- Email: [email protected]
A PCR-RFLP assay for the distinction between Fasciola hepatica and Fasciola gigantica
Molecular and Cellular Probes (2002) 16, 327±333
doi:10.1006/mcpr.2002.0429, available online at http://www.idealibrary.com on
1
A PCR-RFLP assay for the distinction between Fasciola hepatica and Fasciola gigantica A. Marcilla*, M. D. Bargues and S. Mas-Coma Departamento de ParasitologõÂa, Facultad de Farmacia, Universidad de Valencia, Av. Vicent AndreÂs EstelleÂs s/n, 46100 Burjassot ± Valencia, Spain (Received 9 April 2002; accepted 28 May 2002) Fascioliasis is of well-known veterinary importance and an increasing human health problem, with reported cases in the ®ve continents. The causative agents, Fasciola hepatica and Fasciola gigantica, present geographical distributions, which overlap in many regions of Africa and Asia, and in which the differentiation of both species is usually dif®cult because of the many variations in their morphological characteristics. Moreover, in humans, liver ¯uke classi®cation cannot be achieved by clinical, pathological, coprological or immunological methods. The differential diagnosis between F. hepatica and F. gigantica infection is very important because of their different transmission and epidemiological characteristics. A simple and rapid PCR-restriction fragment length polymorphism (RFLP) assay, using the common restriction enzymes AvaII and DraII, is described to distinguish between both fasciolid species. It is based on a 618-bp-long sequence of the 28S rRNA gene recently obtained from liver ¯uke populations of South America, Europe and Africa. This sequence showed a few nucleotide differences between both fasciolids and no intraspeci®c variations within each species. This assay provides unambigous results and may be useful for both individual subject diagnosis and epidemiological surveys of humans and animals in endemic regions of sympatry. # 2002 Elsevier Science Ltd. All rights reserved. KEYWORDS: Fasciola hepatica, Fasciola gigantica, PCR-RFLP, 28S ribosomal DNA, molecular distinction.
INTRODUCTION Besides its well-known veterinary importance, fascioliasis has also proved to be an important health problem.1 The epidemiological picture of human fascioliasis has changed in recent years. Today we know that it can no longer be considered merely as a secondary zoonotic disease but must be considered an important human parasitic disease.2,3 Recent papers estimate human infection up to 17 million people.4 Human cases have been reported in countries of the ®ve continents,5 including severe symptomatology and pathology,1,3,6,7 with singular epidemiological
characteristics and presenting human endemic areas ranging from hypo- to hyperendemic.2,3 Two trematode species are involved in both animal and human fascioliasis: Fasciola hepatica and Fasciola gigantica (Trematoda: Fasciolidae). Whereas in Europe, the Americas and Australia only F. hepatica is concerned, the distributions of both species overlap in many areas of Africa and Asia.1 This geographical overlapping gives rise to many problems in the diagnosis. Traditional methods of identi®cation of Fasciola species have relied on morphological characteristics of adults and eggs. The adult stage of F. gigantica (24±76/5±13 mm in size) is
* Author to whom all correspondence should be addressed at: Departamento de ParasitologõÂa, Facultad de Farmacia, Universitat de Valencia, Av. Vicent AndreÂs EstelleÂs s/n, 46100 Burjassot ± Valencia, Spain. Tel.: 34 96 3864298; Fax: 34 96 3864769; E-mail: [email protected]
0890±8508/02/$ ± see front matter
# 2002 Elsevier Science Ltd. All rights reserved.
328
A. Marcilla et al.
much larger and slightly narrower than F. hepatica (20±50/6±13 mm).1 The average length/width ratio is 439±520 in F. gigantica, while it is 188±232 in F. hepatica.8 In F. gigantica, the shoulders are less developed, the cephalic cone is shorter, and the caeca are more branched than in F. hepatica, especially those toward the midline of the body (the centipedal branches). Branching patterns of the testes and ovary are also different between the two species.8,9 The average distance between the posterior border of the body and the posterior testis is longer in F. gigantica (149 mm; range: 6±19 mm) than in F. hepatica (778 mm; range: 3±13 mm).8 The eggs are morphologically similar but larger in F. gigantica (150±196/90±100 mm) than in F. hepatica (130±150/ 63±90 mm).1 Despite all this, it is usually dif®cult to accurately discriminate between F. hepatica and F. gigantica because of the many variations in their morphological characteristics. The differentiation becomes very dif®cult, sometimes impossible, when dealing with small specimens. This overlapping distribution of both species has even become the basis of an already long controversy on the taxonomic identity of the Fasciola species occurring in Far East countries, especially Japan, Taiwan, the Philippines and Korea, in which a wide range of morphological types is detected. At the extremes of this morphological range, some resemble F. hepatica, whereas others resemble F. gigantica, with intermediate forms also occurring and involving phenomena such as abnormal gametogenesis, diploidy, triploidy and mixoploidy, parthenogenesis, and hybridization events between different genotypes.1 Moreover, very recent experimental and ®eld studies have revealed that the de®nitive host species decisively in¯uences the morphometrics of liver ¯uke adults and eggs.10 This explains why in countries presenting large human endemic areas and in which both liver ¯uke species are known, as Egypt11,12 and Iran,8,13 most of the papers dealing with human fascioliasis only refer to Fasciola species, without speci®c classi®cation.3,5,14 In humans, the parasitological diagnosis of fascioliasis is based on egg ®nding and classi®cation in coprological studies,3,5 which does not allow liver ¯uke species differentiation because of the overlapping of egg dimensions in the human host (Valero & Mas-Coma, unpublished). The diagnosis neither by clinical and pathological analyses,3,7,15 nor by immunological tests,5,16 can differentiate between F. hepatica and F. gigantica infection, up to the present. The low number of records of human infection with F. gigantica may well be due to the lack of good tools to distinguish this species from F. hepatica.17
The differential diagnosis between F. hepatica and F. gigantica infection in humans is very important because of their different transmission and epidemiological characteristics. Each one of the liver ¯uke species is transmitted by different lymnaeid snail species, owing to different phylogenetic specificities.18,19 These different lymnaeid species have different living requirements, which explain that transmission foci of F. hepatica and F. gigantica are different.1 Therefore, many control measures against one or other liver ¯uke species also differ. Consequently, a rapid and simple test for the differentiation of the two Fasciola species is needed. The usefulness of molecular genetic techniques based on nuclear and mitochondrial DNA was emphasized while addressing problems of identi®cation, characterization, and phylogeny of parasites.20 Choice of sequences not repeated multiple times in the genome may have the effect of limiting sensitivity. In the present paper we describe a PCR-RFLP assay to speci®cally distinguish between F. hepatica and F. gigantica, based on nucleotide differences detected in a partial sequence of the large subunit (28S) of the ribosomal RNA gene recently obtained from liver ¯uke populations of South America, Europe and Africa. MATERIALS AND METHODS Parasite materials Adults of F. hepatica and F. gigantica were isolated from livers of naturally infected sheep and cattle taken from various geographical regions (Table 1). Flukes washed extensively in PBS (37 C) and subsequently ®xed in 70% ethanol and maintained at 4 C for several weeks were used for DNA extraction. DNA isolation and ampli®cation Genomic DNA was isolated from the apical zone of adult ¯ukes according to the phenol-chloroform method.21 DNA extraction was performed according to Bargues & Mas-Coma.18 Using information available from partial nucleotide sequences of the 28S rDNA from some trematodes22,23 and following a cloning approach, the whole 28S rRNA gene of F. hepatica and F. gigantica from different geographical regions was ampli®ed and sequenced. The whole 28S rDNA molecule is 4171 bp long and highly conserved in both F. hepatica and F. gigantica, with no intraspeci®c variation and only a few interspeci®c nucleotide differences
A PCR-RFLP assay for Fasciola species
329
Table 1. Liver ¯uke materials used in this study Liver ¯uke species
Host species
Geographical origin
Fasciola hepatica
Cattle Sheep Cattle
Northern Altiplano Cullera, Valencia Damanhour
Bolivia Spain Egypt
AJ440788 AJ439738 AJ440787
Fasciola gigantica
Cattle Cattle Cattle
Santiago Island Bobo-Dioulasso Damanhour
Cape Verde Burkina Faso Egypt
AJ439739 AJ440785 AJ440786
(Marcilla et al., unpublished). Basing on this, a fragment of 618 bp at the 50 end of the 28S rRNA gene, including 4 nucleotide differences between both Fasciola species, was selected and a PCR method to amplify it was developed. For the ampli®cation of this 618-bp-long fragment of the 28S rRNA gene, the primers 28F1 (50 ACGTGATTACCCGCTGAACT30 ) and 28R600 (50 CTGAGAAAGTGCACTGACAAG30 ) were used (Marcilla et al., unpublished). Each reaction mixture (total volume of 25 ml) contained 1 ml of diluted 1:30 genomic DNA, 15 U of Taq polymerase, dNTPs (200 mM each), 2 mM MgCl2, PCR 106 reaction buffer and 02 mmol of each primer. The Taq DNA polymerase EcoTaq1 was from Ecogen (Barcelona, Spain) and the nucleotide set from Promega (Madison, WI, USA). The reaction mixture was ampli®ed in a Peltier thermal cycler (MJ Research, Watertown, MA, USA). The samples were subjected to an initial denaturation step at 94 C for 3 min, followed by 30 cycles of 30 s at 94 C, 30 s at 60 C, and 60 s at 72 C. Finally, a primer extension step of 5 min at 72 C was used. Ten microlitres of PCR products were analysed by electroforesis on 1% (w/v) agarose gels. A lambda/Hind III DNA marker and a 100-bp Plus ladder molecular weight marker (MBI Fermentas, Lithuania) were included on each gel for base-pair comparisons. Gels were visualized by staining with ethidium bromide as described by Sambrook et al.21 Restriction fragment length polymorphism (RFLP) analysis Advantage was taken of the previous knowledge about the exact nucleotide differences between the two liver ¯uke species for choosing the appropriate, speci®c and common restriction enzymes AvaII and DraII to carry out the necessary restriction fragment length polymorphism analysis, which would allow us to distinguish between both species. Speci®c restriction enzymes were selected and lengths of resulting restriction fragments were predicted by means of the Gene Runner software v. 305 (Hastings Software Inc., 1994).
Country
Accession no.
Fig. 1. Ethidium bromide staining patterns of PCR products from the liver ¯uke DNA samples studied: Lane 1, Fasciola hepatica from cattle of Bolivia; Lane 2, F. hepatica from sheep of Spain; Lane 3, F. hepatica from cattle of Egypt; Lane 4, F. gigantica from cattle of Cape Verde; Lane 5, F. gigantica from cattle of Burkina Faso; Lane 6, F. gigantica from cattle of Egypt; Lane M, 100 bp DNA size marker.
Fifteen microlitres of PCR products were completely digested with 15 ml of AvaII (75 UI) and DraII (45 UI) restriction enzymes (Roche, Basel, Switzerland) at 37 C. The digested DNA was analysed by electrophoresis in 2% agarose gels and visualized by ethidium bromide staining.
RESULTS The result of a regular PCR experiment for the ampli®cation of the selected 28S rDNA fragment with the designed primer set yielded identical 618bp-long PCR products for F. hepatica and F. gigantica, independently from the different geographical origins and the different host species (Fig. 1). The corresponding sequences of F. hepatica and F. gigantica have been deposited in the GenBankTM , EMBL and DDBJ databases under the accesion numbers noted in Table 1. Restriction fragment length polymorphism (RFLP) patterns of F. hepatica and F. gigantica parasites were obtained after digestion of the PCR products with AvaII and DraII restriction enzymes (Fig. 2). The different band patterns generated after digestion and used to differentiate between the two species, including exact number of nucleotides, are summarized in Table 2.
330
A. Marcilla et al.
Fig. 2. Restriction fragment length polymorphism (RFLP) patterns of PCR products of liver ¯ukes after digestion with AvaII and DraII restriction enzymes: Lanes M (left and right), 100 bp DNA size marker; Lanes 1 and 2, 618-bp-long PCR products of Fasciola hepatica and F. gigantica, respectively; Lanes 3 and 5, PCR products of F. hepatica after digestion with AvaII and DraII, respectively; Lanes 4 and 6, PCR products of F. gigantica after digestion with AvaII and DraII, respectively. Table 2. Restriction fragment length polymorphism (RFLP) patterns (in bp for each restriction band) of the 618-bp-long PCR fragments from liver ¯uke species generated after digestion with restriction enzymes Restriction enzyme AvaII DraII
Fasciola hepatica
Fasciola gigantica
529, 62, 27 529, 89
322, 269, 27 618
After the digestion of the PCR product with the restriction enzyme AvaII, the RFLP pro®le obtained from F. hepatica revealed two fragments of 529 and 62 bp, whereas F. gigantica generated a clearly distinguishible doublet corresponding to the 322 and 269 bp fragments (common fragments of 27 bp in both species were not visualized) (Table 2, Fig. 2). The DraII digestion generated two fragments of 529 bp and 89 bp from F. hepatica, whereas it did not cut the PCR product from F. gigantica (Table 2, Fig. 2). DISCUSSION Different molecular techniques and DNA markers have already been used for the differentiation of fasciolid ¯ukes. Most studies on fasciolid proteins have concentrated on isozymes. Unfortunately, only a very few studies considered individual or population-level variation. The same isozymes of F. hepatica were detected regardless of the host species (cattle, sheep, goats), but densities of some isozyme bands did differ according to host.24 Isoelectric focusing of ¯uke soluble protein has been used to con®rm the
presence of both F. hepatica and F. gigantica in Egypt,12 although pro®les of whole-body proteins and excretory secretory products obtained with this technique differ among worms from different hosts as sheep and calves.25 Concerning the mitochondrial DNA, part of the mtDNA of F. hepatica was cloned, sequenced and showed length heterogeneity, suggesting length differences among individual mitochondrial genomes.26 NADH dehydrogenase subunit I (NDI) and cytochrome c oxidase subunit I (COI) sequencing results showed that the Japanese Fasciola forms were more closely related to those of F. gigantica than to F. hepatica,27 contrary to the previous predictions obtained from the similar band pattern detected between fasciolids via the PCR-single-strand conformational polymorphism (SSCP) method.28 Moreover, a high intraspeci®c variation (83%) in a 145-bpfragment of the NDI sequence of F. gigantica and a low one (02%) in a 474-bp-fragment of the COI sequence of F. hepatica and the Japanese form of Fasciola were found.27 Restriction-fragment-length polymorphism (RFLP) patterns were analysed for the whole mitochondrial DNA of F. hepatica from Australia, F. gigantica from Malaysia and Fasciola sp. from Japan after digestion with three four-base-cutting endonucleases: Hinf I, MspI and RsaI.29 The mtDNA digestion patterns differed markedly between the three fasciolids. For each enzyme there were some bands speci®c for each geographical isolate, the Japanese Fasciola sp. sharing more bands with F. gigantica than with F. hepatica. However, given the variation observed within the short region of the COI gene sequenced, there are likely to be considerable differences in RFLP patterns even between quite closely related forms. Additionally, 25±28 nucleotide differences were detected in a 395-bp-long COI fragment between F. hepatica and Fasciola sp./F. gigantica, and 4±5 between Fasciola sp. and F. gigantica. Moreover, intraspeci®c variation was found at one nucleotide site between different specimens from the same F. gigantica population from Malaysia.29 Concerning ribosomal DNA, restriction endonuclease maps of the rRNA genes were distinct for F. hepatica and F. gigantica, Japanese Fasciola sp. being identical in restriction map to F. gigantica. No intraspeci®c variations in the maps of F. hepatica (11 isolates from 6 countries) or of F. gigantica (2 isolates from different countries) were detected, but length heterogeneity was noted in the intergenic spacer, even within individual worms.30 In a fragment of less than 200 bp of the D1 domain of the 28S rRNA gene, a few differences were detected between F. hepatica from sheep of Ipswich
A PCR-RFLP assay for Fasciola species
and F. gigantica from cattle of Malaysia,22 but unfortunately no intraspeci®c variation studies were performed. The second internal transcribed spacer (ITS-2) of the rDNA has been used several times for fasciolid classi®cation. One nucleotide difference in a 263-bplong ITS-2 fragment between the F. hepatica population from Mexico and those from Australia, Hungary and New Zealand, and no difference in the 213-bplong ITS-2 fragment compared between F. gigantica from Indonesia and Malaysia were found. Fasciola hepatica and F. gigantica differed at 6 nucleotide sites among 213 nucleotides compared, and Fasciola sp. from Japan differed in 7 nucleotide differences from F. hepatica and in 1 from F. gigantica.31 Later, similar results were found in the almost complete, 362-bp-long ITS-2 sequence, although no difference was found between Japanese Fasciola sp. and F. gigantica.29 The ITS-2 sequences of the 7 Japanese triploid fasciolids were divided into two distinct types: F.sp.I, almost identical to that of F. hepatica from Uruguay, and F.sp.II, similar to F. gigantica from Indonesia and Japan from previous reports.32 No intraspeci®c variation was detected between 2 F. hepatica specimens from Uruguay, but two different sequences were obtained from individuals of F. gigantica from Zambia and a third sequence from F. gigantica from Indonesia which was identical to that known from Malaysia. It was concluded that the Japanese triploid form of Fasciola may be a hybrid between F. hepatica and F. gigantica because the NDI and COI sequences of F.sp.I were almost identical to those of F. gigantica from Zambia but not to F. hepatica from Uruguay.32 More recently, the complete ITS-2 sequence of F. hepatica from Bolivia and Spain proved to be identical. Its comparison with the ITS-2 sequences of F. hepatica from other geographic origins showed a few nucleotide differences, differing from all other at least in one position. Similarly, the complete, 433-bp-long ITS-1 sequence showed no nucleotide difference between Bolivia and Spain.33 In the present study, no intraspeci®c nucleotide variations were detected in the 618-bp-long fragment of the highly-conserved 28S rRNA gene sequenced, regardless of the host species and different geographical origins. The three F. hepatica populations from Bolivia, Spain and Egypt presented an identical sequence, as did the three F. gigantica populations from Cape Verde, Burkina Faso and Egypt. On the contrary, a few but signi®cant nucleotide differences were detected between F. hepatica and F. gigantica. Based on these nucleotide differences, a PCR-RFLP assay was developed to speci®cally
331
separate/distinguish between F. hepatica and F. gigantica. This assay is simple to perform, provides unambiguous results, uses common restriction enzymes (as AvaII), may be developed from a very small amount of material because of being based on repetitive DNA (presumed high sensitivity), and can be completed within 1 day. The PCR method described here can be used for the proper identi®cation of Fasciola species and become a helpful tool for the speci®c diagnosis of the liver ¯uke causal agent of fascioliasis in human subjects in geographical areas such as Egypt, where both F. hepatica and F. gigantica appear to be sympatric, and clinical, pathological, coprological and immunological analyses do not allow a differentiation between them. It might also be a useful alternative to distinguish between the two Fasciola species at veterinary level in those overlapping distribution areas in which they often coexist in the liver of the same domestic animal, and morphological characteristics of the ¯uke adult stage are tedious, time consuming and sometimes not suf®cient for the necessary speci®c classi®cation. Moreover, this method may be very useful for epidemiological surveys on both human and livestock fascioliases in those high endemic regions of sympatry. ACKNOWLEDGEMENTS This work was supported by funding from the Project No. PM97-0099 of the DireccioÂn General de InvestigacioÂn Cientõ®ca y TeÂcnica (DGICYT), Spanish Ministry of Education and Culture, Madrid, by the Program of Scienti®c Cooperation with Latin America, Instituto de CooperacioÂn Iberoamericana, Agencia EspanÄola de CooperacioÂn Internacional (ICI-AECI), Madrid, Project PDP B2/181/125 of WHO, Geneva, Project No. 3006/1999 of the DireccioÂn General de CooperacioÂn para el Desarrollo, Presidencia de Gobierno de la Generalitat Valenciana, Valencia, Spain, and by the Patronat Sud-Nord of the Fundacio General of the University of Valencia, Spain. Collaboration by Dr Rene Angles and Dr Wilma Strauss (La Paz, Bolivia) in the collection of parasite materials from Bolivia, and by Dr Filippo Curtale (Rome, Italy), Dr Aly Abd El Wahed El Wakeel, M. Mabrouk El Sayed and the Behera Survey Team (Damanhour, Egypt) in those from Egypt, is acknowledged. Special thanks are given to Dr Lorenzo Savioli and Dr Antonio Montresor (WHO, Geneva) for facilitating ®eld work in Egypt. Parasite materials from Burkina Faso and Cape Verde were provided by Dr JeanPierre Pointier (Perpignan, France) and Dr Fernanda Rosa and Dr Virginia Crespo (Lisbon, Portugal), respectively.
REFERENCES 1. Mas-Coma, S. & Bargues, M. D. (1997). Human liver ¯ukes: a review. Research and Reviews in Parasitology 57, 145±218.
332
A. Marcilla et al.
2. Mas-Coma, S., Esteban, J. G. & Bargues, M. D. (1999). Epidemiology of human fascioliasis: a review and proposed new classi®cation. Bulletin of the World Health Organization 77, 340±6. 3. Mas-Coma, S, Bargues, M. D. & Esteban, J. G. (1999). Human Fasciolosis. In Fasciolosis (Dalton, J. P., ed.) pp. 411±34. Wallingford, Oxon, UK: CAB International Publishing. 4. Hopkins, D. R. (1992). Homing in on helminths. American Journal of Tropical Medicine and Hygiene 46, 626±34. 5. Esteban, J. G., Bargues, M. D. & Mas-Coma, S. (1998) Geographical distribution, diagnosis and treatment of human fascioliasis: a review. Research and Reviews in Parasitology 58, 13±42. 6. Chen, M. G. & Mott, K. E. (1990). Progress in assessment of morbidity due to Fasciola hepatica infection: a review of recent literature. Tropical Diseases Bulletin 87, R1±R38. 7. Mas-Coma,S.,Bargues,M.D.,Marty,A.M.&Nea®e,R.C. (2000). Hepatic Trematodiases. In Pathology of Infectious Diseases, Vol. 1 Helminthiases (Meyers, W. M., Nea®e, R. C., Marty, A. M. & Wear, D. J., eds) pp. 69±92. Washington, D.C.: Armed Forces Institute of Pathology and American Registry of Pathology. 8. Sahba, G. H., Arfaa, F., Farahmandian, I. & Jalali, H. (1972). Animal fascioliasis in Khuzestan, southwestern Iran. Journal of Parasitology 58, 712±16. 9. Bergeon, P. & Laurent, M. (1970). DiffeÂrences entre la morphologie testiculaire de Fasciola hepatica et Fasciola gigantica. Revue d'Elevage et de MeÂdecine VeÂterinaire des Pays Tropicaux 23, 223±7. 10. Valero, M. A., Darce, N. A., Panova, M. & Mas-Coma, S. (2001). Relationships between host species and morphometric patterns in Fasciola hepatica adults and eggs from the Northern Bolivian Altiplano hyperendemic region. Veterinary Parasitology 102, 85±100. 11. Soliman, M. S. (1998). Control of veterinary fascioliasis. In Infectious Diseases and Public Health. A Research and Clinical Update (Angelico, M. & Rocchi, G., eds) pp. 334±46. Philadelphia, L'Aquila: Balaban Publishers. 12. Lotfy, W. M., El-Morshedy, H. N., El-Hoda, M. A., El-Tawila, M. M., Omar, E. A. & Farag, H. F. (2002). Identi®cation of the Egyptian species of Fasciola. Veterinary Parasitology 103, 323±32. 13. Massoud, J. & Sadjadi, S. (1980). Susceptibility of different species of Lymnaea snails to miracidia of Fasciola gigantica and F. hepatica in Iran. Journal of Helminthology 54, 201±2. 14. Curtale, F., Hammoud, E. S., El Wakeel, A., Mas-Coma, S. & Savioli, L. (2000). Human fascioliasis, an emerging public health problem in the Nile Delta, Egypt. Research and Reviews in Parasitology 60, 129±34. 15. El-Shabrawi, M., El-Karaksy, H., Okasha, S. & El-Hennawy, A. (1997). Human fascioliasis: clinical features and diagnostic dif®culties in Egyptian children. Journal of Tropical Pediatrics 43, 162±6. 16. Hillyer, G. V. (1999). Immunodiagnosis of human and animal fasciolosis. In Fasciolosis (Dalton, J. P., ed.) pp. 435±47. Wallingford, Oxon, UK: CAB International Publishing. 17. Hammond, J. A. (1974). Human infection with the liver ¯uke Fasciola gigantica. Transactions of the
18.
19.
20.
21.
22.
23.
24. 25.
26.
27.
28.
29.
30.
31.
Royal Society of Tropical Medicine and Hygiene 68, 253±4. Bargues, M. D. & Mas-Coma, S. (1997). Phylogenetic analysis of lymnaeid snails based on 18S rDNA sequences. Molecular Biology and Evolution 14, 569±77. Bargues, M. D., Vigo, M., Horak, P., Dvorak, J., Patzner, R. A., Pointier, J. P., Jackiewicz, M., MeierBrook, C. & Mas-Coma, S. (2001). European Lymnaeidae (Mollusca: Gastropoda), intermediate hosts of trematodiases, based on nuclear ribosomal DNA ITS-2 sequences. Infection, Genetics and Evolution 1, 85±107. McManus, D. P. & Bowles, J. (1996). Molecular genetic approaches to parasite identi®cation: their value in diagnostic parasitology and systematics. International Journal for Parasitology 26, 687±704. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning. A Laboratory Manual, 2nd edn. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. Barker, S. C., Blair, D., Garret, A. R. & Cribb, T. H. (1993). Utility of the D1 domain of nuclear 28S rRNA for phylogenetic inference in the Digenea. Systematic Parasitology 26, 181±8. Littlewood, D. T. & Johnston, D. A., (1995). Molecular phylogenetics of the four Schistosoma species groups determined with partial 28S ribosomal RNA gene sequences. Parasitology 111, 167±75. Blair, D. (1993). Molecular variation in fasciolids and Paragonimus. Acta Tropica 53, 277±89. Lee, C. G., Zimmerman, G. L. & Bishop, J. K. (1992). Host in¯uence on the banding pro®les of whole-body protein and excretory-secretory product of Fasciola hepatica (Trematoda) by isoelectric focusing. Veterinary Parasitology 41, 57±68. Zurita, M., Bieber, D., Ringold, G. & Mansour, T. E. (1988). cDNA cloning and gene characterization of the mitochondrial large subunit (LSU) rRNA from the liver ¯uke Fasciola hepatica. Evidence of heterogeneity in the ¯uke mitochondrial genome. Nucleic Acids Research 16, 7001±12. Itagaki, T., Tsutsumi, K.-I., Ito, K. & Tsutsumi, Y. (1998). Taxonomic status of the Japanese triploid forms of Fasciola: comparison of mitochondrial ND1 and COI sequences with F. hepatica and F. gigantica. Journal of Parasitology 84, 445±8. Itagaki, T., Tsutsumi, K.-I., Sakamoto, T., Tsutsumi, Y. & Itagaki, H. (1995). Characterization of genetic divergence among species within the genus Fasciola by PCR-SSCP. Japanese Journal of Parasitology 44, 244±7. Hashimoto, K., Watanobe, T., Liu, C. X., Init, I., Blair, D., Ohnishi, S. & Agatsuma, T. (1997). Mitochondrial DNA and nuclear DNA indicate that the Japanese Fasciola species is F. gigantica. Parasitology Research 83, 220±5. Blair, D. & McManus, D. P. (1989). Restriction enzyme mapping of ribosomal DNA can distinguish between fasciolid (liver ¯uke) species. Molecular and Biochemical Parasitology 36, 201±8. Adlard, R. D., Barker, S. C., Blair, D. & Cribb, T. H. (1993). Comparison of the second internal transcribed spacer (ribosomal DNA) from populations and species of Fasciolidae (Digenea). International Journal for Parasitology 23, 422±5.
A PCR-RFLP assay for Fasciola species 32. Itagaki, T. & Tsutsumi, K. (1998). Triploid form of Fasciola in Japan: genetic relationships between Fasciola hepatica and Fasciola gigantica determined by ITS-2 sequence of the nuclear rDNA. International Journal for Parasitology 28, 777±81.
333
33. Mas-Coma, S, Funatsu, I. R. & Bargues, M. D. (2001). Fasciola hepatica and lymnaeid snails occurring at very high altitude in South America. Parasitology 123, S115±27.
doi:10.1006/mcpr.2002.0429, available online at http://www.idealibrary.com on
1
A PCR-RFLP assay for the distinction between Fasciola hepatica and Fasciola gigantica A. Marcilla*, M. D. Bargues and S. Mas-Coma Departamento de ParasitologõÂa, Facultad de Farmacia, Universidad de Valencia, Av. Vicent AndreÂs EstelleÂs s/n, 46100 Burjassot ± Valencia, Spain (Received 9 April 2002; accepted 28 May 2002) Fascioliasis is of well-known veterinary importance and an increasing human health problem, with reported cases in the ®ve continents. The causative agents, Fasciola hepatica and Fasciola gigantica, present geographical distributions, which overlap in many regions of Africa and Asia, and in which the differentiation of both species is usually dif®cult because of the many variations in their morphological characteristics. Moreover, in humans, liver ¯uke classi®cation cannot be achieved by clinical, pathological, coprological or immunological methods. The differential diagnosis between F. hepatica and F. gigantica infection is very important because of their different transmission and epidemiological characteristics. A simple and rapid PCR-restriction fragment length polymorphism (RFLP) assay, using the common restriction enzymes AvaII and DraII, is described to distinguish between both fasciolid species. It is based on a 618-bp-long sequence of the 28S rRNA gene recently obtained from liver ¯uke populations of South America, Europe and Africa. This sequence showed a few nucleotide differences between both fasciolids and no intraspeci®c variations within each species. This assay provides unambigous results and may be useful for both individual subject diagnosis and epidemiological surveys of humans and animals in endemic regions of sympatry. # 2002 Elsevier Science Ltd. All rights reserved. KEYWORDS: Fasciola hepatica, Fasciola gigantica, PCR-RFLP, 28S ribosomal DNA, molecular distinction.
INTRODUCTION Besides its well-known veterinary importance, fascioliasis has also proved to be an important health problem.1 The epidemiological picture of human fascioliasis has changed in recent years. Today we know that it can no longer be considered merely as a secondary zoonotic disease but must be considered an important human parasitic disease.2,3 Recent papers estimate human infection up to 17 million people.4 Human cases have been reported in countries of the ®ve continents,5 including severe symptomatology and pathology,1,3,6,7 with singular epidemiological
characteristics and presenting human endemic areas ranging from hypo- to hyperendemic.2,3 Two trematode species are involved in both animal and human fascioliasis: Fasciola hepatica and Fasciola gigantica (Trematoda: Fasciolidae). Whereas in Europe, the Americas and Australia only F. hepatica is concerned, the distributions of both species overlap in many areas of Africa and Asia.1 This geographical overlapping gives rise to many problems in the diagnosis. Traditional methods of identi®cation of Fasciola species have relied on morphological characteristics of adults and eggs. The adult stage of F. gigantica (24±76/5±13 mm in size) is
* Author to whom all correspondence should be addressed at: Departamento de ParasitologõÂa, Facultad de Farmacia, Universitat de Valencia, Av. Vicent AndreÂs EstelleÂs s/n, 46100 Burjassot ± Valencia, Spain. Tel.: 34 96 3864298; Fax: 34 96 3864769; E-mail: [email protected]
0890±8508/02/$ ± see front matter
# 2002 Elsevier Science Ltd. All rights reserved.
328
A. Marcilla et al.
much larger and slightly narrower than F. hepatica (20±50/6±13 mm).1 The average length/width ratio is 439±520 in F. gigantica, while it is 188±232 in F. hepatica.8 In F. gigantica, the shoulders are less developed, the cephalic cone is shorter, and the caeca are more branched than in F. hepatica, especially those toward the midline of the body (the centipedal branches). Branching patterns of the testes and ovary are also different between the two species.8,9 The average distance between the posterior border of the body and the posterior testis is longer in F. gigantica (149 mm; range: 6±19 mm) than in F. hepatica (778 mm; range: 3±13 mm).8 The eggs are morphologically similar but larger in F. gigantica (150±196/90±100 mm) than in F. hepatica (130±150/ 63±90 mm).1 Despite all this, it is usually dif®cult to accurately discriminate between F. hepatica and F. gigantica because of the many variations in their morphological characteristics. The differentiation becomes very dif®cult, sometimes impossible, when dealing with small specimens. This overlapping distribution of both species has even become the basis of an already long controversy on the taxonomic identity of the Fasciola species occurring in Far East countries, especially Japan, Taiwan, the Philippines and Korea, in which a wide range of morphological types is detected. At the extremes of this morphological range, some resemble F. hepatica, whereas others resemble F. gigantica, with intermediate forms also occurring and involving phenomena such as abnormal gametogenesis, diploidy, triploidy and mixoploidy, parthenogenesis, and hybridization events between different genotypes.1 Moreover, very recent experimental and ®eld studies have revealed that the de®nitive host species decisively in¯uences the morphometrics of liver ¯uke adults and eggs.10 This explains why in countries presenting large human endemic areas and in which both liver ¯uke species are known, as Egypt11,12 and Iran,8,13 most of the papers dealing with human fascioliasis only refer to Fasciola species, without speci®c classi®cation.3,5,14 In humans, the parasitological diagnosis of fascioliasis is based on egg ®nding and classi®cation in coprological studies,3,5 which does not allow liver ¯uke species differentiation because of the overlapping of egg dimensions in the human host (Valero & Mas-Coma, unpublished). The diagnosis neither by clinical and pathological analyses,3,7,15 nor by immunological tests,5,16 can differentiate between F. hepatica and F. gigantica infection, up to the present. The low number of records of human infection with F. gigantica may well be due to the lack of good tools to distinguish this species from F. hepatica.17
The differential diagnosis between F. hepatica and F. gigantica infection in humans is very important because of their different transmission and epidemiological characteristics. Each one of the liver ¯uke species is transmitted by different lymnaeid snail species, owing to different phylogenetic specificities.18,19 These different lymnaeid species have different living requirements, which explain that transmission foci of F. hepatica and F. gigantica are different.1 Therefore, many control measures against one or other liver ¯uke species also differ. Consequently, a rapid and simple test for the differentiation of the two Fasciola species is needed. The usefulness of molecular genetic techniques based on nuclear and mitochondrial DNA was emphasized while addressing problems of identi®cation, characterization, and phylogeny of parasites.20 Choice of sequences not repeated multiple times in the genome may have the effect of limiting sensitivity. In the present paper we describe a PCR-RFLP assay to speci®cally distinguish between F. hepatica and F. gigantica, based on nucleotide differences detected in a partial sequence of the large subunit (28S) of the ribosomal RNA gene recently obtained from liver ¯uke populations of South America, Europe and Africa. MATERIALS AND METHODS Parasite materials Adults of F. hepatica and F. gigantica were isolated from livers of naturally infected sheep and cattle taken from various geographical regions (Table 1). Flukes washed extensively in PBS (37 C) and subsequently ®xed in 70% ethanol and maintained at 4 C for several weeks were used for DNA extraction. DNA isolation and ampli®cation Genomic DNA was isolated from the apical zone of adult ¯ukes according to the phenol-chloroform method.21 DNA extraction was performed according to Bargues & Mas-Coma.18 Using information available from partial nucleotide sequences of the 28S rDNA from some trematodes22,23 and following a cloning approach, the whole 28S rRNA gene of F. hepatica and F. gigantica from different geographical regions was ampli®ed and sequenced. The whole 28S rDNA molecule is 4171 bp long and highly conserved in both F. hepatica and F. gigantica, with no intraspeci®c variation and only a few interspeci®c nucleotide differences
A PCR-RFLP assay for Fasciola species
329
Table 1. Liver ¯uke materials used in this study Liver ¯uke species
Host species
Geographical origin
Fasciola hepatica
Cattle Sheep Cattle
Northern Altiplano Cullera, Valencia Damanhour
Bolivia Spain Egypt
AJ440788 AJ439738 AJ440787
Fasciola gigantica
Cattle Cattle Cattle
Santiago Island Bobo-Dioulasso Damanhour
Cape Verde Burkina Faso Egypt
AJ439739 AJ440785 AJ440786
(Marcilla et al., unpublished). Basing on this, a fragment of 618 bp at the 50 end of the 28S rRNA gene, including 4 nucleotide differences between both Fasciola species, was selected and a PCR method to amplify it was developed. For the ampli®cation of this 618-bp-long fragment of the 28S rRNA gene, the primers 28F1 (50 ACGTGATTACCCGCTGAACT30 ) and 28R600 (50 CTGAGAAAGTGCACTGACAAG30 ) were used (Marcilla et al., unpublished). Each reaction mixture (total volume of 25 ml) contained 1 ml of diluted 1:30 genomic DNA, 15 U of Taq polymerase, dNTPs (200 mM each), 2 mM MgCl2, PCR 106 reaction buffer and 02 mmol of each primer. The Taq DNA polymerase EcoTaq1 was from Ecogen (Barcelona, Spain) and the nucleotide set from Promega (Madison, WI, USA). The reaction mixture was ampli®ed in a Peltier thermal cycler (MJ Research, Watertown, MA, USA). The samples were subjected to an initial denaturation step at 94 C for 3 min, followed by 30 cycles of 30 s at 94 C, 30 s at 60 C, and 60 s at 72 C. Finally, a primer extension step of 5 min at 72 C was used. Ten microlitres of PCR products were analysed by electroforesis on 1% (w/v) agarose gels. A lambda/Hind III DNA marker and a 100-bp Plus ladder molecular weight marker (MBI Fermentas, Lithuania) were included on each gel for base-pair comparisons. Gels were visualized by staining with ethidium bromide as described by Sambrook et al.21 Restriction fragment length polymorphism (RFLP) analysis Advantage was taken of the previous knowledge about the exact nucleotide differences between the two liver ¯uke species for choosing the appropriate, speci®c and common restriction enzymes AvaII and DraII to carry out the necessary restriction fragment length polymorphism analysis, which would allow us to distinguish between both species. Speci®c restriction enzymes were selected and lengths of resulting restriction fragments were predicted by means of the Gene Runner software v. 305 (Hastings Software Inc., 1994).
Country
Accession no.
Fig. 1. Ethidium bromide staining patterns of PCR products from the liver ¯uke DNA samples studied: Lane 1, Fasciola hepatica from cattle of Bolivia; Lane 2, F. hepatica from sheep of Spain; Lane 3, F. hepatica from cattle of Egypt; Lane 4, F. gigantica from cattle of Cape Verde; Lane 5, F. gigantica from cattle of Burkina Faso; Lane 6, F. gigantica from cattle of Egypt; Lane M, 100 bp DNA size marker.
Fifteen microlitres of PCR products were completely digested with 15 ml of AvaII (75 UI) and DraII (45 UI) restriction enzymes (Roche, Basel, Switzerland) at 37 C. The digested DNA was analysed by electrophoresis in 2% agarose gels and visualized by ethidium bromide staining.
RESULTS The result of a regular PCR experiment for the ampli®cation of the selected 28S rDNA fragment with the designed primer set yielded identical 618bp-long PCR products for F. hepatica and F. gigantica, independently from the different geographical origins and the different host species (Fig. 1). The corresponding sequences of F. hepatica and F. gigantica have been deposited in the GenBankTM , EMBL and DDBJ databases under the accesion numbers noted in Table 1. Restriction fragment length polymorphism (RFLP) patterns of F. hepatica and F. gigantica parasites were obtained after digestion of the PCR products with AvaII and DraII restriction enzymes (Fig. 2). The different band patterns generated after digestion and used to differentiate between the two species, including exact number of nucleotides, are summarized in Table 2.
330
A. Marcilla et al.
Fig. 2. Restriction fragment length polymorphism (RFLP) patterns of PCR products of liver ¯ukes after digestion with AvaII and DraII restriction enzymes: Lanes M (left and right), 100 bp DNA size marker; Lanes 1 and 2, 618-bp-long PCR products of Fasciola hepatica and F. gigantica, respectively; Lanes 3 and 5, PCR products of F. hepatica after digestion with AvaII and DraII, respectively; Lanes 4 and 6, PCR products of F. gigantica after digestion with AvaII and DraII, respectively. Table 2. Restriction fragment length polymorphism (RFLP) patterns (in bp for each restriction band) of the 618-bp-long PCR fragments from liver ¯uke species generated after digestion with restriction enzymes Restriction enzyme AvaII DraII
Fasciola hepatica
Fasciola gigantica
529, 62, 27 529, 89
322, 269, 27 618
After the digestion of the PCR product with the restriction enzyme AvaII, the RFLP pro®le obtained from F. hepatica revealed two fragments of 529 and 62 bp, whereas F. gigantica generated a clearly distinguishible doublet corresponding to the 322 and 269 bp fragments (common fragments of 27 bp in both species were not visualized) (Table 2, Fig. 2). The DraII digestion generated two fragments of 529 bp and 89 bp from F. hepatica, whereas it did not cut the PCR product from F. gigantica (Table 2, Fig. 2). DISCUSSION Different molecular techniques and DNA markers have already been used for the differentiation of fasciolid ¯ukes. Most studies on fasciolid proteins have concentrated on isozymes. Unfortunately, only a very few studies considered individual or population-level variation. The same isozymes of F. hepatica were detected regardless of the host species (cattle, sheep, goats), but densities of some isozyme bands did differ according to host.24 Isoelectric focusing of ¯uke soluble protein has been used to con®rm the
presence of both F. hepatica and F. gigantica in Egypt,12 although pro®les of whole-body proteins and excretory secretory products obtained with this technique differ among worms from different hosts as sheep and calves.25 Concerning the mitochondrial DNA, part of the mtDNA of F. hepatica was cloned, sequenced and showed length heterogeneity, suggesting length differences among individual mitochondrial genomes.26 NADH dehydrogenase subunit I (NDI) and cytochrome c oxidase subunit I (COI) sequencing results showed that the Japanese Fasciola forms were more closely related to those of F. gigantica than to F. hepatica,27 contrary to the previous predictions obtained from the similar band pattern detected between fasciolids via the PCR-single-strand conformational polymorphism (SSCP) method.28 Moreover, a high intraspeci®c variation (83%) in a 145-bpfragment of the NDI sequence of F. gigantica and a low one (02%) in a 474-bp-fragment of the COI sequence of F. hepatica and the Japanese form of Fasciola were found.27 Restriction-fragment-length polymorphism (RFLP) patterns were analysed for the whole mitochondrial DNA of F. hepatica from Australia, F. gigantica from Malaysia and Fasciola sp. from Japan after digestion with three four-base-cutting endonucleases: Hinf I, MspI and RsaI.29 The mtDNA digestion patterns differed markedly between the three fasciolids. For each enzyme there were some bands speci®c for each geographical isolate, the Japanese Fasciola sp. sharing more bands with F. gigantica than with F. hepatica. However, given the variation observed within the short region of the COI gene sequenced, there are likely to be considerable differences in RFLP patterns even between quite closely related forms. Additionally, 25±28 nucleotide differences were detected in a 395-bp-long COI fragment between F. hepatica and Fasciola sp./F. gigantica, and 4±5 between Fasciola sp. and F. gigantica. Moreover, intraspeci®c variation was found at one nucleotide site between different specimens from the same F. gigantica population from Malaysia.29 Concerning ribosomal DNA, restriction endonuclease maps of the rRNA genes were distinct for F. hepatica and F. gigantica, Japanese Fasciola sp. being identical in restriction map to F. gigantica. No intraspeci®c variations in the maps of F. hepatica (11 isolates from 6 countries) or of F. gigantica (2 isolates from different countries) were detected, but length heterogeneity was noted in the intergenic spacer, even within individual worms.30 In a fragment of less than 200 bp of the D1 domain of the 28S rRNA gene, a few differences were detected between F. hepatica from sheep of Ipswich
A PCR-RFLP assay for Fasciola species
and F. gigantica from cattle of Malaysia,22 but unfortunately no intraspeci®c variation studies were performed. The second internal transcribed spacer (ITS-2) of the rDNA has been used several times for fasciolid classi®cation. One nucleotide difference in a 263-bplong ITS-2 fragment between the F. hepatica population from Mexico and those from Australia, Hungary and New Zealand, and no difference in the 213-bplong ITS-2 fragment compared between F. gigantica from Indonesia and Malaysia were found. Fasciola hepatica and F. gigantica differed at 6 nucleotide sites among 213 nucleotides compared, and Fasciola sp. from Japan differed in 7 nucleotide differences from F. hepatica and in 1 from F. gigantica.31 Later, similar results were found in the almost complete, 362-bp-long ITS-2 sequence, although no difference was found between Japanese Fasciola sp. and F. gigantica.29 The ITS-2 sequences of the 7 Japanese triploid fasciolids were divided into two distinct types: F.sp.I, almost identical to that of F. hepatica from Uruguay, and F.sp.II, similar to F. gigantica from Indonesia and Japan from previous reports.32 No intraspeci®c variation was detected between 2 F. hepatica specimens from Uruguay, but two different sequences were obtained from individuals of F. gigantica from Zambia and a third sequence from F. gigantica from Indonesia which was identical to that known from Malaysia. It was concluded that the Japanese triploid form of Fasciola may be a hybrid between F. hepatica and F. gigantica because the NDI and COI sequences of F.sp.I were almost identical to those of F. gigantica from Zambia but not to F. hepatica from Uruguay.32 More recently, the complete ITS-2 sequence of F. hepatica from Bolivia and Spain proved to be identical. Its comparison with the ITS-2 sequences of F. hepatica from other geographic origins showed a few nucleotide differences, differing from all other at least in one position. Similarly, the complete, 433-bp-long ITS-1 sequence showed no nucleotide difference between Bolivia and Spain.33 In the present study, no intraspeci®c nucleotide variations were detected in the 618-bp-long fragment of the highly-conserved 28S rRNA gene sequenced, regardless of the host species and different geographical origins. The three F. hepatica populations from Bolivia, Spain and Egypt presented an identical sequence, as did the three F. gigantica populations from Cape Verde, Burkina Faso and Egypt. On the contrary, a few but signi®cant nucleotide differences were detected between F. hepatica and F. gigantica. Based on these nucleotide differences, a PCR-RFLP assay was developed to speci®cally
331
separate/distinguish between F. hepatica and F. gigantica. This assay is simple to perform, provides unambiguous results, uses common restriction enzymes (as AvaII), may be developed from a very small amount of material because of being based on repetitive DNA (presumed high sensitivity), and can be completed within 1 day. The PCR method described here can be used for the proper identi®cation of Fasciola species and become a helpful tool for the speci®c diagnosis of the liver ¯uke causal agent of fascioliasis in human subjects in geographical areas such as Egypt, where both F. hepatica and F. gigantica appear to be sympatric, and clinical, pathological, coprological and immunological analyses do not allow a differentiation between them. It might also be a useful alternative to distinguish between the two Fasciola species at veterinary level in those overlapping distribution areas in which they often coexist in the liver of the same domestic animal, and morphological characteristics of the ¯uke adult stage are tedious, time consuming and sometimes not suf®cient for the necessary speci®c classi®cation. Moreover, this method may be very useful for epidemiological surveys on both human and livestock fascioliases in those high endemic regions of sympatry. ACKNOWLEDGEMENTS This work was supported by funding from the Project No. PM97-0099 of the DireccioÂn General de InvestigacioÂn Cientõ®ca y TeÂcnica (DGICYT), Spanish Ministry of Education and Culture, Madrid, by the Program of Scienti®c Cooperation with Latin America, Instituto de CooperacioÂn Iberoamericana, Agencia EspanÄola de CooperacioÂn Internacional (ICI-AECI), Madrid, Project PDP B2/181/125 of WHO, Geneva, Project No. 3006/1999 of the DireccioÂn General de CooperacioÂn para el Desarrollo, Presidencia de Gobierno de la Generalitat Valenciana, Valencia, Spain, and by the Patronat Sud-Nord of the Fundacio General of the University of Valencia, Spain. Collaboration by Dr Rene Angles and Dr Wilma Strauss (La Paz, Bolivia) in the collection of parasite materials from Bolivia, and by Dr Filippo Curtale (Rome, Italy), Dr Aly Abd El Wahed El Wakeel, M. Mabrouk El Sayed and the Behera Survey Team (Damanhour, Egypt) in those from Egypt, is acknowledged. Special thanks are given to Dr Lorenzo Savioli and Dr Antonio Montresor (WHO, Geneva) for facilitating ®eld work in Egypt. Parasite materials from Burkina Faso and Cape Verde were provided by Dr JeanPierre Pointier (Perpignan, France) and Dr Fernanda Rosa and Dr Virginia Crespo (Lisbon, Portugal), respectively.
REFERENCES 1. Mas-Coma, S. & Bargues, M. D. (1997). Human liver ¯ukes: a review. Research and Reviews in Parasitology 57, 145±218.
332
A. Marcilla et al.
2. Mas-Coma, S., Esteban, J. G. & Bargues, M. D. (1999). Epidemiology of human fascioliasis: a review and proposed new classi®cation. Bulletin of the World Health Organization 77, 340±6. 3. Mas-Coma, S, Bargues, M. D. & Esteban, J. G. (1999). Human Fasciolosis. In Fasciolosis (Dalton, J. P., ed.) pp. 411±34. Wallingford, Oxon, UK: CAB International Publishing. 4. Hopkins, D. R. (1992). Homing in on helminths. American Journal of Tropical Medicine and Hygiene 46, 626±34. 5. Esteban, J. G., Bargues, M. D. & Mas-Coma, S. (1998) Geographical distribution, diagnosis and treatment of human fascioliasis: a review. Research and Reviews in Parasitology 58, 13±42. 6. Chen, M. G. & Mott, K. E. (1990). Progress in assessment of morbidity due to Fasciola hepatica infection: a review of recent literature. Tropical Diseases Bulletin 87, R1±R38. 7. Mas-Coma,S.,Bargues,M.D.,Marty,A.M.&Nea®e,R.C. (2000). Hepatic Trematodiases. In Pathology of Infectious Diseases, Vol. 1 Helminthiases (Meyers, W. M., Nea®e, R. C., Marty, A. M. & Wear, D. J., eds) pp. 69±92. Washington, D.C.: Armed Forces Institute of Pathology and American Registry of Pathology. 8. Sahba, G. H., Arfaa, F., Farahmandian, I. & Jalali, H. (1972). Animal fascioliasis in Khuzestan, southwestern Iran. Journal of Parasitology 58, 712±16. 9. Bergeon, P. & Laurent, M. (1970). DiffeÂrences entre la morphologie testiculaire de Fasciola hepatica et Fasciola gigantica. Revue d'Elevage et de MeÂdecine VeÂterinaire des Pays Tropicaux 23, 223±7. 10. Valero, M. A., Darce, N. A., Panova, M. & Mas-Coma, S. (2001). Relationships between host species and morphometric patterns in Fasciola hepatica adults and eggs from the Northern Bolivian Altiplano hyperendemic region. Veterinary Parasitology 102, 85±100. 11. Soliman, M. S. (1998). Control of veterinary fascioliasis. In Infectious Diseases and Public Health. A Research and Clinical Update (Angelico, M. & Rocchi, G., eds) pp. 334±46. Philadelphia, L'Aquila: Balaban Publishers. 12. Lotfy, W. M., El-Morshedy, H. N., El-Hoda, M. A., El-Tawila, M. M., Omar, E. A. & Farag, H. F. (2002). Identi®cation of the Egyptian species of Fasciola. Veterinary Parasitology 103, 323±32. 13. Massoud, J. & Sadjadi, S. (1980). Susceptibility of different species of Lymnaea snails to miracidia of Fasciola gigantica and F. hepatica in Iran. Journal of Helminthology 54, 201±2. 14. Curtale, F., Hammoud, E. S., El Wakeel, A., Mas-Coma, S. & Savioli, L. (2000). Human fascioliasis, an emerging public health problem in the Nile Delta, Egypt. Research and Reviews in Parasitology 60, 129±34. 15. El-Shabrawi, M., El-Karaksy, H., Okasha, S. & El-Hennawy, A. (1997). Human fascioliasis: clinical features and diagnostic dif®culties in Egyptian children. Journal of Tropical Pediatrics 43, 162±6. 16. Hillyer, G. V. (1999). Immunodiagnosis of human and animal fasciolosis. In Fasciolosis (Dalton, J. P., ed.) pp. 435±47. Wallingford, Oxon, UK: CAB International Publishing. 17. Hammond, J. A. (1974). Human infection with the liver ¯uke Fasciola gigantica. Transactions of the
18.
19.
20.
21.
22.
23.
24. 25.
26.
27.
28.
29.
30.
31.
Royal Society of Tropical Medicine and Hygiene 68, 253±4. Bargues, M. D. & Mas-Coma, S. (1997). Phylogenetic analysis of lymnaeid snails based on 18S rDNA sequences. Molecular Biology and Evolution 14, 569±77. Bargues, M. D., Vigo, M., Horak, P., Dvorak, J., Patzner, R. A., Pointier, J. P., Jackiewicz, M., MeierBrook, C. & Mas-Coma, S. (2001). European Lymnaeidae (Mollusca: Gastropoda), intermediate hosts of trematodiases, based on nuclear ribosomal DNA ITS-2 sequences. Infection, Genetics and Evolution 1, 85±107. McManus, D. P. & Bowles, J. (1996). Molecular genetic approaches to parasite identi®cation: their value in diagnostic parasitology and systematics. International Journal for Parasitology 26, 687±704. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning. A Laboratory Manual, 2nd edn. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. Barker, S. C., Blair, D., Garret, A. R. & Cribb, T. H. (1993). Utility of the D1 domain of nuclear 28S rRNA for phylogenetic inference in the Digenea. Systematic Parasitology 26, 181±8. Littlewood, D. T. & Johnston, D. A., (1995). Molecular phylogenetics of the four Schistosoma species groups determined with partial 28S ribosomal RNA gene sequences. Parasitology 111, 167±75. Blair, D. (1993). Molecular variation in fasciolids and Paragonimus. Acta Tropica 53, 277±89. Lee, C. G., Zimmerman, G. L. & Bishop, J. K. (1992). Host in¯uence on the banding pro®les of whole-body protein and excretory-secretory product of Fasciola hepatica (Trematoda) by isoelectric focusing. Veterinary Parasitology 41, 57±68. Zurita, M., Bieber, D., Ringold, G. & Mansour, T. E. (1988). cDNA cloning and gene characterization of the mitochondrial large subunit (LSU) rRNA from the liver ¯uke Fasciola hepatica. Evidence of heterogeneity in the ¯uke mitochondrial genome. Nucleic Acids Research 16, 7001±12. Itagaki, T., Tsutsumi, K.-I., Ito, K. & Tsutsumi, Y. (1998). Taxonomic status of the Japanese triploid forms of Fasciola: comparison of mitochondrial ND1 and COI sequences with F. hepatica and F. gigantica. Journal of Parasitology 84, 445±8. Itagaki, T., Tsutsumi, K.-I., Sakamoto, T., Tsutsumi, Y. & Itagaki, H. (1995). Characterization of genetic divergence among species within the genus Fasciola by PCR-SSCP. Japanese Journal of Parasitology 44, 244±7. Hashimoto, K., Watanobe, T., Liu, C. X., Init, I., Blair, D., Ohnishi, S. & Agatsuma, T. (1997). Mitochondrial DNA and nuclear DNA indicate that the Japanese Fasciola species is F. gigantica. Parasitology Research 83, 220±5. Blair, D. & McManus, D. P. (1989). Restriction enzyme mapping of ribosomal DNA can distinguish between fasciolid (liver ¯uke) species. Molecular and Biochemical Parasitology 36, 201±8. Adlard, R. D., Barker, S. C., Blair, D. & Cribb, T. H. (1993). Comparison of the second internal transcribed spacer (ribosomal DNA) from populations and species of Fasciolidae (Digenea). International Journal for Parasitology 23, 422±5.
A PCR-RFLP assay for Fasciola species 32. Itagaki, T. & Tsutsumi, K. (1998). Triploid form of Fasciola in Japan: genetic relationships between Fasciola hepatica and Fasciola gigantica determined by ITS-2 sequence of the nuclear rDNA. International Journal for Parasitology 28, 777±81.
333
33. Mas-Coma, S, Funatsu, I. R. & Bargues, M. D. (2001). Fasciola hepatica and lymnaeid snails occurring at very high altitude in South America. Parasitology 123, S115±27.