- Email: [email protected]
B protein from squid brain
Neuroscience Letters 696 (2019) 219–224
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
A phylogenetically conserved hnRNP type A/B protein from squid brain a,⁎
a
a
Gabriel Sarti Lopes , Diego Torrecillas Paula Lico , Rafael Silva-Rocha , Renata Rocha de Oliveirab, Adriano Sebollelac, Maria Luisa Paçó-Larsona, Roy Edward Larsona a b c
T
Dept. Cellular & Molecular Biology, Ribeirão Preto Medical School, University of São Paulo, 14049-900, Brazil National Laboratory of Biosciences (LNBio-CNPEM), Campinas, 13083-970, Brazil Dept. Biochemistry and Immunology, Ribeirão Preto Medical School, University of São Paulo, 14049-900, Brazil
ARTICLE INFO
ABSTRACT
Keywords: Squid hnRNP Nuclear localization sequence Cell stress granules Presynaptic terminal SH-SY5Y cells
Eukaryotic mRNA precursors are co-transcriptionally assembled into ribonucleoprotein complexes. Heterogeneous nuclear ribonucleoprotein (hnRNP) complexes are involved in mRNA translocation, stability, subcellular localization and regulation of mRNA translation. About 20 major classes of hnRNPs have been identified in mammals. In a previous work, we characterized a novel, strongly-basic, RNA-binding protein (p65) in presynaptic terminals of squid neurons presenting homology with human hnRNPA/B type proteins, likely involved in local mRNA processing. We have identified and sequenced two hnRNPA/B-like proteins associated with tissue purified squid p65: Protein 1 (36.3 kDa, IP 7.1) and Protein 2 (37.6 kDa, IP 8.9). In the present work we generated an in silico, tridimensional, structural model of squid hnRNPA/B-like Protein 2, which showed highly conserved secondary and tertiary structure of RNA recognition motifs with human hnRNPA1 protein, as well as illustrated the potential for squid Protein 2 stable homodimerization. This was supported by biophysical measurements of bacterially expressed, recombinant protein. In addition, we induced expression of squid hnRNPA/B-like Protein 2 in human neuroblastoma cells (SH-SY5Y) and observed an exclusively nuclear localization, which depended on an intact C-terminal amino acid sequence and which relocated to cytoplasm particles containing PABP when the cells were challenged with sorbitol, suggesting an involvement with stress granule function.
1. Introduction Regulated local mRNA translation is an important mechanism cells employ to target proteins to specific subcellular locations, enabling both rapid and site specific protein synthesis to occur [1]. RNA binding proteins (RBPs) have emerged as major components in the mechanisms of local regulation of RNA translation/protein synthesis [2]. RBPs regulate mRNA distribution and metabolism by forming RNA-protein complexes in RNA granules within which RNA is processed, translocated or occulted from translation [3]. hnRNPs form a diverse family of RNPs, which display multiple functions in mRNA processing, translocation and regulation [4]. Twenty major classes of hnRNP polypeptides, termed A1 to U, have been identified [5].
In a previous work from our group, Lico et al. [6,7] identified in the presynaptic terminals of squid neurons, a strongly basic protein of 65 kDa (p65) that was shown to be a member of the hnRNPA/B class. Members of this protein class bind to mRNA and participate in premRNA processing and exportation from the nucleus, besides having an important role in mRNA metabolism in the cytoplasm, and its translocation to specific subcellular regions [8]. Lico et al. [7] proposed that p65 is a SDS-stable, homo or heterodimer protein. Two hnRNPA/B-like proteins were identified associated with tissue purified squid p65: Protein 1 of 36.3 kDa and isoelectric point (IP) 7.1, and Protein 2 of 37.6 kDa (IP 8.9). Particularly, squid hnRNPA/B-like Protein 2 called our attention by being also a basic protein, as is p65 (IP˜9.3). Here we show that squid hnRNPA/B-like Protein 2 shares a high degree of
Abbreviations: BSA, bovine serum albumin; RBPs, RNA binding proteins; hnRNPs, heterogeneous nuclear ribonucleoproteins; mRNA, messenger RNA; IP, isoelectric point; PAGE, polyacrylamide gel electrophoresis; PBS, phosphate buffered saline; RNP, ribonucleoprotein; RNP1/RNP2, core sequences of RNA recognition motifs; SDS, sodium dodecyl sulfate; NeuN, neuronal nuclei protein; PABP, poly-A binding protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; BDNF, brainderived neurotrophic factor ⁎ Corresponding author. E-mail addresses: [email protected] (G.S. Lopes), [email protected] (D.T.P. Lico), [email protected] (R. Silva-Rocha), [email protected] (R.R. de Oliveira), [email protected] (A. Sebollela), [email protected] (M.L. Paçó-Larson), [email protected] (R.E. Larson). https://doi.org/10.1016/j.neulet.2019.01.002 Received 12 September 2018; Received in revised form 13 December 2018; Accepted 2 January 2019 Available online 02 January 2019 0304-3940/ © 2019 Elsevier B.V. All rights reserved.
Neuroscience Letters 696 (2019) 219–224
G.S. Lopes et al.
structural homology and cellular activity with human hnRNPA/B proteins. From crystallographic data of human hnRNPA1 [9] (PDB accession n° 1L3K), a tridimensional model of squid Protein 2 was generated in silico and used to illustrate the potential for its stable homodimerization. Dynamic light scattering and gel filtration chromatography of bacterially expressed squid hnRNPA/B-like Protein 2 indicate it has a higher hydrodynamic radius than its calculated molecular weight would suggest. We also produced expression constructs of squid hnRNPA/B-like Protein 2 for expression in human neuroblastoma cells (SH-SY5Y) to obtain clues of its cellular properties and functions. Our data revealed that squid hnRNPA/B-like Protein 2 shows an exclusively nuclear localization, dependent on a sequence in the CO terminal region, and is recruited to stress granules (SG) when cells are challenged by sorbitol osmotic stress.
conditioned medium used at the end of the differentiation process. 2.3. Induction of osmotic stress D-Sorbitol (Sigma) was diluted in standard growth medium to yield a 0.4 M concentration. After 1 h of incubation in this medium cells were fixed and processed for immunostaining.
2.4. Immunocytochemistry After 48 h post-transfection, cells were fixed and permeabilized in phosphate-buffered saline (PBS) containing 2% paraformaldehyde and 0.3% Triton X-100 for 20 min, then blocked with 2% Bovine Serum Albumin (BSA) in PBS for 1 h, washed 3x times with PBS, and incubated with 10 μg/ml monoclonal anti-PolyA-binding protein (anti-PABP) (Sigma-Aldrich, clone 10E10, n° P6246), diluted in PBS containing 1% BSA, for 2 h at room temperature in a humid chamber. Primary antibodies were visualized with secondary antibody conjugated with Alexa Fluor 594 (Molecular Probes, Invitrogen). Secondary antibody was incubated for 1 h diluted in PBS containing 1% BSA. Nuclei were detected using DAPI. Stained cells were examined using a confocal microscope TCS-SP5 (Leica Microsystems, Germany) or an inverted microscope LSM 780 AxioObserver (Carl Zeiss, Germany).
2. Material and methods 2.1. Expression plasmids Full-length squid hnRNPA/B-like Protein 2 and its truncated form lacking the last 53 amino acids of the C-terminal region were produced by PCR amplification from full-length cDNA using corresponding primers, cloned into pGEM-T Easy vector (Promega Corporation, Wisconsin, USA), and subcloned into the pEGFP-C1 vector (Clontech) for expression in mammalian cells. The squid hnRNPA/B-like Protein 2 transcript was amplified using the forward and reverse primers, respectively: 5`–ATGAATTCTATGCCCGAAAGGTAC–3` and 5`–ATGGGC CCTTACCGTCTGTAACCGCC–3`.The truncated squid hnRNPA/B-like Protein 2 was amplified using the forward and reverse primers: 5`– ATGAATTCTATGCCCGAAAGGTAC– 3` and 5`–ATGGGCCCTTAATCAT TAAAGTCACC–3`. EcoRI and ApaI restriction sites are underlined. The complementary stop codon for the C-terminus is shown in bold. DNA was sequenced using the Big Dye Terminator Cycle Sequencing Ready Reaction (Applied Biosystems, Foster City, CA, USA) on a ABI 3100 sequence analyzer. Affinity purified squid hnRNPA/B-like Protein 2 in fusion with a 6xHis tag was expressed in bacteria and purified as described [7].
2.5. Western blotting SDS-PAGE was performed on 10% minigels. After electrophoresis, proteins were transferred to nitrocellulose membranes. Primary antibodies used were monoclonal anti-Neuron Specific Nuclear protein (Anti-NeuN) (Millipore, MAB377, clone A60), and polyclonal antiGAPDH (Sigma-Aldrich St. Louis, MO, USA). Membrane was developed using ECL™ Western Blot Detection Reagent (GE Healthcare, RNP2209) following manufacturer`s instructions. 3. Results 3.1. Squid hnRNPA/B-like Proteins 1 and 2 show a high degree of structural homology with human hnRNPA1 and hnRNPA2/B1
2.2. Cell culture, differentiation and transfection
RNA-binding proteins of the hnRNPA/B class are characterized by a phylogenetically conserved linear organization of structural and functional domains, which include two RNA Recognition Motifs (RRMs) at the N-terminus. Each of these RRMs presents a RNP2 motif containing the core consensus sequence LFIGGL, and a RNP1 consensus sequence RGFGFITY [11]. The C-terminal region is intrinsically disordered, rich in glycine and contains RGG triplets that are also sites for protein and RNA interactions [11]. The alignment of squid hnRNPA/B-like Proteins 1 and 2 with human hnRNPA/B revealed a high degree of primary sequence identity and chemical homology (Fig. 1). The squid paralogs, Proteins 1 and 2, share 51% amino acid identity, and 65% chemical homology between themselves [7], while squid Proteins 1 and 2 show 47% and 45% residue identity and 65% and 61% chemical homology with human hnRNPA1 and hnRNPA2/B1, respectively. The sequence alignment also revealed the conserved domain framework and spatial assembly of these proteins, including the tandem RRMs and the glycine rich region containing the RGG box. Molecular characteristics of each of these proteins are shown in Supp. Table 1. Human hnRNPA/B proteins have a specific sequence at the Cterminal region named the M9 domain [12], or nuclear targeting sequence [13] (shown in bold letters in Fig. 1), which correspond to a non-canonical signal for nuclear localization, responsible for the shuttling of these proteins between nucleus and cytoplasm. Homologous sequences are found in the C-terminal region of squid Proteins 1 and 2 that show 39–41% identity with the human proteins, thus suggesting that these corresponding regions in the squid proteins could also represent non-canonical nuclear localization signals. We tested this
SH-SY5Y neuroblastoma cell line was grown in Dulbecco’s modified Eagle’s medium (DMEM) high glucose (Sigma-Aldrich St. Louis, MO, USA) supplemented with penicillin (100 units/ml), streptomycin (100 μg/ml), and 10% (vol/vol) heat-inactivated fetal bovine serum (FBS) (GIBCO, Gaithersburg, MD, USA). Cells were maintained at 37 °C in a saturated humidity atmosphere containing 95% air and 5% CO2. SH-SY5Y cells were differentiated into neuronal phenotype using the procedures described in Encinas et al. [10], with the following modifications: cells were seeded at an initial density of 3 × 104 cells/ cm² on 13 mm2 glass slides previously coated with 0.1 mg/ml poly-Dlysine hydrobromide (Sigma-Aldrich St. Louis, MO, USA). Retinoic acid (Alltrans-RA, AbCam) was added the day after plating at a final concentration of 10 μM in DMEM containing 1% FBS. After 3–4 days in the presence of RA, the medium was replaced by DMEM containing 1% FBS, 10 μM Alltrans-RA and 50 ng/ml Brain Derived Neurotrophic Factor (BDNF) (Sigma-Aldrich) and culture was kept for additional 3–4 days. For non-differentiated SH-SY5Y cells transfection, 9 × 104 cells/ cm2 were plated on 13 mm2 glass slides, in a 24 well plate. The next day, cells were transfected for 3 h using 0.5 μg per well of pEGFP-C1 vector, containing or not the DNA constructs, and 1 μl lipofectamine 2000 (Invitrogen, Life Technologies, Grand Island, NY, USA) diluted in DMEM. After incubation, the medium was replaced by DMEM supplemented with penicillin (100 units/ml), streptomycin (100 mg/ml), and 10% FBS. Transfection of differentiated cells was done the same way, except that after 3 h of transfection the medium was replaced by the 220
Neuroscience Letters 696 (2019) 219–224
G.S. Lopes et al.
Fig. 1. Alignment of squid hnRNPA/B-like Proteins 1 and 2 translated ORFs with canonical human hnRNPA1 and hnRNPA2B1 amino acid sequences. The hnRNPA1 represented here is isoform B, which includes the insert from amino acid 252 to 303, while hnRNPA2/B1 is the isoform that includes amino acids 3 to 14. Clustal W program was used to align the sequences. Asterisks indicate amino acid identity; double dots indicate strong chemical homology (scoring > 0.5 in the Gonnet PAM 250 matrix) [22]; single dots indicate weakly similar properties (scoring = < 0.5 > 0). The boxed areas indicate the core sequences for the two RNA recognition motifs (RRMs), RNP2 and RNP1, as indicated. RGG triplets making up the RGG boxes are underlined. The M9 and NTS sequences in the human proteins are in bold.
hypothesis below.
2 homodimer is shown in Fig. 2D in which the interaction between the monomers occurs at the N-terminal compact globular region, while the unstructured C-terminal region is in an extended flexible chain. To obtain biochemical evidence for the proposed structural model, we expressed recombinant squid hnRNPA/B-like Protein 2 in bacteria as a fusion protein with a 6xHis tag (rP2) and investigated its biochemical properties. The affinity purified rP2 showed a single band in SDS-PAGE [7] as expected for a fully denatured 40 kDa polypeptide (37.6 kDa from Protein 2 plus 2.4 kDa from the 6XHis tag). In non-denaturing aqueous solution, however, rP2 was quite insoluble, except in the presence of 2 M urea, which was thus maintained in all rP2 solutions for the following studies. The molecular mass and shape of rP2 in solution were investigated by gel filtration chromatography (Fig. 2G) and Dynamic Light Scattering (Fig. 2H). Data were compared with results obtained using the 41 kDa globular protein adenosine kinase, under the same experimental conditions. The observed hydrodynamic molecular radius of rP2 from both measurements were at least twice that of adenosine kinase, thus consistent with the notion that rP2 forms a homodimer in aqueous solution.
3.2. Structural model of squid hnRNPA/B-like Protein 2 To evaluate secondary and tertiary structure, a three-dimensional model of the squid hnRNPA/B-like Protein 2 N-terminal region was made in silico using the N-terminal region of human hnRNPA1 determined by crystallography [9] (PDB # 1L3K) as a template (Fig. 2). Note that the C-terminal half of squid hnRNPA/B-like Protein 2, as in the human protein, is intrinsically disordered, hence not represented in this model (see Krebs and DeMesquita [14], for an in silico model of the CO-terminal domain of hnRNPA1). Superposition of the template with the generated model showed a high degree of conservation of both secondary and tertiary structures (Fig. 2A), having an atomic root mean square deviation of 0.275 angstroms. The two RRM domains give rise to two anti-parallel beta sheets each with a nested pair of perpendicularly oriented alpha helices. The RRM domains are linked by a loop, such that the beta sheets are oriented toward the surface to form the sites for interaction with RNA (Fig. 2B). Using GRAMM-X, protein docking software, we investigated whether two monomers of squid hnRNPA/B-like Protein 2 could form a stable homodimer, as previously proposed [7]. Fig. 2C shows a docked model with a best fit to a homodimer stabilized by hydrogen and electrostatic bonds. Using Gromacs-3.2.1 [15], the stability of squid hnRNPA/B-like Protein 2 homodimer was evaluated by simulating its behavior in an aqueous environment. The homodimer showed stability after 1 ns of simulation (Fig. 2E). Through molecular dynamics analysis, it was possible to observe that the ends of the dimer model have greater root mean square fluctuations indicating greater mobility in aqueous solution (Fig. 2F). The central region of the model, responsible for the interaction between monomers, presents low fluctuation indicating high stability. A cartoon of a putative squid hnRNPA/B-like Protein
3.3. Full-length squid hnRNPA/B-like Protein 2 expressed in SH-SY5Y cells is exclusively nuclear, whereas truncated Protein 2 co-localizes to cytoplasmic PABP containing granules In order to evaluate the subcellular localization of squid hnRNPA/Blike Protein 2 in neuronal-like cells, we expressed the recombinant GFPconjugated protein GFP-rP2 in cultured SH-SY5Y human neuroblastoma cells, a cell line prone to assume a neuronal phenotype upon differentiation in culture, characterized by neurite extension and elongated nuclei (Supp. Fig. 1A), as well as up-regulation of NeuN protein (Supp. Fig. 1B,C) [10]. SH-SY5Y cells were transfected with pEGFP-C1 vector containing the open reading frame that encodes for squid hnRNPA/B221
Neuroscience Letters 696 (2019) 219–224
G.S. Lopes et al.
Fig. 2. Tridimensional structural model of the amino terminal half of squid hnRNPA/B-like Protein 2. The crystallographic structure of the N-terminal domain of human hnRNPA1, accession n° 1L3K [9], was used as a template to generate a tridimensional model of amino acids 1–200 of the squid hnRNPA/B-like Protein 2, using the Modeller software. Being intrinsically unstructured, the C-terminal half of the molecule is not represented here. A) The overlay of the template (red) and model (yellow) shows very close correspondence between the structures, giving an atomic root mean square deviation of 0.279 angstroms using the Chimera v1.10.2 software. The N-terminal (NH) and the C-terminal (CO) of this model are indicated. Two views are given at 180° rotation around the horizontal axis. B) The squid Protein 2 model is given by itself to illustrate the orientation of the two RRMs in the structure, each composed of two perpendicularly oriented alpha helices (red), nested with a four-stranded beta-sheet (yellow) that make up the RNA contact surfaces. Two views are given at 180° rotation around the horizontal axis. C) A stable homodimer of the structured N-terminal domain of hnRNPA/B-like Protein 2 is presented, predicted by application of the GRAMM-X Protein Docking Server (GXPDS, online) to form by strong hydrogen and electrostatic bonding resulting in pseudo symmetry around the contact surface (white dashed line). RRM 1 is represented in yellow and RRM2 in green. Two views are given at 180° rotation around the horizontal axis. D) A cartoon rendition of the hypothesized complete dimer is given to illustrate the relation of the globular N-terminal domains to the unstructured and possibly extended C-terminal domain (CO). E) The Root Mean Square Deviation (RMSD) in nanoseconds of squid hnRNPA/B-like Protein 2 homodimer was determined by simulation of its behavior in an aqueous environment using Gromacs-3.2.1. F) The atomic Root Mean Square Fluctuation (RMSF) is plotted for each residue of each monomer when RMSD attained maximum stability. G) The profile of elution of recombinant Protein 2 (rP2,1.4 mg/ml) compared to adenosine kinase (ADK, 1,4 mg/ml) on a calibrated Superdex 200 10/300 G l column gave estimates of their molecular mass (kDa). The first peak eluted is rP2 and the second is ADK. The molecular radii (r.nm) and estimated molecular mass are given in the insert. H) Dynamic Light Scattering (DLS) of rP2 and ADK in the same buffer was performed on a Malvern Zetasizer apparatus. Overlapped ZetaSizer DLS of the rP2 and ADK showed an average hydrodynamic diameter of the 5,0 ± 1,6 nm and 3,2 ± 0,9 nm and polydispersity of 28% and 254% at 20° respectively. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
like Protein 2 (GFP-rP2) (Fig. 3). Remarkably the full-length GFP-rP2 showed an exclusively nuclear localization in both non-differentiated (Fig. 3B) and differentiated cells (Supp. Fig. 2B). To evaluate if the corresponding M9/NTS region of squid hnRNPA/ B-like Protein 2 has a role in its cellular distribution, we induced the expression of a GFP-tagged truncated form of squid Protein 2 lacking the last 53 amino acid residues from the C-terminal (GFP-rP21-296).
Interestingly, the truncated squid hnRNPA/B-like Protein 2 was also found in the cytoplasm, where it concentrated in aggregates, many of which also contained poly-A binding protein (PABP) (Fig. 3C and Supp. Fig. 2C) an indicator of SGs.
222
Neuroscience Letters 696 (2019) 219–224
G.S. Lopes et al.
Fig. 3. Subcellular localization of full-length and truncated forms of squid hnRNPA/B-like Protein 2 in human SH-SY5Y cells submitted or not to hyperosmotic stress. Non-differentiated cells expressing GFP alone (A), or GFP fused to full length squid hnRNPA/B-like Protein 2 (GFP-rP2) (B), or its truncated form lacking 53 amino acids of the C-terminal region (GFP-rP21-296) (C). In (D), cells expressing full length GFP-rP2 and osmotically stressed by 0,4 M sorbitol for 1 h. Cells were immunolabeled for PABP (red). Nuclei were stained with DAPI (blue). GFP and conjugates are rendered green. Scale bars, 10 μm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
3.4. Full-length squid hnRNPA/B-like Protein 2 relocates to SG in SH-SY5Y cells submitted to osmotic stress
may be involved in stress response, SH-SY5Y cells expressing GFP-rP2 were treated with 400 mM D-Sorbitol for one hour. The results show that in cells submitted to osmotic stress, part of GFP-rP2 accumulated in cytoplasmic foci that co-localize with PABP granules (Fig. 3D), different
To investigate the hypothesis that squid hnRNPA/B-like Protein 2 223
Neuroscience Letters 696 (2019) 219–224
G.S. Lopes et al.
than the control where GFP-rP2 was exclusively located in the nucleus (Fig. 3B).
We also thanks Center for Research in Energy and Materials (CNPEM) and the Biosciences National Laboratory (LNBio) at for provision of time in the LPP facilities. Authors declare no competing financial interests.
4. Discussion P65 represents a specific hnRNPA/B type member at the pre-synaptic site of squid neurons. We have proposed p65 to be an SDS-stable dimer composed of ∼37-kDa hnRNPA/B-like subunits. Here, we showed a structural model of squid hnRNPA/B-like Protein 2 (37.6 kDa) that provides support of the formation of a stable homodimer, based on the low flexibility and movement during RMSF and RMSD analysis. Dynamic light scattering (DLS) and gel filtration chromatography of the recombinant squid hnRNPA/B-like Protein 2 also suggest a propensity of squid Protein 2 to dimerize in aqueous solution. An understanding of biochemical mechanisms involved in the formation and stability of the dimeric form may bring insights into the cytoplasmic inclusion body formation of hnRNP complexes, which is a hallmark of several neurodegenerative diseases. One feature of human hnRNPA/B type proteins is the shuttling from nucleus to cytoplasm. The M9 sequence found in human hnRNPA1 proteins functions as a signal for nuclear/cytoplasm exchange [13,16]. When we expressed truncated rP2 fused to GFP (GFP-rP2aa1-296), in which the region corresponding to M9 is lacking, the localization of rP2 is no longer exclusively nuclear (Fig. 3C), indicating that the lack of this region disturbs nuclear localization of squid hnRNPA/B-like Protein 2. Similarly, human hnRNPA1 protein lacking M9 sequence is also found in the cytoplasm of transfected HeLa cells [17]. Indeed the activity of shuttling from nucleus to cytoplasm of hnRNPA/B family of proteins seems to be functionally relevant to squid hnRNPA/B-like Protein 2, considering the observation that under osmotic stress GFP-rP2 relocates from the nuclei into cytoplasmic SGs (Fig. 3D), as occurs with human hnRNPA1 [18]. Moreover, the mobilization of PABP to cytoplasmic granules containing truncated rP2, in neuroblastoma SH-SY5Y cells maintained under normal physiological conditions, suggests that squid hnRNPA/B-like Protein 2 may have regions of interaction with nucleating proteins of SGs. Interestingly, Drosophila ortholog of human hnRNP A1/A2 proteins (Hrb98DE/ Hrp38) maintains the ability of these proteins to bind to TDP-43 [19], a component of SG which is required for its efficient dynamics in neurodegenerative disease-relevant cell type [20], and also to form RNA granules in dendritic arbors of neurons [21]. In summary, the molecular structure and similarity in cellular location and stress response between the squid and human proteins support the notion that the functions of the hnRNPA/B family are phylogenetically highly conserved. These data in connection with the synaptic location of squid hnRNPA/B-like Protein 2 may offer insight into the role of this class of RNA binding proteins in human neurodegenerative diseases.
Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.neulet.2019.01.002. References [1] J.R. Buchan, mRNP granules. Assembly, function, and connections with disease, RNA Biol. 11 (8) (2014) 1019–1030. [2] L. Liu-Yesucevitz, G.J. Bassel, A.D. Gitler, A.C. Hart, E. Klann, J.D. Richter, S.T. Warren, B. Wolozin, Local RNA translation at the synapse and in disease, J. Neurosci. 31 (45) (2011) 16086–16093. [3] M.G. Thomas, M. Loschi, M.A. Desbats, G.L. Boccaccio, RNA granules: the good, the bad and the ugly, Cell. Signal. 23 (2) (2011) 324–334. [4] J. Jean-Philippe, S. Paz, M. Caputi, hnRNP A1: The Swiss Army Knife of gene expression, Int. J. Mol. Sci. 14 (9) (2013) 18999–19024. [5] Y.D. Choi, G. Dreyfuss, Isolation of the heterogeneous nuclear RNA-ribonucleoprotein complex (hnRNP): a unique supramolecular assembly, Proc. Natl. Acad. Sci. U. S. A. 81 (23) (1984) 7471–7475. [6] D.T. Lico, J.C. Rosa, J.A. DeGiorgis, E.J. de Vasconcelos, L. Casaletti, S.B. Tauhata, M.M. Baqui, M. Fukuda, J.E. Moreira, R.E. Larson, A novel 65 kDa RNA-binding protein in squid presynaptic terminals, Neuroscience 166 (1) (2010) 73–83. [7] D.T. Lico, G.S. Lopes, J. Brusco, J.C. Rosa, R.M. Gould, J.A. De Giorgis, R.E. Larson, A novel SDS-stable dimer of a heterogeneous nuclear ribonucleoprotein at presynaptic terminals of squid neurons, Neuroscience. 300 (2015) 381–392. [8] G. Dreyfuss, V.N. Kim, N. Kataoka, Messenger-RNA-binding proteins and the messages they carry, Nat. Rev. Mol. Cell Biol. 3 (3) (2002) 195–205. [9] J. Vitali, J. Ding, J. Jiang, Y. Zhang, A.R. Krainer, R.M. Xu, Correlated alternative side chain conformations in the RNA-recognition motif of heterogeneous nuclear ribonucleoprotein A1, Nucleic Acids Res. 30 (7) (2002) 1531–1538. [10] M. Encinas, M. Iglesias, Y. Liu, H. Wang, A. Muhaisen, V. Ceña, C. Gallego, J.X. Comella, Sequential treatment of SH-SY5Y cells with retinoic acid and brainderived neurotrophic factor gives rise to fully differentiated, neurotrophic factordependent, human neuron-like cells, J. Neurochem. 75 (3) (2000) 991–1003. [11] C. Maris, C. Dominguez, F.H. Allain, The RNA recognition motif, a plastic RNAbinding platform to regulate post-transcriptional gene expression, FEBS J. 272 (9) (2005) 2118–2131. [12] H. Siomi, G. Dreyfuss, A nuclear localization domain in the hnRNP A1 protein, J. Cell Biol. 129 (3) (1995) 551–560. [13] W.M. Michael, M. Choi, G. Dreyfuss, A nuclear export signal in hnRNP A1: a signalmediated, temperature-dependent nuclear protein export pathway, Cell. 83 (3) (1995) 415–422. [14] B.B. Krebs, J.F. De Mesquita, Amyotrophic lateral sclerosis type 20 - in silico. Analysis and molecular dynamics simulation of hnRNPA1, PLoS One 11 (7) (2016) e0158939. [15] E. Lindahl, B. Hess, D. van der Spoel, GROMACS 3.0: a package for molecular simulation and trajectory analysis, J. Mol. Model. 7 (2001) 306–317. [16] M.C. Siomi, P.S. Eder, N. Kataoka, L. Wan, Q. Liu, G. Dreyfuss, Transportin-mediated nuclear import of heterogeneous nuclear RNP proteins, J. Cell Biol. 138 (6) (1997) 1181–1192. [17] H. Kooshapur, N.R. Choudhury, B. Simon, M. Muhlbauer, A. Jussupow, N. Fernandez, A.N. Jones, A. Dallmann, F. Gabel, C. Camilloni, G. Michlewski, J.F. Cáceres, M. Sattler, Structural basis for terminal loop recognition and stimulation of pri-miRNA-18a processing by hnRNPA1, Nat. Commun. 9 (1) (2018) 2479 26. [18] S. Guil, J.C. Long, J.F. Cáceres, hnRNPA1 relocalization to the stress granules reflects a role in the stress response, Mol. Cell. Biol. 26 (15) (2006) 5744–5758. [19] M. Romano, E. Buratti, G. Romano, R. Klima, L. Belluz, C. Stuani, F. Baralle, F. Feiguin, Evolutionarily conserved heterogeneous nuclear ribonucleoprotein (hnRNP) A/B proteins functionally interact with human and drosophila TAR DNAbinding protein 43 (TDP-43), J. Biol. Chem. 28 (10) (2014) 7121–7130. [20] Y. Khalfallah, R. Kuta, C. Grasmuck, A. Prat, H.D. Durham, C.V. Velde, TDP-43 regulation of stress granule dynamics in neurodegenerative disease-relevant cell types, Sci. Rep. 8 (2018) 7551. [21] L. Liu-Yesucevitz, A.Y. Lin, A. Ebata, J.Y. Boon, W. Reid, Y. Xu, K. Kobrin, G.J. Murphy, L. Petrucelli, B. Wolozin, ALS-linked mutations enlarge TDP-43-enriched neuronal RNA granules in the dendritic arbor, J. Neurosci. 34 (12) (2014) 4167–4174. [22] P. Gonnet, F. Lisacek, Probabilistic alignment of motifs with sequences, Bioinformatics 18 (8) (2002) 1091–1101.
Acknowledgements Research was supported by grants to REL from the Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and Fundação de Apoio ao Ensino, Pesquisa e Assistência do Hospital das Clínicas da FMRP-USP (FAEPA). GSL and DTPL received research fellowships from CNPq and FAPESP, respectively. REL and MLPL received the Productivity-in-Research fellowship from CNPq. Thanks to Silvia Andrade for expert technical help, and M.Sc Elizabete R. Milani for technical help with confocal microscopy, performed at Laboratório Multiusuário de Microscopia Confocal - LMMC, Fapesp 2004/08868-0.
224
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
A phylogenetically conserved hnRNP type A/B protein from squid brain a,⁎
a
a
Gabriel Sarti Lopes , Diego Torrecillas Paula Lico , Rafael Silva-Rocha , Renata Rocha de Oliveirab, Adriano Sebollelac, Maria Luisa Paçó-Larsona, Roy Edward Larsona a b c
T
Dept. Cellular & Molecular Biology, Ribeirão Preto Medical School, University of São Paulo, 14049-900, Brazil National Laboratory of Biosciences (LNBio-CNPEM), Campinas, 13083-970, Brazil Dept. Biochemistry and Immunology, Ribeirão Preto Medical School, University of São Paulo, 14049-900, Brazil
ARTICLE INFO
ABSTRACT
Keywords: Squid hnRNP Nuclear localization sequence Cell stress granules Presynaptic terminal SH-SY5Y cells
Eukaryotic mRNA precursors are co-transcriptionally assembled into ribonucleoprotein complexes. Heterogeneous nuclear ribonucleoprotein (hnRNP) complexes are involved in mRNA translocation, stability, subcellular localization and regulation of mRNA translation. About 20 major classes of hnRNPs have been identified in mammals. In a previous work, we characterized a novel, strongly-basic, RNA-binding protein (p65) in presynaptic terminals of squid neurons presenting homology with human hnRNPA/B type proteins, likely involved in local mRNA processing. We have identified and sequenced two hnRNPA/B-like proteins associated with tissue purified squid p65: Protein 1 (36.3 kDa, IP 7.1) and Protein 2 (37.6 kDa, IP 8.9). In the present work we generated an in silico, tridimensional, structural model of squid hnRNPA/B-like Protein 2, which showed highly conserved secondary and tertiary structure of RNA recognition motifs with human hnRNPA1 protein, as well as illustrated the potential for squid Protein 2 stable homodimerization. This was supported by biophysical measurements of bacterially expressed, recombinant protein. In addition, we induced expression of squid hnRNPA/B-like Protein 2 in human neuroblastoma cells (SH-SY5Y) and observed an exclusively nuclear localization, which depended on an intact C-terminal amino acid sequence and which relocated to cytoplasm particles containing PABP when the cells were challenged with sorbitol, suggesting an involvement with stress granule function.
1. Introduction Regulated local mRNA translation is an important mechanism cells employ to target proteins to specific subcellular locations, enabling both rapid and site specific protein synthesis to occur [1]. RNA binding proteins (RBPs) have emerged as major components in the mechanisms of local regulation of RNA translation/protein synthesis [2]. RBPs regulate mRNA distribution and metabolism by forming RNA-protein complexes in RNA granules within which RNA is processed, translocated or occulted from translation [3]. hnRNPs form a diverse family of RNPs, which display multiple functions in mRNA processing, translocation and regulation [4]. Twenty major classes of hnRNP polypeptides, termed A1 to U, have been identified [5].
In a previous work from our group, Lico et al. [6,7] identified in the presynaptic terminals of squid neurons, a strongly basic protein of 65 kDa (p65) that was shown to be a member of the hnRNPA/B class. Members of this protein class bind to mRNA and participate in premRNA processing and exportation from the nucleus, besides having an important role in mRNA metabolism in the cytoplasm, and its translocation to specific subcellular regions [8]. Lico et al. [7] proposed that p65 is a SDS-stable, homo or heterodimer protein. Two hnRNPA/B-like proteins were identified associated with tissue purified squid p65: Protein 1 of 36.3 kDa and isoelectric point (IP) 7.1, and Protein 2 of 37.6 kDa (IP 8.9). Particularly, squid hnRNPA/B-like Protein 2 called our attention by being also a basic protein, as is p65 (IP˜9.3). Here we show that squid hnRNPA/B-like Protein 2 shares a high degree of
Abbreviations: BSA, bovine serum albumin; RBPs, RNA binding proteins; hnRNPs, heterogeneous nuclear ribonucleoproteins; mRNA, messenger RNA; IP, isoelectric point; PAGE, polyacrylamide gel electrophoresis; PBS, phosphate buffered saline; RNP, ribonucleoprotein; RNP1/RNP2, core sequences of RNA recognition motifs; SDS, sodium dodecyl sulfate; NeuN, neuronal nuclei protein; PABP, poly-A binding protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; BDNF, brainderived neurotrophic factor ⁎ Corresponding author. E-mail addresses: [email protected] (G.S. Lopes), [email protected] (D.T.P. Lico), [email protected] (R. Silva-Rocha), [email protected] (R.R. de Oliveira), [email protected] (A. Sebollela), [email protected] (M.L. Paçó-Larson), [email protected] (R.E. Larson). https://doi.org/10.1016/j.neulet.2019.01.002 Received 12 September 2018; Received in revised form 13 December 2018; Accepted 2 January 2019 Available online 02 January 2019 0304-3940/ © 2019 Elsevier B.V. All rights reserved.
Neuroscience Letters 696 (2019) 219–224
G.S. Lopes et al.
structural homology and cellular activity with human hnRNPA/B proteins. From crystallographic data of human hnRNPA1 [9] (PDB accession n° 1L3K), a tridimensional model of squid Protein 2 was generated in silico and used to illustrate the potential for its stable homodimerization. Dynamic light scattering and gel filtration chromatography of bacterially expressed squid hnRNPA/B-like Protein 2 indicate it has a higher hydrodynamic radius than its calculated molecular weight would suggest. We also produced expression constructs of squid hnRNPA/B-like Protein 2 for expression in human neuroblastoma cells (SH-SY5Y) to obtain clues of its cellular properties and functions. Our data revealed that squid hnRNPA/B-like Protein 2 shows an exclusively nuclear localization, dependent on a sequence in the CO terminal region, and is recruited to stress granules (SG) when cells are challenged by sorbitol osmotic stress.
conditioned medium used at the end of the differentiation process. 2.3. Induction of osmotic stress D-Sorbitol (Sigma) was diluted in standard growth medium to yield a 0.4 M concentration. After 1 h of incubation in this medium cells were fixed and processed for immunostaining.
2.4. Immunocytochemistry After 48 h post-transfection, cells were fixed and permeabilized in phosphate-buffered saline (PBS) containing 2% paraformaldehyde and 0.3% Triton X-100 for 20 min, then blocked with 2% Bovine Serum Albumin (BSA) in PBS for 1 h, washed 3x times with PBS, and incubated with 10 μg/ml monoclonal anti-PolyA-binding protein (anti-PABP) (Sigma-Aldrich, clone 10E10, n° P6246), diluted in PBS containing 1% BSA, for 2 h at room temperature in a humid chamber. Primary antibodies were visualized with secondary antibody conjugated with Alexa Fluor 594 (Molecular Probes, Invitrogen). Secondary antibody was incubated for 1 h diluted in PBS containing 1% BSA. Nuclei were detected using DAPI. Stained cells were examined using a confocal microscope TCS-SP5 (Leica Microsystems, Germany) or an inverted microscope LSM 780 AxioObserver (Carl Zeiss, Germany).
2. Material and methods 2.1. Expression plasmids Full-length squid hnRNPA/B-like Protein 2 and its truncated form lacking the last 53 amino acids of the C-terminal region were produced by PCR amplification from full-length cDNA using corresponding primers, cloned into pGEM-T Easy vector (Promega Corporation, Wisconsin, USA), and subcloned into the pEGFP-C1 vector (Clontech) for expression in mammalian cells. The squid hnRNPA/B-like Protein 2 transcript was amplified using the forward and reverse primers, respectively: 5`–ATGAATTCTATGCCCGAAAGGTAC–3` and 5`–ATGGGC CCTTACCGTCTGTAACCGCC–3`.The truncated squid hnRNPA/B-like Protein 2 was amplified using the forward and reverse primers: 5`– ATGAATTCTATGCCCGAAAGGTAC– 3` and 5`–ATGGGCCCTTAATCAT TAAAGTCACC–3`. EcoRI and ApaI restriction sites are underlined. The complementary stop codon for the C-terminus is shown in bold. DNA was sequenced using the Big Dye Terminator Cycle Sequencing Ready Reaction (Applied Biosystems, Foster City, CA, USA) on a ABI 3100 sequence analyzer. Affinity purified squid hnRNPA/B-like Protein 2 in fusion with a 6xHis tag was expressed in bacteria and purified as described [7].
2.5. Western blotting SDS-PAGE was performed on 10% minigels. After electrophoresis, proteins were transferred to nitrocellulose membranes. Primary antibodies used were monoclonal anti-Neuron Specific Nuclear protein (Anti-NeuN) (Millipore, MAB377, clone A60), and polyclonal antiGAPDH (Sigma-Aldrich St. Louis, MO, USA). Membrane was developed using ECL™ Western Blot Detection Reagent (GE Healthcare, RNP2209) following manufacturer`s instructions. 3. Results 3.1. Squid hnRNPA/B-like Proteins 1 and 2 show a high degree of structural homology with human hnRNPA1 and hnRNPA2/B1
2.2. Cell culture, differentiation and transfection
RNA-binding proteins of the hnRNPA/B class are characterized by a phylogenetically conserved linear organization of structural and functional domains, which include two RNA Recognition Motifs (RRMs) at the N-terminus. Each of these RRMs presents a RNP2 motif containing the core consensus sequence LFIGGL, and a RNP1 consensus sequence RGFGFITY [11]. The C-terminal region is intrinsically disordered, rich in glycine and contains RGG triplets that are also sites for protein and RNA interactions [11]. The alignment of squid hnRNPA/B-like Proteins 1 and 2 with human hnRNPA/B revealed a high degree of primary sequence identity and chemical homology (Fig. 1). The squid paralogs, Proteins 1 and 2, share 51% amino acid identity, and 65% chemical homology between themselves [7], while squid Proteins 1 and 2 show 47% and 45% residue identity and 65% and 61% chemical homology with human hnRNPA1 and hnRNPA2/B1, respectively. The sequence alignment also revealed the conserved domain framework and spatial assembly of these proteins, including the tandem RRMs and the glycine rich region containing the RGG box. Molecular characteristics of each of these proteins are shown in Supp. Table 1. Human hnRNPA/B proteins have a specific sequence at the Cterminal region named the M9 domain [12], or nuclear targeting sequence [13] (shown in bold letters in Fig. 1), which correspond to a non-canonical signal for nuclear localization, responsible for the shuttling of these proteins between nucleus and cytoplasm. Homologous sequences are found in the C-terminal region of squid Proteins 1 and 2 that show 39–41% identity with the human proteins, thus suggesting that these corresponding regions in the squid proteins could also represent non-canonical nuclear localization signals. We tested this
SH-SY5Y neuroblastoma cell line was grown in Dulbecco’s modified Eagle’s medium (DMEM) high glucose (Sigma-Aldrich St. Louis, MO, USA) supplemented with penicillin (100 units/ml), streptomycin (100 μg/ml), and 10% (vol/vol) heat-inactivated fetal bovine serum (FBS) (GIBCO, Gaithersburg, MD, USA). Cells were maintained at 37 °C in a saturated humidity atmosphere containing 95% air and 5% CO2. SH-SY5Y cells were differentiated into neuronal phenotype using the procedures described in Encinas et al. [10], with the following modifications: cells were seeded at an initial density of 3 × 104 cells/ cm² on 13 mm2 glass slides previously coated with 0.1 mg/ml poly-Dlysine hydrobromide (Sigma-Aldrich St. Louis, MO, USA). Retinoic acid (Alltrans-RA, AbCam) was added the day after plating at a final concentration of 10 μM in DMEM containing 1% FBS. After 3–4 days in the presence of RA, the medium was replaced by DMEM containing 1% FBS, 10 μM Alltrans-RA and 50 ng/ml Brain Derived Neurotrophic Factor (BDNF) (Sigma-Aldrich) and culture was kept for additional 3–4 days. For non-differentiated SH-SY5Y cells transfection, 9 × 104 cells/ cm2 were plated on 13 mm2 glass slides, in a 24 well plate. The next day, cells were transfected for 3 h using 0.5 μg per well of pEGFP-C1 vector, containing or not the DNA constructs, and 1 μl lipofectamine 2000 (Invitrogen, Life Technologies, Grand Island, NY, USA) diluted in DMEM. After incubation, the medium was replaced by DMEM supplemented with penicillin (100 units/ml), streptomycin (100 mg/ml), and 10% FBS. Transfection of differentiated cells was done the same way, except that after 3 h of transfection the medium was replaced by the 220
Neuroscience Letters 696 (2019) 219–224
G.S. Lopes et al.
Fig. 1. Alignment of squid hnRNPA/B-like Proteins 1 and 2 translated ORFs with canonical human hnRNPA1 and hnRNPA2B1 amino acid sequences. The hnRNPA1 represented here is isoform B, which includes the insert from amino acid 252 to 303, while hnRNPA2/B1 is the isoform that includes amino acids 3 to 14. Clustal W program was used to align the sequences. Asterisks indicate amino acid identity; double dots indicate strong chemical homology (scoring > 0.5 in the Gonnet PAM 250 matrix) [22]; single dots indicate weakly similar properties (scoring = < 0.5 > 0). The boxed areas indicate the core sequences for the two RNA recognition motifs (RRMs), RNP2 and RNP1, as indicated. RGG triplets making up the RGG boxes are underlined. The M9 and NTS sequences in the human proteins are in bold.
hypothesis below.
2 homodimer is shown in Fig. 2D in which the interaction between the monomers occurs at the N-terminal compact globular region, while the unstructured C-terminal region is in an extended flexible chain. To obtain biochemical evidence for the proposed structural model, we expressed recombinant squid hnRNPA/B-like Protein 2 in bacteria as a fusion protein with a 6xHis tag (rP2) and investigated its biochemical properties. The affinity purified rP2 showed a single band in SDS-PAGE [7] as expected for a fully denatured 40 kDa polypeptide (37.6 kDa from Protein 2 plus 2.4 kDa from the 6XHis tag). In non-denaturing aqueous solution, however, rP2 was quite insoluble, except in the presence of 2 M urea, which was thus maintained in all rP2 solutions for the following studies. The molecular mass and shape of rP2 in solution were investigated by gel filtration chromatography (Fig. 2G) and Dynamic Light Scattering (Fig. 2H). Data were compared with results obtained using the 41 kDa globular protein adenosine kinase, under the same experimental conditions. The observed hydrodynamic molecular radius of rP2 from both measurements were at least twice that of adenosine kinase, thus consistent with the notion that rP2 forms a homodimer in aqueous solution.
3.2. Structural model of squid hnRNPA/B-like Protein 2 To evaluate secondary and tertiary structure, a three-dimensional model of the squid hnRNPA/B-like Protein 2 N-terminal region was made in silico using the N-terminal region of human hnRNPA1 determined by crystallography [9] (PDB # 1L3K) as a template (Fig. 2). Note that the C-terminal half of squid hnRNPA/B-like Protein 2, as in the human protein, is intrinsically disordered, hence not represented in this model (see Krebs and DeMesquita [14], for an in silico model of the CO-terminal domain of hnRNPA1). Superposition of the template with the generated model showed a high degree of conservation of both secondary and tertiary structures (Fig. 2A), having an atomic root mean square deviation of 0.275 angstroms. The two RRM domains give rise to two anti-parallel beta sheets each with a nested pair of perpendicularly oriented alpha helices. The RRM domains are linked by a loop, such that the beta sheets are oriented toward the surface to form the sites for interaction with RNA (Fig. 2B). Using GRAMM-X, protein docking software, we investigated whether two monomers of squid hnRNPA/B-like Protein 2 could form a stable homodimer, as previously proposed [7]. Fig. 2C shows a docked model with a best fit to a homodimer stabilized by hydrogen and electrostatic bonds. Using Gromacs-3.2.1 [15], the stability of squid hnRNPA/B-like Protein 2 homodimer was evaluated by simulating its behavior in an aqueous environment. The homodimer showed stability after 1 ns of simulation (Fig. 2E). Through molecular dynamics analysis, it was possible to observe that the ends of the dimer model have greater root mean square fluctuations indicating greater mobility in aqueous solution (Fig. 2F). The central region of the model, responsible for the interaction between monomers, presents low fluctuation indicating high stability. A cartoon of a putative squid hnRNPA/B-like Protein
3.3. Full-length squid hnRNPA/B-like Protein 2 expressed in SH-SY5Y cells is exclusively nuclear, whereas truncated Protein 2 co-localizes to cytoplasmic PABP containing granules In order to evaluate the subcellular localization of squid hnRNPA/Blike Protein 2 in neuronal-like cells, we expressed the recombinant GFPconjugated protein GFP-rP2 in cultured SH-SY5Y human neuroblastoma cells, a cell line prone to assume a neuronal phenotype upon differentiation in culture, characterized by neurite extension and elongated nuclei (Supp. Fig. 1A), as well as up-regulation of NeuN protein (Supp. Fig. 1B,C) [10]. SH-SY5Y cells were transfected with pEGFP-C1 vector containing the open reading frame that encodes for squid hnRNPA/B221
Neuroscience Letters 696 (2019) 219–224
G.S. Lopes et al.
Fig. 2. Tridimensional structural model of the amino terminal half of squid hnRNPA/B-like Protein 2. The crystallographic structure of the N-terminal domain of human hnRNPA1, accession n° 1L3K [9], was used as a template to generate a tridimensional model of amino acids 1–200 of the squid hnRNPA/B-like Protein 2, using the Modeller software. Being intrinsically unstructured, the C-terminal half of the molecule is not represented here. A) The overlay of the template (red) and model (yellow) shows very close correspondence between the structures, giving an atomic root mean square deviation of 0.279 angstroms using the Chimera v1.10.2 software. The N-terminal (NH) and the C-terminal (CO) of this model are indicated. Two views are given at 180° rotation around the horizontal axis. B) The squid Protein 2 model is given by itself to illustrate the orientation of the two RRMs in the structure, each composed of two perpendicularly oriented alpha helices (red), nested with a four-stranded beta-sheet (yellow) that make up the RNA contact surfaces. Two views are given at 180° rotation around the horizontal axis. C) A stable homodimer of the structured N-terminal domain of hnRNPA/B-like Protein 2 is presented, predicted by application of the GRAMM-X Protein Docking Server (GXPDS, online) to form by strong hydrogen and electrostatic bonding resulting in pseudo symmetry around the contact surface (white dashed line). RRM 1 is represented in yellow and RRM2 in green. Two views are given at 180° rotation around the horizontal axis. D) A cartoon rendition of the hypothesized complete dimer is given to illustrate the relation of the globular N-terminal domains to the unstructured and possibly extended C-terminal domain (CO). E) The Root Mean Square Deviation (RMSD) in nanoseconds of squid hnRNPA/B-like Protein 2 homodimer was determined by simulation of its behavior in an aqueous environment using Gromacs-3.2.1. F) The atomic Root Mean Square Fluctuation (RMSF) is plotted for each residue of each monomer when RMSD attained maximum stability. G) The profile of elution of recombinant Protein 2 (rP2,1.4 mg/ml) compared to adenosine kinase (ADK, 1,4 mg/ml) on a calibrated Superdex 200 10/300 G l column gave estimates of their molecular mass (kDa). The first peak eluted is rP2 and the second is ADK. The molecular radii (r.nm) and estimated molecular mass are given in the insert. H) Dynamic Light Scattering (DLS) of rP2 and ADK in the same buffer was performed on a Malvern Zetasizer apparatus. Overlapped ZetaSizer DLS of the rP2 and ADK showed an average hydrodynamic diameter of the 5,0 ± 1,6 nm and 3,2 ± 0,9 nm and polydispersity of 28% and 254% at 20° respectively. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
like Protein 2 (GFP-rP2) (Fig. 3). Remarkably the full-length GFP-rP2 showed an exclusively nuclear localization in both non-differentiated (Fig. 3B) and differentiated cells (Supp. Fig. 2B). To evaluate if the corresponding M9/NTS region of squid hnRNPA/ B-like Protein 2 has a role in its cellular distribution, we induced the expression of a GFP-tagged truncated form of squid Protein 2 lacking the last 53 amino acid residues from the C-terminal (GFP-rP21-296).
Interestingly, the truncated squid hnRNPA/B-like Protein 2 was also found in the cytoplasm, where it concentrated in aggregates, many of which also contained poly-A binding protein (PABP) (Fig. 3C and Supp. Fig. 2C) an indicator of SGs.
222
Neuroscience Letters 696 (2019) 219–224
G.S. Lopes et al.
Fig. 3. Subcellular localization of full-length and truncated forms of squid hnRNPA/B-like Protein 2 in human SH-SY5Y cells submitted or not to hyperosmotic stress. Non-differentiated cells expressing GFP alone (A), or GFP fused to full length squid hnRNPA/B-like Protein 2 (GFP-rP2) (B), or its truncated form lacking 53 amino acids of the C-terminal region (GFP-rP21-296) (C). In (D), cells expressing full length GFP-rP2 and osmotically stressed by 0,4 M sorbitol for 1 h. Cells were immunolabeled for PABP (red). Nuclei were stained with DAPI (blue). GFP and conjugates are rendered green. Scale bars, 10 μm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
3.4. Full-length squid hnRNPA/B-like Protein 2 relocates to SG in SH-SY5Y cells submitted to osmotic stress
may be involved in stress response, SH-SY5Y cells expressing GFP-rP2 were treated with 400 mM D-Sorbitol for one hour. The results show that in cells submitted to osmotic stress, part of GFP-rP2 accumulated in cytoplasmic foci that co-localize with PABP granules (Fig. 3D), different
To investigate the hypothesis that squid hnRNPA/B-like Protein 2 223
Neuroscience Letters 696 (2019) 219–224
G.S. Lopes et al.
than the control where GFP-rP2 was exclusively located in the nucleus (Fig. 3B).
We also thanks Center for Research in Energy and Materials (CNPEM) and the Biosciences National Laboratory (LNBio) at for provision of time in the LPP facilities. Authors declare no competing financial interests.
4. Discussion P65 represents a specific hnRNPA/B type member at the pre-synaptic site of squid neurons. We have proposed p65 to be an SDS-stable dimer composed of ∼37-kDa hnRNPA/B-like subunits. Here, we showed a structural model of squid hnRNPA/B-like Protein 2 (37.6 kDa) that provides support of the formation of a stable homodimer, based on the low flexibility and movement during RMSF and RMSD analysis. Dynamic light scattering (DLS) and gel filtration chromatography of the recombinant squid hnRNPA/B-like Protein 2 also suggest a propensity of squid Protein 2 to dimerize in aqueous solution. An understanding of biochemical mechanisms involved in the formation and stability of the dimeric form may bring insights into the cytoplasmic inclusion body formation of hnRNP complexes, which is a hallmark of several neurodegenerative diseases. One feature of human hnRNPA/B type proteins is the shuttling from nucleus to cytoplasm. The M9 sequence found in human hnRNPA1 proteins functions as a signal for nuclear/cytoplasm exchange [13,16]. When we expressed truncated rP2 fused to GFP (GFP-rP2aa1-296), in which the region corresponding to M9 is lacking, the localization of rP2 is no longer exclusively nuclear (Fig. 3C), indicating that the lack of this region disturbs nuclear localization of squid hnRNPA/B-like Protein 2. Similarly, human hnRNPA1 protein lacking M9 sequence is also found in the cytoplasm of transfected HeLa cells [17]. Indeed the activity of shuttling from nucleus to cytoplasm of hnRNPA/B family of proteins seems to be functionally relevant to squid hnRNPA/B-like Protein 2, considering the observation that under osmotic stress GFP-rP2 relocates from the nuclei into cytoplasmic SGs (Fig. 3D), as occurs with human hnRNPA1 [18]. Moreover, the mobilization of PABP to cytoplasmic granules containing truncated rP2, in neuroblastoma SH-SY5Y cells maintained under normal physiological conditions, suggests that squid hnRNPA/B-like Protein 2 may have regions of interaction with nucleating proteins of SGs. Interestingly, Drosophila ortholog of human hnRNP A1/A2 proteins (Hrb98DE/ Hrp38) maintains the ability of these proteins to bind to TDP-43 [19], a component of SG which is required for its efficient dynamics in neurodegenerative disease-relevant cell type [20], and also to form RNA granules in dendritic arbors of neurons [21]. In summary, the molecular structure and similarity in cellular location and stress response between the squid and human proteins support the notion that the functions of the hnRNPA/B family are phylogenetically highly conserved. These data in connection with the synaptic location of squid hnRNPA/B-like Protein 2 may offer insight into the role of this class of RNA binding proteins in human neurodegenerative diseases.
Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.neulet.2019.01.002. References [1] J.R. Buchan, mRNP granules. Assembly, function, and connections with disease, RNA Biol. 11 (8) (2014) 1019–1030. [2] L. Liu-Yesucevitz, G.J. Bassel, A.D. Gitler, A.C. Hart, E. Klann, J.D. Richter, S.T. Warren, B. Wolozin, Local RNA translation at the synapse and in disease, J. Neurosci. 31 (45) (2011) 16086–16093. [3] M.G. Thomas, M. Loschi, M.A. Desbats, G.L. Boccaccio, RNA granules: the good, the bad and the ugly, Cell. Signal. 23 (2) (2011) 324–334. [4] J. Jean-Philippe, S. Paz, M. Caputi, hnRNP A1: The Swiss Army Knife of gene expression, Int. J. Mol. Sci. 14 (9) (2013) 18999–19024. [5] Y.D. Choi, G. Dreyfuss, Isolation of the heterogeneous nuclear RNA-ribonucleoprotein complex (hnRNP): a unique supramolecular assembly, Proc. Natl. Acad. Sci. U. S. A. 81 (23) (1984) 7471–7475. [6] D.T. Lico, J.C. Rosa, J.A. DeGiorgis, E.J. de Vasconcelos, L. Casaletti, S.B. Tauhata, M.M. Baqui, M. Fukuda, J.E. Moreira, R.E. Larson, A novel 65 kDa RNA-binding protein in squid presynaptic terminals, Neuroscience 166 (1) (2010) 73–83. [7] D.T. Lico, G.S. Lopes, J. Brusco, J.C. Rosa, R.M. Gould, J.A. De Giorgis, R.E. Larson, A novel SDS-stable dimer of a heterogeneous nuclear ribonucleoprotein at presynaptic terminals of squid neurons, Neuroscience. 300 (2015) 381–392. [8] G. Dreyfuss, V.N. Kim, N. Kataoka, Messenger-RNA-binding proteins and the messages they carry, Nat. Rev. Mol. Cell Biol. 3 (3) (2002) 195–205. [9] J. Vitali, J. Ding, J. Jiang, Y. Zhang, A.R. Krainer, R.M. Xu, Correlated alternative side chain conformations in the RNA-recognition motif of heterogeneous nuclear ribonucleoprotein A1, Nucleic Acids Res. 30 (7) (2002) 1531–1538. [10] M. Encinas, M. Iglesias, Y. Liu, H. Wang, A. Muhaisen, V. Ceña, C. Gallego, J.X. Comella, Sequential treatment of SH-SY5Y cells with retinoic acid and brainderived neurotrophic factor gives rise to fully differentiated, neurotrophic factordependent, human neuron-like cells, J. Neurochem. 75 (3) (2000) 991–1003. [11] C. Maris, C. Dominguez, F.H. Allain, The RNA recognition motif, a plastic RNAbinding platform to regulate post-transcriptional gene expression, FEBS J. 272 (9) (2005) 2118–2131. [12] H. Siomi, G. Dreyfuss, A nuclear localization domain in the hnRNP A1 protein, J. Cell Biol. 129 (3) (1995) 551–560. [13] W.M. Michael, M. Choi, G. Dreyfuss, A nuclear export signal in hnRNP A1: a signalmediated, temperature-dependent nuclear protein export pathway, Cell. 83 (3) (1995) 415–422. [14] B.B. Krebs, J.F. De Mesquita, Amyotrophic lateral sclerosis type 20 - in silico. Analysis and molecular dynamics simulation of hnRNPA1, PLoS One 11 (7) (2016) e0158939. [15] E. Lindahl, B. Hess, D. van der Spoel, GROMACS 3.0: a package for molecular simulation and trajectory analysis, J. Mol. Model. 7 (2001) 306–317. [16] M.C. Siomi, P.S. Eder, N. Kataoka, L. Wan, Q. Liu, G. Dreyfuss, Transportin-mediated nuclear import of heterogeneous nuclear RNP proteins, J. Cell Biol. 138 (6) (1997) 1181–1192. [17] H. Kooshapur, N.R. Choudhury, B. Simon, M. Muhlbauer, A. Jussupow, N. Fernandez, A.N. Jones, A. Dallmann, F. Gabel, C. Camilloni, G. Michlewski, J.F. Cáceres, M. Sattler, Structural basis for terminal loop recognition and stimulation of pri-miRNA-18a processing by hnRNPA1, Nat. Commun. 9 (1) (2018) 2479 26. [18] S. Guil, J.C. Long, J.F. Cáceres, hnRNPA1 relocalization to the stress granules reflects a role in the stress response, Mol. Cell. Biol. 26 (15) (2006) 5744–5758. [19] M. Romano, E. Buratti, G. Romano, R. Klima, L. Belluz, C. Stuani, F. Baralle, F. Feiguin, Evolutionarily conserved heterogeneous nuclear ribonucleoprotein (hnRNP) A/B proteins functionally interact with human and drosophila TAR DNAbinding protein 43 (TDP-43), J. Biol. Chem. 28 (10) (2014) 7121–7130. [20] Y. Khalfallah, R. Kuta, C. Grasmuck, A. Prat, H.D. Durham, C.V. Velde, TDP-43 regulation of stress granule dynamics in neurodegenerative disease-relevant cell types, Sci. Rep. 8 (2018) 7551. [21] L. Liu-Yesucevitz, A.Y. Lin, A. Ebata, J.Y. Boon, W. Reid, Y. Xu, K. Kobrin, G.J. Murphy, L. Petrucelli, B. Wolozin, ALS-linked mutations enlarge TDP-43-enriched neuronal RNA granules in the dendritic arbor, J. Neurosci. 34 (12) (2014) 4167–4174. [22] P. Gonnet, F. Lisacek, Probabilistic alignment of motifs with sequences, Bioinformatics 18 (8) (2002) 1091–1101.
Acknowledgements Research was supported by grants to REL from the Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and Fundação de Apoio ao Ensino, Pesquisa e Assistência do Hospital das Clínicas da FMRP-USP (FAEPA). GSL and DTPL received research fellowships from CNPq and FAPESP, respectively. REL and MLPL received the Productivity-in-Research fellowship from CNPq. Thanks to Silvia Andrade for expert technical help, and M.Sc Elizabete R. Milani for technical help with confocal microscopy, performed at Laboratório Multiusuário de Microscopia Confocal - LMMC, Fapesp 2004/08868-0.
224