream of the insert using EcoR I (40 units), and purified by ethanol precipitation after heat denaturation of the enzyme. (ii) The RNA competitive template was synthesized by in vitro transcription of the linearised plasmid, which contained a T7 RNA polymerase promoter upstream of the cDNA competitive template insert. Transcription was performed at 378C for 2 h in 100 ml of transcription buffer (final concentration: 40 mM Tris–HCl, pH 7.5, 6 mM MgCl 2 , 2 mM spermidine, 10 mM NaCl, 10 mM DTT, 0.5 mM dNTPs) using 2 mg of linearised plasmid with 40 units of T7 RNA polymerase (Promega) and 100 units of RNAase inhibitor (Bresatec). (iii) After transcription, the plasmid DNA template was degraded using 5 units of RQ1 RNAase-free DNAase (Promega) by incubating the transcription mixture for a further 15 min at 378C. (iv) The synthesized RNA was ethanol-precipitated, airdried and redissolved in DEPC water, and spectrophotometric measurements were made at 260 and 280 nm, to determine the concentration and purity of the RNA.
4.4. Reverse transcription-polymerase chain reaction ( RT-PCR) The partial mouse G za cDNA sequence had been obtained from cloned PCR products. The exact mouse sequence at the primer regions was, therefore, not known. Since the PCR product contained the synthetic predicted sequences, it was, therefore, possible that these primers may anneal better to the mimic than to the mouse G za cDNA, since the mimic sequence at these positions may not be identical to the mouse sequence. New primers
103
complementary to the mouse G za sequence, which could be expected to anneal specifically and with equal probability to both the target and mimic RNA, were synthesized. Blast alignment was also performed on the sequences of the new primers to be used for the RT-PCR procedure to ensure they were constructed to regions of G za that show maximal difference to other G protein a-subunit sequences, in order to avoid their amplification (Table 3). The primers were specifically chosen to have different annealing temperatures to other G protein a-subunit sequences so as to preferentially amplify G za . Moreover, in a number of cases, our primers have no homology to other G protein a-subunit sequences at the 39 end of the primer (Table 3), thereby preventing any amplification of these other genes. In addition, the specificity of our primers was verified during the cloning process where all eight randomly chosen clones contained full length mouse G z sequences that only varied by single base differences and no other G protein sequences were seen. We are confident therefore that our primers are specific for G za . A one-step RT-PCR was performed where both the reverse transcriptase enzyme and Taq DNA polymerase were combined in the same tube. The RT-PCR buffer contained 67 mM Tris– HCl (pH 8.3), 0.5 mM dithiothreitol, 50 mM KCl, 0.1% Triton X-100, 6 mM EDTA and 2.5 mM MgCl 2 [10]. Yeast transfer RNA (tRNA) was added to the DEPC-treated water (0.3 mg / ml) that was used to dilute the stock solution of mimic RNA. (i) Pipette 3 ml of mimic RNA into an appropriate number of tubes. The concentration of mimic RNA to be used needs to be determined depending on the range of target RNA dilutions expected. (ii) Add 3 ml of target RNA to a tube containing 3 ml of mimic RNA and mix well. (iii) From this, remove 3 ml and add to another tube containing a further 3 ml of mimic RNA. Repeat this process to perform a series of dilutions of target RNA in mimic RNA. We initially performed tenfold dilutions to determine approximately at what concentration the point of equilibrium between target RNA and mimic RNA is reached. A further twofold range of dilutions was then
Table 3 Comparison of oligonucleotide sequences of primers used for RT-PCR with other G protein a-subunits a
Mouse G za Mouse G ia Mouse G sa Mouse G qa Mouse G oa A Mouse G oa B Mouse G 12a Mouse G ta a
KKF
KKR
59 TGGGTGTCATGCGACGGCTCTG 39 CCGGTGTCATCCGGAGGCTCTG TATGAGTCATGCCAAGGCTCTG TAGATGCAATAAAGAGCTTGTG TTTCTGCCATGATGCGACTCTG TTTCTGCCATGATGCGACTCTG TACGTGCCAGCCCTGAGTGCCC TGGACGTCATCAGGAAGTTGTG
39 AACATCCAGTTTGTGTTTGACGCAG 59 AACGTGCAGTTTGTGTTCGATGCCG AACATCCGCCGTGTCTTCAACGACT AACATCCGCTTCGTCTTTGCAGCCG AATATCCAGGTGGTATTCGACGCCG AACATCCAATTCGTCTTTTGATGCCG AACATCCGCTTCGTGTTTCATGCTG AACGTCAAATTCGTGTTCGATGCAG
KKF (forward primer) and KKR (reverse primer) were the primers used in the RT-PCR study. They were constructed to regions that were known to show differences at the same sites to other G protein a subunits, to avoid amplifications of the mRNAs of the G protein a subunits in the mouse tissue. Genbank accession codes for the other G proteins are M13963 for G ia , M13964 for Gs a , M36777 for G oa A, M36778 for G oa B and M25509 for G ta . The numbers refer to the nucleotide position in the corresponding cDNA.
104
K.L Kelleher et al. / Brain Research Protocols 6 (2001) 100 – 107
performed as above, spanning the approximate equivalent point in a second PCR reaction. (iv) Add 9 ml of reaction mix that contains RT-PCR buffer, 200 mM of each dTTP, dGTP, dCTP and dATP, 5 pmol of forward primer, 5 pmol of reverse primer, 0.6 U AMV-RT and 1 U Supertaq (1 unit of Boehringer Taq DNA polymerase is equally effective) and DEPC-treated water. (v) The RT-PCR procedure is then carried out on a fast capillary thermal cycler (Corbett Research) employing the following cycling conditions. Cycle 1: reverse transcription (428C, 59 min); cycle 2: DNA denaturation and AMV-RT inactivation (958C, 3 min); cycles 3–40: DNA denaturation (958C, 10 s), primer annealing (658C, 15 s), primer extension (728C, 35 s); cycle 41: final primer extension (728C, 3 min), cooling (258C, 5 min). NB. The times given are ‘in tube’ times that reflect the actual times present in the reaction mixture. (vi) Agarose gels (1.5%) were prepared by dissolving agarose in TAE electrophoresis buffer (40 mM Tris– acetate, 2 mM EDTA, pH 8.0). Add a 0.25 volume of loading dye to PCR products and place in 658C water bath for 5 min. Electrophoresis is carried out in a Bio-Rad wide mini-sub electrophoretic tank with TAE as the electrophoretic buffer. The plasmid pTZ19U DNA digested with Alu I is run in parallel with the samples to serve as a molecular-size marker. (vii) Stain the agarose gel with ethidium bromide (0.5 mg / ml) for 15–20 min. (viii) The stained gel is viewed and photographed under ultraviolet light and recorded with the Novaline Gel Documentation System.
5. Results
5.1. Quantitation of PCR products The intensity of the respective bands was measured using Image Quant software (Molecular Dynamics). The values obtained enabled the level of G za mRNA in the initial total RNA sample to be calculated. Fig. 1A shows the amplification of G za after 38 cycles of a sample containing twofold dilutions of mouse brain RNA (645 bp) and a constant concentration of mimic RNA (538 bp). Fig. 1B shows a graph of the log ratio of RNA to mimic RNA, plotted against the log amount of initial RNA. An RNA / mimic RNA ratio of one,where the RNA and mimic RNA bands are of equal intensity, corresponds to an RNA concentration of 2.1 ng / assay. By combining the concentration of the mimic RNA (156 fg / ml per assay), the size of the human G za RNA sequence (3957 bp) [8] and the size of the mimic RNA sequence (538 bp), we determined that the mimic RNA represents 1.143 fg of G za mRNA. Applying this value with the RNA concentration
Fig. 1. Quantitation of G za mRNA levels in the initial total RNA sample. (A) Amplification of twofold dilutions of mouse brain RNA (645 bp, top row of bands) and a constant concentration of mimic RNA (538 bp, bottom row of bands) (lanes 1–9). PTZ19U /Alu I (lane M) was run in parallel to serve as a molecular-weight marker (621 and 521 bp). (B) Graph of the log ratio of RNA-to-mimic RNA, plotted against the log amount of initial RNA. An RNA / mimic RNA ratio of one (approximately lane 5) corresponds to an RNA concentration of 2.1 ng / assay. It was calculated that the G za mRNA concentration was 0.55 fg / ng total RNA (see text for discussion).
at equivalence (2.1 ng), we calculated the G za mRNA concentration to be 0.55 fg / ng of total RNA.
5.2. Quantitative RT-PCR: optimal cycling conditions The mimic RNA must be transcribed to DNA at the same rate as the target RNA if it is going to be suitable to be used as a competitive internal standard. Constant amounts of brain RNA and mimic RNA were amplified for varying numbers of cycles. Results from aliquots taken at the end of every two cycles, from 26 to 40 cycles of amplification, showed that the amplification rates of samples from adult mouse brain RNA and mimic RNA were exponential between 28 and 38 cycles (Fig. 2). The log of the DNA concentration was plotted against the number of cycles. Both the total RNA and mimic RNA were transcribed to DNA at the same rate, confirming that the mimic RNA was suitable as a competitive internal standard. In all later experiments, the samples were examined at the end of
K.L Kelleher et al. / Brain Research Protocols 6 (2001) 100 – 107
Fig. 2. Linearity of RT-PCR with cycle time. Known and constant amounts of brain RNA and mimic RNA were amplified for varying numbers of cycles, ranging from 26 to 40. Amplification rates for RNA and mimic RNA were exponential between 28 and 38 cycles. DNA concentration was determined by applying a standard curve that was generated from dilutions of pTZ19U /Alu I separated by electrophoresis in an agarose gel.
the 38 th cycle, the peak of the amplification efficiency. It is recommended that similar optimization experiments be performed for each target RNA.
6. Discussion Determining the mRNA levels of specific genes allows an estimation of gene expression. Northern or dot blot analysis and RNA protection assays have been the major techniques used in the past to determine mRNA levels. These techniques are limited in their usefulness since they require large amounts of total RNA to estimate the concentration of a specific transcript [13]. To examine mRNA expression in embryonic tissues or neuroendocrine tissues where the tissue sample is very small, using these techniques is not very useful since it is necessary to pool tissues from several animals. This not only results in large numbers of animals being used but also necessitates experiments being repeated to allow statistical analysis of the data. Pooling of tissues to obtain enough RNA also means that mRNA levels cannot be determined in individual animals [13]. The development of the RT-PCR procedure has provided a technique that is more specific and sensitive than traditional methods of RNA analysis and has therefore become the method of choice for studying gene expression since it can be performed with far less total RNA. Thus, RT-PCR is extremely useful for the detection of rare transcripts as well as for measuring mRNA levels in individual nuclei or embryonic tissues [13]. However, there are several variables that can affect the efficiency of the RT reaction and PCR amplification, which must be addressed in order to obtain reliable,
105
reproducible data. The polymerase enzyme used, the MgCl 2 concentration in the buffer, the primer sequences and the number of amplification cycles are important variables that can be easily controlled during the PCR process. RT-PCR is an exponential reaction, however, since small variations in the efficiency at an early cycle number during amplification can lead to dramatic variations in the amount of PCR product generated [5]. Alterations in the efficiency of RT-PCR have also been attributed to tube-to-tube variation and / or variations in the temperature across the block of the cycler. In order to limit these variations, a variety of internal standards have been designed. Housekeeping genes, such as b-actin and cyclophilin, are examples of endogenous internal standards [1,2], but exogenous internal standards have been proven more useful in the quantitation of mRNA levels. Exogenous internal standards are synthetic RNA or DNA sequences that are not present in the target sample but are added directly to the RT or PCR reaction [4,12]. Exogenous internal standards generally possess a sequence that is highly homologous to the target RNA sequence (they are also known as mimic RNA), but a portion of sequence will be added or deleted and, therefore, they utilize and compete for the same set of primers, but produce a product of a different size [11]. The target sequence can thus be differentiated from the internal standard by sizing, using electrophoresis [3]. Using an internal standard that utilizes the same set of primers as the target RNA is, therefore, highly advantageous over other internal standards, since differences in the reverse transcription and the amplification efficiencies of the target RNA and mimic RNA are avoided. Since the mimic RNA described here shares the same set of primers and almost identical nucleotide sequence with the target RNA, it is expected to undergo similar reverse transcription, primer annealing, extension and strand separation kinetics as the target RNA during RTPCR. Moreover, the addition of a known quantity of mimic into each reaction enables it to serve as an internal control for any variations that might occur between tubes. The average of the reactions then gives an accurate estimate of the target RNA concentration. Quantitation of the target with respect to known amounts of co-amplified mimic therefore allows a sensitive and reliable measurement of the number of target molecules in the original sample.
6.1. Troubleshooting 6.1.1. RNA isolation and cDNA synthesis The entire RNA isolation procedure needs to be performed under sterile conditions in order to obtain a pure, uncontaminated, RNA sample. Therefore, all dissecting tools, homogenizers, eppendorf tubes and pipette tips need to be sterile and only used for RNA isolation. Other reagents involved in RNA isolation, such as chloroform, isopropanol and ethanol should be used only for RNA
106
K.L Kelleher et al. / Brain Research Protocols 6 (2001) 100 – 107
isolation, in order to avoid contamination from other sources. If RNA is being isolated from small tissue samples, it may be possible to increase the yield by extending the isopropanol step to overnight at 2208C. There are two sources for reverse transcriptase, AMV or MMLV, both of which have different cDNA synthesis efficiencies. We have used AMV-RT for the current study and we found this enzyme to give accurate and reproducible experimental results.
(vi) Add an equal volume of isopropanol, store at 2208C overnight. (vii) Centrifuge sample at 12 000 g at 48C for 20 min. Decant isopropanol and air-dry the pellet for 15 min. (viii) Wash RNA pellet with 75% ethanol. Centrifuge at 12 000 g at 48C for 8 min. Decant ethanol and air-dry pellet for 15 min. (ix) Resuspend RNA pellet in DEPC-treated water and heat to 608C for 10 min. Store RNA at 2708C.
6.1.2. Amplification efficiencies It is essential that the target RNA and internal standard undergo similar RT-PCR kinetics in order for quantitation to be accurate. The target RNA and internal standard must be transcribed to cDNA and be amplified at the same rate for the internal standard to perform its role properly.
7.2. Generation of internal standard
6.2. Alternative and support protocols We isolated RNA using RNAzol B from Bresatec and we found this product to produce a high yield of pure RNA. All steps in the manufacturer’s procedure are suggested to be performed at 48C or on ice. For another reagent, Isogen, it is recommended that all steps be performed at room temperature. The temperature at which the RNA isolation is performed is obviously critical, but varies for different reagents from different suppliers. When generating the competitive internal standard, a proof-reading Taq DNA polymerase (Pfu) can be used, which will decrease the number of clones required to obtain a true clone of the gene. Since the development of the RT-PCR technique, many advances have been made whereby it is now possible to accurately measure mRNA levels in small amounts of tissues or even single cells. We have used a one-step method as opposed to the two-step method, as this minimizes the number of manipulations and limits the number of pipetting errors. We have also employed a competitive internal standard that resulted in a sensitive, accurate and reproducible means of measuring mRNA levels.
7. Quick procedure
The generation of an internal standard will vary with every gene but can be based on the methods below. (i) Obtain a partial mouse G za cDNA sequence by RT-PCR from mouse cerebellum using primers predicted from the conserved sequences of human and rat G za cDNA. (ii) Carry out RT-PCR procedure. (iii) Prepare a 1.5% agarose gel. (iv) Add loading dye to each PCR product and carry out electrophoresis. (v) Stain gel with ethidium bromide for 15–20 min. (vi) View gel under ultraviolet light and excise bands of the predicted size. (vii) Purify RT-PCR product and clone into the Sma I restriction site of pTZ19U (or similar plasmid). (viii) Sequence insert DNA. (ix) Digest DNA plasmid with Stu I and EcoR V restriction enzymes, gel purify and religate, resulting in the removal of the 107-base-pair fragment.
7.3. Synthesis of RNA internal standard (i) Plasmid DNA was linearised by restriction digestion and purified by ethanol precipitation after heat denaturation of the enzyme. (ii) The RNA competitive template was synthesized by in vitro transcription of the linearised plasmid in 100 ml of transcription buffer for 2 h at 378C. (iii) Digest plasmid DNA with 5 units of RQ1 RNAasefree DNAase for 15 min at 378C. (iv) Ethanol precipitate, air-dry and redissolve the synthesized RNA in DEPC-treated water.
7.1. Extraction of total mouse RNA (i) Anaesthetize mice with ether. (ii) Dissect out tissues, weigh and add an appropriate volume of RNAzol B. (iii) Homogenize tissue samples on ice, leave on ice for 10–20 min. (iv) Add chloroform, shake sample, leave on ice for 15 min. (v) Centrifuge sample at 12 000 g at 48C for 20 min. Remove upper aqueous phase.
7.4. Reverse transcription-polymerase chain reaction ( RT-PCR) (i) Pipette 3 ml of mimic RNA into an appropriate number of tubes. (ii) Add 3 ml of target RNA to a tube containing 3 ml of mimic RNA, mix well. (iii) Perform an appropriate number of dilutions. (iv) Add 9 ml of reaction mix to each tube (total 12 ml per tube).
K.L Kelleher et al. / Brain Research Protocols 6 (2001) 100 – 107
(v) Run RT-PCR procedure on a fast capillary thermal cycler. (vi) Prepare agarose gel. Carry out electrophoresis. (vii) Stain gel with ethidium bromide for 15–20 min. (viii) View stained gel under UV light and record image.
[5]
[6]
8. Essential literature references [7]
[8,10,12] [8]
References [1] J. Chelly, J.C. Kaplan, P. Maire, S. Gautron, A. Kahn, Transcription of the dystrophin gene in human muscle and non-muscle tissue, Nature 333 (1988) 858–860. [2] J. Chelly, D. Montarras, C. Pinset, Y. Berwald-Netter, J.C. Kaplan, A. Kahn, Quantitative estimation of minor mRNAs by cDNApolymerase chain reaction. Application to dystrophin mRNA in cultured myogenic and brain cells, Eur. J. Biochem. 187 (1990) 691–698. [3] E. de Kant, C.F. Rochlitz, R. Herrmann, Gene expression analysis by a competitive and differential PCR with antisense competitors, Biotechniques 17 (1994) 934–942. [4] R.A. Gadient, U. Otten, Differential expression of interleukin-6
[9] [10]
[11] [12]
[13]
107
(IL-6) and interleukin-6 receptor (IL-6R) mRNAs in rat hypothalamus, Neurosci. Lett. 153 (1993) 13–16. G. Gilliland, S. Perrin, K. Blanchard, H.F. Bunn, Analysis of cytokine mRNA and DNA: detection and quantitation by competitive polymerase chain reaction, Proc. Natl. Acad. Sci. USA 87 (1990) 2725–2729. K.L. Kelleher, K.I. Matthaei, K.J. Leck, I.A. Hendry, Developmental expression of messenger RNA levels of the alpha subunit of the GTP-binding protein, Gz, in the mouse nervous system, Brain Res. Dev. Brain Res. 107 (1998) 247–253. T. Maniatis, E.F. Fritsch, J. Sambrook, Molecular Cloning: A Laboratory Manual Vol 1 (1989) 7.3–7.4. M. Matsuoka, H. Itoh, Y. Kaziro, Characterization of the human gene for Gx alpha, a pertussis toxin-insensitive regulatory GTPbinding protein, J. Biol. Chem. 265 (1990) 13215–13220. A. Mellick, The characterization and in vivo targeting of Gz, in: Masters Thesis, Australian National University, 1995. L.N. Sellner, R.J. Coelen, J.S. Mackenzie, Reverse transcriptase inhibits Taq polymerase activity, Nucleic Acids Res. 20 (1992) 1487–1490. P.D. Siebert, J.W. Larrick, Competitive PCR, Nature 359 (1992) 557–558. A.M. Wang, M.V. Doyle, D.F. Mark, Quantitation of mRNA by the polymerase chain reaction, Proc. Natl. Acad. Sci. USA 86 (1989) 9717–9721. P.L. Zamorano, V.B. Mahesh, D.W. Brann, Quantitative RT-PCR for neuroendocrine studies. A minireview, Neuroendocrinology 63 (1996) 397–407.