- Email: [email protected]
A plasmid vector for an extreme thermophile, Thermus thermophilus
FEMS MicrobiologyLetters72 (1990)97-102 Publishedby Elsevier
97
FEMSLE04178
A plasmid vector for an extreme thermophile,
Thermus thermophilus Y. Koyama t, y . Afikawa 2 and K. Furukawa t t Fermentation ResearchInstitute. 41ST. MITL TaukubaScience Clff+Ibarakiand : NaganoState Laboratoryof FoodTechnology; 205.1 Nishibanbo.Kunta. NaganoCiO~Japan Received27 February 1990 Re'asion received30 May 19qo Acccptc¢l I June 1990 Key words: Thermus; Plasmid vector; Transformation; "l'ryptophan synthetase gene
1. SUMMARY The host-vector system for an extreme thermophile. Thermus thermophilus HB27, was developed. The host strain has a mutation in tryptophan synthetase gene (trpB). and the mutation was determined to be a missense mutation by DNA sequence analysis. A Thermus.E. cob shuttle vector pYKI09 was constructed, pYKI09 consists of Thermus cryptic plasmid p'I'T8, tryptophan synthetas¢ gene (trpB) of Thermus T2 and E. coh plasmid vector pUCI3, pYK109 t-~nsformed T. thermophilus HB27 trpB5 to Trp , a :. {uency of 106 transformants per ~.g DNA.
2. INTRODUCTION Thermus sp. are extremely thermophilie Gramnegative bacteria which can grow at over 75°C. Since no antibiotic resistance plasmid has been
Correspondenceto."YoshinoriKoyama.Fermcl~tatlonResearch Institute, AIST, MITt, Tsukuba Science City, Ibaxaki 305. Japan+
igc,!ated from Thermus bacteria and antibiotic resistance g'mes from mesophilic bacteria do not function at high temperature, a Thermus plasmid vector has not yet been constructed. We reported previously natural DNA transformation events in T. thermophilus HB27 [1]. Auxotrophic strains of T. thermophilus HB27 were transformed 1o prototrophy at high frequencies of 10 -2 to 10 ~ when cells were incubated at 70°C with wild-type chromosomal DNA. Cells of T. thermophilus HB27 require no chemical treatment to induce competence. Introduction of a cryptic plasmid pTT8 into T. rhermophilus HB27 was also demonstrated. We have cloned tryptophan synthetase genes (trpBA) from T. thermophilus HB27 for a selection marker in Thermus [2]. However. T. thermophilus HB27 trpBA genes were not suitable for a selection marker in T. thermophilus HB27 hosts, because the cloned DNA fragment of T. thermophilus HB27 trpBA genes recombined with the chromosomal counterpart at high frequency. We describe here the analysis of the trpB5 mutation of the host strain and the construction of a Thermus-E. colt shuttle vector plasmid which contains Thermus T2 trpB gene as a selection marker.
0378.1097/90/S03,50 © 1990Federationof European MicrobiologicalSocieties
98 3. MATERIALS A N D METHODS
3. L Bacterial strains and plasmids E. coli strains MC1009, MC1061 [3], JM83 [41 and E. coil plasmid vector pUC13, pUC19 [5] were purchased from Pharmacia. E. colt plasmid vector pUCII8 [61 was purchased from Takara Shuzo Co. lhermus strains, T caldophilus GK24 [7], T. flavus AT62 [8], T aquaticus YTI [9] Ther. mus T2 [10], T thermophilus HB8 [11], T thermophilus HB27 [12], T. thermophilus HB27 trpB5 [2] and Thermus cryptic plasmid pTT8 [13] were described previously.
nucleotide sequence (315 bp) between the BamHl and Sinai restriction sites of the insert D N A on the plasmid was determined.
3.5. Determination of nucleotide sequence The D N A fragment to be sequenced was cloned in both orientation in pUCIIS. Single stranded plasmid D N A was obtained by the method of Vieira and Messing [6]. Nucleotide sequences were determined with a D N A sequencer (Applied Bio. systems model 370A),
4. RESULTS A N D DISCUSSION
3.2. Media and growth conditions TM broth medium [1] was used for routine cultivation and transformation experiments o~' T thermophilus. Minimal medium for T. thermophilus HB27 was described previously []4]. Liquid and agar culture of :E thermophilus were incubated at 70°C.
3.3. DNA isolation, transformation and cloning E. colt transformation and plasmid isolation were performed as described [15]. T. thermophilus HB27 trpB was transformed to Trp + as described previously [1]. Thermus T2 trpBA genes were cloned as follows. Thermus T2 chromosomal D N A was partially digested with Mbol and 4-10 kbp D N A fragments were isolated. After ligation of the D N A fragments to BamH! digested pUCI3, E. ¢~li MC1009 was transformed. The E. colt recombinant colony bank was screened by colony-hybridization with a 1,8 kbp BgllI-$acl D N A fragment which contained trpB and the N-ternfinal region of trpA of 7". thermophil~' HB27 121.
3.4. Location of the trpB5 mutation Chromosomal DNA of T. thermophilus HB27 trpB5 mutant was digested with Sinai and 1.1-1.2 kbp DNA fragments were isolated. The D N A fragments were ligated to Smal digested p U C I I 8 and E. colt JM83 was transformed. A colony containing the trpB5 mutant gene was selected from the colony bank by colony hybridization with the 1.15 kbp Sinai fragment of wild type T~ thermophilus HB27 trpB geae [2] as a probe. The
4.L Location of the T. thermophilus HB27 trpB3 mutation trpB5 mutation is known to be in a 315 bp SmaI-BamH1 fragment which contains the Nterminal part of the trpB gent and the 5" flanking region (Fig. 1) [2]. This region was cloned from tile T. thermophilus HB27 trpB5 mulant. The nuclcotide sequence of the mutant D N A revealed one base change (G to A) at position 234 in Fig 1. The glycine at position 20 was replaced with glutamate in the trpB5 mutant enzyme,
4.Z Transformation of T, thermophilus HB27 trpB5 with heterospeeific chromosomal DNA We have tried to construct a Thermus plasmid vector containing the previously cloned tryplophan synthetasc genes (trpBA)of T. thermophilus HB27 [2] as a selection marker. However, T, thermophilus HB27 trpBA genes were not suitable for a selection marker, because these genes were found to recombine with their chromosomal counterpart at high frequency. So we screened several Thermus strains for tryptophan synthetase genes which would not recombine with T, thermophilas HB27 chromosomal DNA, Z thermophilus HB27 trpB5 mutant was transformed 1o Trp+ with DNA from various Thermus strains (Table 1). The results suggested that Thermus T2 tryptophan synthetase gene can be used as a selection marker in T, thermophilus HB27 trpB5 host, because the transformation frequency with Thermus T2 chromosomal D N A was lowest, with a frequency of about 10 -a corn-
SmaX CCCGGGCCGCCTGGACGATGGCGCGGTCGTCCCCCATCTGGTCCACCAGGCGGACGAAGC
60
CC~TGTCCAAGACCGOGATCGTGAGAGGCCCTTCCATCCCCCCGAGTTTACCGGGAGGCC
120
CCTCCGGGGTAGUATCGGAGTTGTCTTGGCOCGAGGCGCCTTTAGG~AGCGAAGCATGCT
180
MerLe CACCCTACCCGACTTTCCCTTGCCCGACGCGACGGGGCGGTTCGG~CCCTACGGGGGGCG uThrLeuP~oAspPheProLeuPzoAspAlaArgG1y~rgPheGIyProTzrGlyGlyAr
24Q
GAG
G1u
CZ'pB5 m u t a Z l o n GTACGTGCCCGAGACCCTGATCCCCGCCCTGGAGGAGTTGGAGGCCGCCTACCGGGAGGC
300
gTyrvelProG!uThrLeufleProAlaleuGluGluLeuGZuA1aAlaTyrArgGluA1 m~m~Z
CAAGAAG~ATCC
312
,~L/SZySASp
Fig, l. NudL~tidusequcu~c~ofthere~on
¢ofllalnins;hctrpB) lnu|allon cf l[Ihermophilll~HB27.
"Iabl¢ 1
pared with the parental I-iB27 chromosomal DNA. Thermus T2 and T. thermopllilus are distantly related taxonomically and were classified in differ¢nt groups [16]. It is not known why T. thermophilus HB27 trpB5 was transformed to Trp* at higher frequencies with chromosomal DIN?, from T. thermophilus HBS, T. flavus AT62 and T. ca/dophilus GK24 than with that of the parental strain. A similar phenomenon was also obsgrved in the transformation of other auxotrophic strains (Leu-, Met-, Lys-) of T. thcrmophilus HB27 (data not shown). Combined with the fact that the transformation
Trans[otmation of T ihermophih~ HB27 trpB5 Io Tip ~ with various DNAs DNAs of wild type Thermu~ slrains except for pKA2 plasmid were used for transformation ¢xpcrim©nL pKA2 plasntid contains 7~ thermophdr~ HB27 trpBA genes in pljC13. Chromosomal
DNA source
Transformation frequency (%)
pKA2 plasmid DNA T Ihcrmophilu.t HB27 2~ thermophilas HB? T flav~.~ AT62 2~ caldophilv,¢ GK24 T aquatlc~ YTI Thermu~ "[2
4.1 6.3 14.1 9,8 12,4 0.00(~
f r e q u e n c y o f 7". ther mophilus
C.(~05
HB27 auxotrophic
} pKA 07[ 0c,3 =.l
[ --
pKA210 1
~I,I
pKA216 ]
pUG13
.~1
pKA211 I
pUC19
~/I
I
t
i
II i I
II II I
I I
II I I i u
I
I I-----1
Fig, 2. pKA207 containing Therm~ T'2 Iryptophan syn|helase gen¢~ and its derivative p]asnfids. Location of Ihe trpB,4 genes is shown,
100 markers with HB27 wild type chromosomal DNA varies from 1 to 15% [1], this suggests that T. thermophilus HB27 may have a base excision repair system which is similar to "'hex" system in Streptococcus pneumoniae [17].
4.3. Cloning of Thermus T2 tryptophan synthetase genes A Thermus "I"2 chromosomal DNA gene bank was constructed in E, cell using pUC13 and the resultant recombinant plasmid pKA207 containing the Thermus T2 trpBA genes was selected by colony-hybridization with the previously isolated T. thermophilus HB27 trpB gene as a probe (Fig. 2). Since preliminary hybridization suggested that the trpBA genes ate located in a 3.1 kbp Bglll. BamHI fragment, this fragment was subeloned into pUC13 (making pKA210) and a detailed restriction map was constructed. The 1.8 kbp BgllI-SacI fragment and the 0.95 kbp XhoI fragment on pKA210 insert DNA were also sub. cloned. The nucleotide sequence of the 0.95 kbp Xhol fragment indicated that it coded for a peptide which is homologous to T. thermophilus HB2) trpB peptide (40th to 353th amino acid; data not shown). The possible location of Thermus T2 trpBA genes is shown in Fig, 2.
Pstl~
1
pKA216(4.SKb)
~ EcoRI
'St) .Kpn)
Pstl
PSII phi
18ell Fig, 3. Constructionof Thermt~-E. coli shuttlereeler plasmid
pYKI09.
for use as a shuttle vector for Thermus and /~: coil, using EcoRI as a cloning site.
4.4. Construction of a Thermus plasmid vector
REFERENCES
Vasquez et al, reported that the cryptic plasmid pTT8 (9.7 kbp) is stably maintained in T. thermophilus HB8 and cannot easily be cured [18]. Stable maintenance without selective pressure is a preferable feature of a vector plasmid. We chose this pTTg plasmid as a base plasmid for the construelion of a Thermus vector, The Thermus T2 trpB gene was inserted in the BgllI site of the cryptic plasmld pTl"8 from T. therulophilus HB8 as shown in Fig. 3. After the ligation of BamHl digested pKA216 and Bglll digested pTT8. T. thermophilus HB27 trpB5 was transformed. The recombinant plasmld pYK109 was obtained from a Trp + transformant, E. co// MC1061 was also transformed with pYK109 and the same plasmid was isolated from Apr transformants, pYK109 transformed T, thermophilus HB27 trpB5 to Tip + at the frequency of 106 transfer. mants per/~g DNA. pYK109 should be suitable
Ill Koyama, Y,, Hoshino. T., Tomlzuka, N. and Furukawa, K. (1986)J. Bacieriol. 166,338-340, [2] Koyama, Y. and Furukawa, K. 0990) J, Bacteriol. in pre~s, [3] Casadaban. MJ, and Cohen, SM. (1980)J. MoL Biol.138, 179-207, [4] Vieira,J. and Messing.J. (1982)Gene 19. 259-268, 15] Messing,J. (1983)Methods EnzymoL101, 20-78, Ia] Vieira, J, and Messing,J, 0987) Methods En~ymol. 153, 3-11, [7] Taguchi.H,, Yamashita, M.. Matsuzawa, H. and Ohtu, T, (1982~J. Biochem.91,1343-1348, [8] Salki,T,, Kiraurq, K. and Arima, K. (19"/2) ASfic, Biol. Chum, 36,2357-2366, [91 Brc~k,I.D. and Fr¢~:, H. 11969)J, B=cterioL98. 289297. [t01 Ulrich,3,1",, Mcfetets. G.A. and T~mple, K.L, (1972) J. Bactefiol. llO,691-698, [ll I Oshima,T. and Imahori, K. (1974) Int. J, Syst. Bacteriol, 24.102-112, [121 Nagahari, K.. Koshlkawa. T. and Sakaguchl, K. (1980) Oene 10, 137-145.
101 [13] Hishinuma. F., Tanaka, T. and Sakaguchi, K. 11978) J. Gen. Microbiol. 104, 193 199. [14] Oshima, T. and Baba. M+ {198D Biochem. Biophys. Res. Comm. 103, 156-160. 1151 Maniatis, T., Fritsch, E+F. and Sambrook, J. (1982) Molecular Cloning, Cold Spring Harbor Laboratory.
116] Hudson. J.A., Morgan, H.W. and Daniel R.M. {1986) 1. Gcn. MicrobioL 132+ 531-540. [17] Claverys, J.P., Roger, M and Sicard+ A.M. (]qg0) Mol. Gen. Genet. 178. 191-201. [181 V a ~ u e ~ C., Vitanue, a+ J. and Vicuna. R. (1983) FEBS Left. 158, 339-342.
97
FEMSLE04178
A plasmid vector for an extreme thermophile,
Thermus thermophilus Y. Koyama t, y . Afikawa 2 and K. Furukawa t t Fermentation ResearchInstitute. 41ST. MITL TaukubaScience Clff+Ibarakiand : NaganoState Laboratoryof FoodTechnology; 205.1 Nishibanbo.Kunta. NaganoCiO~Japan Received27 February 1990 Re'asion received30 May 19qo Acccptc¢l I June 1990 Key words: Thermus; Plasmid vector; Transformation; "l'ryptophan synthetase gene
1. SUMMARY The host-vector system for an extreme thermophile. Thermus thermophilus HB27, was developed. The host strain has a mutation in tryptophan synthetase gene (trpB). and the mutation was determined to be a missense mutation by DNA sequence analysis. A Thermus.E. cob shuttle vector pYKI09 was constructed, pYKI09 consists of Thermus cryptic plasmid p'I'T8, tryptophan synthetas¢ gene (trpB) of Thermus T2 and E. coh plasmid vector pUCI3, pYK109 t-~nsformed T. thermophilus HB27 trpB5 to Trp , a :. {uency of 106 transformants per ~.g DNA.
2. INTRODUCTION Thermus sp. are extremely thermophilie Gramnegative bacteria which can grow at over 75°C. Since no antibiotic resistance plasmid has been
Correspondenceto."YoshinoriKoyama.Fermcl~tatlonResearch Institute, AIST, MITt, Tsukuba Science City, Ibaxaki 305. Japan+
igc,!ated from Thermus bacteria and antibiotic resistance g'mes from mesophilic bacteria do not function at high temperature, a Thermus plasmid vector has not yet been constructed. We reported previously natural DNA transformation events in T. thermophilus HB27 [1]. Auxotrophic strains of T. thermophilus HB27 were transformed 1o prototrophy at high frequencies of 10 -2 to 10 ~ when cells were incubated at 70°C with wild-type chromosomal DNA. Cells of T. thermophilus HB27 require no chemical treatment to induce competence. Introduction of a cryptic plasmid pTT8 into T. rhermophilus HB27 was also demonstrated. We have cloned tryptophan synthetase genes (trpBA) from T. thermophilus HB27 for a selection marker in Thermus [2]. However. T. thermophilus HB27 trpBA genes were not suitable for a selection marker in T. thermophilus HB27 hosts, because the cloned DNA fragment of T. thermophilus HB27 trpBA genes recombined with the chromosomal counterpart at high frequency. We describe here the analysis of the trpB5 mutation of the host strain and the construction of a Thermus-E. colt shuttle vector plasmid which contains Thermus T2 trpB gene as a selection marker.
0378.1097/90/S03,50 © 1990Federationof European MicrobiologicalSocieties
98 3. MATERIALS A N D METHODS
3. L Bacterial strains and plasmids E. coli strains MC1009, MC1061 [3], JM83 [41 and E. coil plasmid vector pUC13, pUC19 [5] were purchased from Pharmacia. E. colt plasmid vector pUCII8 [61 was purchased from Takara Shuzo Co. lhermus strains, T caldophilus GK24 [7], T. flavus AT62 [8], T aquaticus YTI [9] Ther. mus T2 [10], T thermophilus HB8 [11], T thermophilus HB27 [12], T. thermophilus HB27 trpB5 [2] and Thermus cryptic plasmid pTT8 [13] were described previously.
nucleotide sequence (315 bp) between the BamHl and Sinai restriction sites of the insert D N A on the plasmid was determined.
3.5. Determination of nucleotide sequence The D N A fragment to be sequenced was cloned in both orientation in pUCIIS. Single stranded plasmid D N A was obtained by the method of Vieira and Messing [6]. Nucleotide sequences were determined with a D N A sequencer (Applied Bio. systems model 370A),
4. RESULTS A N D DISCUSSION
3.2. Media and growth conditions TM broth medium [1] was used for routine cultivation and transformation experiments o~' T thermophilus. Minimal medium for T. thermophilus HB27 was described previously []4]. Liquid and agar culture of :E thermophilus were incubated at 70°C.
3.3. DNA isolation, transformation and cloning E. colt transformation and plasmid isolation were performed as described [15]. T. thermophilus HB27 trpB was transformed to Trp + as described previously [1]. Thermus T2 trpBA genes were cloned as follows. Thermus T2 chromosomal D N A was partially digested with Mbol and 4-10 kbp D N A fragments were isolated. After ligation of the D N A fragments to BamH! digested pUCI3, E. ¢~li MC1009 was transformed. The E. colt recombinant colony bank was screened by colony-hybridization with a 1,8 kbp BgllI-$acl D N A fragment which contained trpB and the N-ternfinal region of trpA of 7". thermophil~' HB27 121.
3.4. Location of the trpB5 mutation Chromosomal DNA of T. thermophilus HB27 trpB5 mutant was digested with Sinai and 1.1-1.2 kbp DNA fragments were isolated. The D N A fragments were ligated to Smal digested p U C I I 8 and E. colt JM83 was transformed. A colony containing the trpB5 mutant gene was selected from the colony bank by colony hybridization with the 1.15 kbp Sinai fragment of wild type T~ thermophilus HB27 trpB geae [2] as a probe. The
4.L Location of the T. thermophilus HB27 trpB3 mutation trpB5 mutation is known to be in a 315 bp SmaI-BamH1 fragment which contains the Nterminal part of the trpB gent and the 5" flanking region (Fig. 1) [2]. This region was cloned from tile T. thermophilus HB27 trpB5 mulant. The nuclcotide sequence of the mutant D N A revealed one base change (G to A) at position 234 in Fig 1. The glycine at position 20 was replaced with glutamate in the trpB5 mutant enzyme,
4.Z Transformation of T, thermophilus HB27 trpB5 with heterospeeific chromosomal DNA We have tried to construct a Thermus plasmid vector containing the previously cloned tryplophan synthetasc genes (trpBA)of T. thermophilus HB27 [2] as a selection marker. However, T, thermophilus HB27 trpBA genes were not suitable for a selection marker, because these genes were found to recombine with their chromosomal counterpart at high frequency. So we screened several Thermus strains for tryptophan synthetase genes which would not recombine with T, thermophilas HB27 chromosomal DNA, Z thermophilus HB27 trpB5 mutant was transformed 1o Trp+ with DNA from various Thermus strains (Table 1). The results suggested that Thermus T2 tryptophan synthetase gene can be used as a selection marker in T, thermophilus HB27 trpB5 host, because the transformation frequency with Thermus T2 chromosomal D N A was lowest, with a frequency of about 10 -a corn-
SmaX CCCGGGCCGCCTGGACGATGGCGCGGTCGTCCCCCATCTGGTCCACCAGGCGGACGAAGC
60
CC~TGTCCAAGACCGOGATCGTGAGAGGCCCTTCCATCCCCCCGAGTTTACCGGGAGGCC
120
CCTCCGGGGTAGUATCGGAGTTGTCTTGGCOCGAGGCGCCTTTAGG~AGCGAAGCATGCT
180
MerLe CACCCTACCCGACTTTCCCTTGCCCGACGCGACGGGGCGGTTCGG~CCCTACGGGGGGCG uThrLeuP~oAspPheProLeuPzoAspAlaArgG1y~rgPheGIyProTzrGlyGlyAr
24Q
GAG
G1u
CZ'pB5 m u t a Z l o n GTACGTGCCCGAGACCCTGATCCCCGCCCTGGAGGAGTTGGAGGCCGCCTACCGGGAGGC
300
gTyrvelProG!uThrLeufleProAlaleuGluGluLeuGZuA1aAlaTyrArgGluA1 m~m~Z
CAAGAAG~ATCC
312
,~L/SZySASp
Fig, l. NudL~tidusequcu~c~ofthere~on
¢ofllalnins;hctrpB) lnu|allon cf l[Ihermophilll~HB27.
"Iabl¢ 1
pared with the parental I-iB27 chromosomal DNA. Thermus T2 and T. thermopllilus are distantly related taxonomically and were classified in differ¢nt groups [16]. It is not known why T. thermophilus HB27 trpB5 was transformed to Trp* at higher frequencies with chromosomal DIN?, from T. thermophilus HBS, T. flavus AT62 and T. ca/dophilus GK24 than with that of the parental strain. A similar phenomenon was also obsgrved in the transformation of other auxotrophic strains (Leu-, Met-, Lys-) of T. thcrmophilus HB27 (data not shown). Combined with the fact that the transformation
Trans[otmation of T ihermophih~ HB27 trpB5 Io Tip ~ with various DNAs DNAs of wild type Thermu~ slrains except for pKA2 plasmid were used for transformation ¢xpcrim©nL pKA2 plasntid contains 7~ thermophdr~ HB27 trpBA genes in pljC13. Chromosomal
DNA source
Transformation frequency (%)
pKA2 plasmid DNA T Ihcrmophilu.t HB27 2~ thermophilas HB? T flav~.~ AT62 2~ caldophilv,¢ GK24 T aquatlc~ YTI Thermu~ "[2
4.1 6.3 14.1 9,8 12,4 0.00(~
f r e q u e n c y o f 7". ther mophilus
C.(~05
HB27 auxotrophic
} pKA 07[ 0c,3 =.l
[ --
pKA210 1
~I,I
pKA216 ]
pUG13
.~1
pKA211 I
pUC19
~/I
I
t
i
II i I
II II I
I I
II I I i u
I
I I-----1
Fig, 2. pKA207 containing Therm~ T'2 Iryptophan syn|helase gen¢~ and its derivative p]asnfids. Location of Ihe trpB,4 genes is shown,
100 markers with HB27 wild type chromosomal DNA varies from 1 to 15% [1], this suggests that T. thermophilus HB27 may have a base excision repair system which is similar to "'hex" system in Streptococcus pneumoniae [17].
4.3. Cloning of Thermus T2 tryptophan synthetase genes A Thermus "I"2 chromosomal DNA gene bank was constructed in E, cell using pUC13 and the resultant recombinant plasmid pKA207 containing the Thermus T2 trpBA genes was selected by colony-hybridization with the previously isolated T. thermophilus HB27 trpB gene as a probe (Fig. 2). Since preliminary hybridization suggested that the trpBA genes ate located in a 3.1 kbp Bglll. BamHI fragment, this fragment was subeloned into pUC13 (making pKA210) and a detailed restriction map was constructed. The 1.8 kbp BgllI-SacI fragment and the 0.95 kbp XhoI fragment on pKA210 insert DNA were also sub. cloned. The nucleotide sequence of the 0.95 kbp Xhol fragment indicated that it coded for a peptide which is homologous to T. thermophilus HB2) trpB peptide (40th to 353th amino acid; data not shown). The possible location of Thermus T2 trpBA genes is shown in Fig, 2.
Pstl~
1
pKA216(4.SKb)
~ EcoRI
'St) .Kpn)
Pstl
PSII phi
18ell Fig, 3. Constructionof Thermt~-E. coli shuttlereeler plasmid
pYKI09.
for use as a shuttle vector for Thermus and /~: coil, using EcoRI as a cloning site.
4.4. Construction of a Thermus plasmid vector
REFERENCES
Vasquez et al, reported that the cryptic plasmid pTT8 (9.7 kbp) is stably maintained in T. thermophilus HB8 and cannot easily be cured [18]. Stable maintenance without selective pressure is a preferable feature of a vector plasmid. We chose this pTTg plasmid as a base plasmid for the construelion of a Thermus vector, The Thermus T2 trpB gene was inserted in the BgllI site of the cryptic plasmld pTl"8 from T. therulophilus HB8 as shown in Fig. 3. After the ligation of BamHl digested pKA216 and Bglll digested pTT8. T. thermophilus HB27 trpB5 was transformed. The recombinant plasmld pYK109 was obtained from a Trp + transformant, E. co// MC1061 was also transformed with pYK109 and the same plasmid was isolated from Apr transformants, pYK109 transformed T, thermophilus HB27 trpB5 to Tip + at the frequency of 106 transfer. mants per/~g DNA. pYK109 should be suitable
Ill Koyama, Y,, Hoshino. T., Tomlzuka, N. and Furukawa, K. (1986)J. Bacieriol. 166,338-340, [2] Koyama, Y. and Furukawa, K. 0990) J, Bacteriol. in pre~s, [3] Casadaban. MJ, and Cohen, SM. (1980)J. MoL Biol.138, 179-207, [4] Vieira,J. and Messing.J. (1982)Gene 19. 259-268, 15] Messing,J. (1983)Methods EnzymoL101, 20-78, Ia] Vieira, J, and Messing,J, 0987) Methods En~ymol. 153, 3-11, [7] Taguchi.H,, Yamashita, M.. Matsuzawa, H. and Ohtu, T, (1982~J. Biochem.91,1343-1348, [8] Salki,T,, Kiraurq, K. and Arima, K. (19"/2) ASfic, Biol. Chum, 36,2357-2366, [91 Brc~k,I.D. and Fr¢~:, H. 11969)J, B=cterioL98. 289297. [t01 Ulrich,3,1",, Mcfetets. G.A. and T~mple, K.L, (1972) J. Bactefiol. llO,691-698, [ll I Oshima,T. and Imahori, K. (1974) Int. J, Syst. Bacteriol, 24.102-112, [121 Nagahari, K.. Koshlkawa. T. and Sakaguchl, K. (1980) Oene 10, 137-145.
101 [13] Hishinuma. F., Tanaka, T. and Sakaguchi, K. 11978) J. Gen. Microbiol. 104, 193 199. [14] Oshima, T. and Baba. M+ {198D Biochem. Biophys. Res. Comm. 103, 156-160. 1151 Maniatis, T., Fritsch, E+F. and Sambrook, J. (1982) Molecular Cloning, Cold Spring Harbor Laboratory.
116] Hudson. J.A., Morgan, H.W. and Daniel R.M. {1986) 1. Gcn. MicrobioL 132+ 531-540. [17] Claverys, J.P., Roger, M and Sicard+ A.M. (]qg0) Mol. Gen. Genet. 178. 191-201. [181 V a ~ u e ~ C., Vitanue, a+ J. and Vicuna. R. (1983) FEBS Left. 158, 339-342.