- Email: [email protected]
A Plasmodium falciparum FK506-binding protein (FKBP) with peptidyl–prolyl cis–trans isomerase and chaperone activities
Molecular & Biochemical Parasitology 139 (2005) 185–195
A Plasmodium falciparum FK506-binding protein (FKBP) with peptidyl–prolyl cis–trans isomerase and chaperone activities Paul Monaghan, Angus Bell∗ Department of Microbiology, Moyne Institute of Preventive Medicine, Trinity College, Dublin 2, Ireland Received in revised form 27 October 2004; accepted 30 October 2004 Available online 2 December 2004
Abstract The immunosuppressive drugs FK506 and rapamycin have anti-malarial properties but their mechanisms of action against malaria parasites remain unknown. The pathway by which these drugs cause immunosuppression in humans is known to involve an FK506-binding protein (FKBP). Homologues of FKBPs have been identified in almost every organism in which they have been sought. Here, we describe the characterisation of the first member of the FKBP family identified in the human malarial parasite, Plasmodium falciparum. This 35-kDa protein, PfFKBP35, comprises a single, N-terminal, FKBP domain and a C-terminal tripartite tetratricopeptide repeat domain. A recombinant form of PfFKBP35, like most other FKBPs, displayed peptidyl–prolyl cis–trans isomerase activity that was inhibitable by FK506 and rapamycin. Unusually the phosphatase activity of calcineurin, the target of the FK506-FKBP complex in T-lymphocytes, was inhibited by PfFKBP35 independently of FK506 binding. PfFKBP35 also inhibited the thermal aggregation in vitro of two model substrates, suggesting that it has general chaperone properties. Analysis of the P. falciparum genome database suggested this to be the only FKBP present in the parasite. The function of this protein remains unknown but the presence of tetratricopeptide repeat motifs suggests a role in intracellular protein transport or modulation of protein function. © 2004 Elsevier B.V. All rights reserved. Keywords: Malaria; Plasmodium; FK506-binding protein; Protein folding; Molecular chaperone
1. Introduction Plasmodium falciparum remains the major human malarial parasite and one of the most important microbial pathogens worldwide [1,2]. The identification of proteins that may serve as novel targets for anti-malarial drugs has intensified in recent years as parasites continue to develop resistance to currently used drugs. The immunosuppressive macrolide drugs FK506 and rapamycin have activity against P. falciparum in culture [3], suggesting the likely presence of a P. falciparum FK506-binding protein (FKBP) homologue.
Abbreviations: CsA, cyclosporin A; FKBP, FK506-binding protein; Hsp, heat shock protein; MBP, maltose binding protein; TPR, tetratricopeptide repeat; p-NA, para-nitroanilide; PPIase, peptidyl–prolyl cis–trans isomerase ∗ Corresponding author. Tel.: +353 1 608 1414; fax: +353 1 679 9294. E-mail address: [email protected] (A. Bell). 0166-6851/$ – see front matter © 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.molbiopara.2004.10.007
The 12-kDa FKBP (hFKBP12) is the major binding protein for both FK506 and rapamycin in human T-lymphocytes [4,5]. Since this protein was first discovered in 1989, a plethora of proteins exhibiting varying degrees of similarity to hFKBP12 have been described in all self-replicating life forms in which they have been sought, with many organisms containing various FKBP isoforms. For example, the human FKBP repertoire includes 16 proteins, ranging from 12 to 135 kDa in size that are distributed amongst a variety of tissues and subcellular compartments [6]. Saccharomyces cerevisiae, whose proteome is comparable in size to that of P. falciparum, has four FKBPs [7]. Certain higher-molecular-weight FKBPs, exemplified by the 52-kDa human isoform hFKBP52, exhibit additional motifs such as tetratricopeptide repeats (TPRs) and calmodulin-binding motifs. TPRs are 34-amino acid repeat motifs that have been identified in a wide range of proteins of diverse biological
186
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
function and are implicated in protein–protein interactions [8,9]. The natural function(s) of FKBPs remain unclear, but the finding that they possess peptidyl–prolyl cis–trans isomerase (PPIase–EC 5.2.1.8) activity in vitro [4,5], is strongly supportive of a role in protein folding. Due to their partial double bond character, peptide bonds can only exist in one of two conformations, cis or trans [10,11]. During protein synthesis, all peptide bonds are inserted into the growing polypeptide chain in the trans conformation due to steric hindrance between the functional groups in the alternative cis conformation. However, analyses of known protein structures show that an estimated 5–7% of peptidyl–prolyl bonds are in the cis conformation [11]. Therefore, in order to achieve their correct three-dimensional structures, many proteins require certain peptidyl–prolyl bonds to be isomerised from the trans to the cis conformation. This isomerisation of specific peptidyl–prolyl bond is one of the slowest steps in protein folding. Certain FKBPs also exhibit chaperone-like activity in vitro, suggesting that they may have a more general role in protein folding [12–17]. A role for FKBPs in regulating cellular signalling events is suggested by their interactions with the receptors for ryanodine [18,19], inositol 1,4,5-trisphosphate [20,21], transforming growth factor- [22,23] and steroid hormones [24]. At least one protozoal FKBP, that of Trypanosoma cruzi, has been implicated in host cell invasion [25]. Although FK506 inhibits the PPIase activity of most FKBPs, this is not its mechanism of immunosuppression. Rather, the binary complex formed between FK506 and hFKBP12 within the cytosol of T-lymphoctyes binds to the serine/threonine protein phosphatase calcineurin. The phosphatase activity of calcineurin is inhibited by this event, thereby disrupting an important signal transduction pathway that ordinarily results in the activation of the T-lymphocyte upon antigen presentation [26]. Neither hFKBP12 nor FK506 alone can bind calcineurin to a significant extent. The first hint of the presence of FKBPs in P. falciparum came from the report of the inhibitory actions of FK506 and rapamycin in cell culture experiments [3]. One possible explanation for the drugs’ effects was that an important cellular process mediated by a putative P. falciparum FKBP was being affected. The first report of an FKBP in this organism was by Braun et al. [27]. It was shown to have a molecular mass of 35 kDa, and was therefore termed PfFKBP35. It was located in the parasite cytosol, and estimated to have an intracellular concentration of 50–100 nM. Independently, we had identified the gene encoding PfFKBP35 by data mining the P. falciparum genome sequence. To gain insights into the antimalarial mechanism of FK506 and rapamycin, with the ultimate hope of designing non-immunosuppressive derivatives with anti-malarial activity, we have cloned and expressed PfFKBP35 and here we report the molecular and biochemical characterisation of this protein, and describe its unusual bifunctional properties.
2. Materials and methods 2.1. Chemicals and reagents FK506 was a kind gift of Fujisawa GmbH (Munich, Germany). Rapamycin and CsA were purchased from Sigma–Aldrich (Tallaght, Ireland). FK506 and rapamycin were prepared as 10 mM stock solutions in ethanol, and cyclosporin A as an 8.3 mM stock solution in 95% ethanol/5% Tween 40. Primers were from Sigma Genosys (Cambridge, UK). All other reagents were from Roche (Lewes, East Sussex, UK) unless otherwise stated. 2.2. Isolation of P. falciparum genomic DNA Asynchronous parasites (clone FCH5.C2), grown in culture as previously described [28], and harvested from human erythrocytes by the method of Zuckerman [29], were lysed in 10 volumes of lysis buffer (10 mM Tris–HCl pH 7.5, 2 mM MgCl2 , 10 mM EDTA, 400 mM NaCl, 5% (v/v) sodium dodecyl sulphate (SDS), 0.2 mg ml−1 proteinase K) overnight at 37 ◦ C. The lysate was incubated with an equal volume of phenol:chloroform:isoamyl alcohol (15:14:1) for 15 min at 65 ◦ C, and centrifuged at 18,000 × g for 10 min. The extraction was repeated before precipitating the genomic DNA from the aqueous phase with ethanol. The precipitated DNA was pelleted by centrifugation at 18,000 × g for 15 min, left to air dry for 10–15 min, and resuspended in an appropriate volume of deionised water. 2.3. Cloning of PfFKBP35 gene The PfFKBP35 sequence was identified in the genome of P. falciparum 3D7 by tBLASTn analysis (http://www. ncbi.nlm.nih.gov/BLAST/) using the consensus FKBP domain amino acid sequence described by Kay [7]. Primers (5 -GCGCGGATCCATGACTACCGAACAAGAATTTG-3 and 5 -GCGCCTGCAGCTTATAAGAAATATTAATTTGC3 ) were used to amplify the coding sequence of the predicted protein with a BamHI site and a PstI site (underlined) at the 5 and 3 ends, respectively, to facilitate subsequent cloning into the pQE30 expression vector (Qiagen). “Hotstart” PCR was performed using ∼2 g genomic DNA, 0.4 M primers, 2.5 U of Pfu Turbo DNA polymerase (Stratagene) and 0.2 mM each of dATP, dTTP, dGTP and dCTP in a Hybaid thermocycler (94 ◦ C for 5 min, 55 ◦ C for 1 min, 72 ◦ C for 1 min; followed by 29 cycles of 94 ◦ C for 1 min, 55 ◦ C for 1 min, 72 ◦ C for 1 min; followed by 1 cycle of 94 ◦ C for 1 min, 55 ◦ C for 1 min, 72 ◦ C for 10 min). The PCR-amplified coding sequence and pQE30 were sequentially digested with BamHI and PstI for 2 h at 37 ◦ C. The products of these reactions were purified using phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation, and ligated together using T4 DNA Ligase at 16 ◦ C overnight. Competent Escherichia coli XL-1 Blue cells were transformed using the heat shock
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
method of Maniaitis et al. [30] and plated on to L-agar supplemented with 100 g ml−1 of ampicillin and incubated overnight at 37 ◦ C. Resulting colonies were screened for the presence of the desired construct (pQE-PfFKBP35) by the method of Birnboim and Doly [31]. Recombinant protein expression was analysed (as described below), but due to low expression levels and difficulties in purifying the recombinant product, the PfFKBP35 gene was sub-cloned into pMAL-c2X (New England Biolabs, Hertfordshire, UK) using the same techniques as above except using pQE-PfFKBP35 as template and E. coli TB1 (New England Biolabs) as the recipient strain, to create pMAL-PfFKBP35. This plasmid served as the template in an inverse PCR to create pMAL-PfFKBP35-His6 . Briefly, a forward primer (5 GCGCCTCGAGTCATTTCTTATAAGCTGCAGGCAAGC3 ) and a reverse primer (5 -GCGCCTCGAGTTAGTGATGGTGATGGTGATGATTTGCACTATTTTTTTTTTC3 ) were used such that priming occurred in opposite directions from the extreme 3 end of the PfFKBP35 coding sequence. This resulted in the replication of pMALPfFKBP35 with the addition of sequence encoding a His6 tag (italicised sequence in reverse primer), a stop codon (double underlined sequence in reverse primer) and a XhoI site (single underlined sequence in reverse primer) at one end, immediately downstream of the PfFKBP35 sequence, and a XhoI site at the other (underlined sequence in forward primer). The PCR conditions and cycle parameters were as above, except with 10 ng of template per reaction, and an elongation time of 16 min. The resulting product was digested with XhoI and subsequently ligated to itself to create pMAL-PfFKBP35-His6 . This construct in turn served as the template in inverse PCRs to generate pMALFKBP-His6 (directs expression of MBP-FKBP-His6 [i.e., the FKBP domain of PfFKBP35 only]) using the primers 5 -GCGCACTAGTCATCACCATCACCATCAC-3 and 5 GCGCACTAGTTCTAAAGCTTAATAATTCAATTTC-3 ; pMAL-TPR-His6 (directs expression of MBP-TPR-His6 [i.e., the TPR domain of PfFKBP35 only]) using the primers 5 -GCGCACTAGTGAAGCTAAAAAAAGTATATAT-3 and 5 -GCGCACTAGTGGATCCGAATTCTGAAATC-3 and pMAL-His8 (directs expression of MBP-His8 ) using the primers 5 -GCGCACTAGTCATCACCATCACCATCAC-3 and 5 -GCGCACTAGTGGATCCGAATTCTGAAATC-3 (the underlined sequence in each of these primers introduced SpeI restriction sites which facilitated recircularisation of the PCR products after treatment with SpeI). 2.4. Reverse transcriptase PCR Two-stage reverse transcriptase PCR was performed on total RNA isolated from P. falciparum using RNA Isolater (Sigma–Aldrich). Firstly, cDNA synthesis was performed on ∼2 g RNA in the presence of oligo(dT)12–18 primer, 0.2 mM of each dNTP, 1/20 RNAguard, 10 mM dithiothreitol and avian myeloblastosis virus reverse transcriptase. The samples were incubated at 42 ◦ C for 45 min, followed by 5 min at
187
95 ◦ C to inactivate the enzyme. Amplification of cDNA was performed as for the PCR described in the cloning section, except with the template being cDNA rather than genomic DNA. 2.5. Overexpression and purification of recombinant PfFKBP35 Recombinant proteins were produced by inoculating L-broth, supplemented with 100 g ml−1 ampicillin, with overnight cultures of the strain of E. coli harbouring the desired plasmid, and grown at 37 ◦ C with agitation at 200 rpm to an A600 of 0.5–0.7. Protein expression was induced by the addition of 0.35 mM isopropyl-l--thiogalactopyranoside (IPTG—Melford Laboratories, UK) and the culture incubated for an additional 3 h. Cells were harvested by centrifugation at 6000 × g for 15 min at 4 ◦ C. Pellets were resuspended in MCAC buffer (25 mM sodium phosphate, 500 mM NaCl, pH 7.4) supplemented with Complete Mini protease inhibitor tablets. The cells were lysed by passage through a French Press, and clarified by spinning at 35,000 × g in an SS-34 rotor (Sorvall) for 1 h at 4 ◦ C. The fusion proteins were purified through (i) a nickel-nitrilotriacetic acidagarose (HiTrap chelating column, Amersham Pharmacia) equilibrated with MCAC buffer, eluted with a step gradient up to 110 mM imidazole, and (ii) a anion-exchange column (Mono Q; Amersham Pharmacia) equilibrated with 20 mM Tris–HCl pH 8.0, 25 mM NaCl, eluted in a step gradient up to 200 mM NaCl. Eluates were concentrated by ultrafiltration through Amicon Ultra 15 concentrators (Millipore), and purity was assessed by SDS-PAGE. Protein concentration was determined by the method of Bradford [32] with bovine serum albumin (Sigma–Aldrich) as the standard. 2.6. PPIase assay The PPIase activity of recombinant proteins was assessed by the method of Kofron et al. [33] using the tetrapeptide substrate succinyl-Ala-Leu-Pro-Phe-p-nitroanilide (Bachem, Bubendorf, Switzerland). All reagents were pre-equilibrated at 0 ◦ C prior to use. In a 1 ml glass cuvette, recombinant protein (50–400 nM final concentration diluted from 120 M stock) was mixed with 100 l ␣-chymotrypsin (Sigma–Aldrich—60 mg ml−1 in 1 mM HCl), and the volume brought up to 975 l with assay buffer (50 mM HEPES, 100 mM NaCl, pH 8.0 at 0 ◦ C). The reaction was initiated by the addition of 25 l substrate (4 mM tetrapeptide in 470 mM anhydrous LiCl prepared in trifluoroethanol [Sigma–Aldrich]). Changes in absorbance due to released pNA were monitored at 390 nm at 0 ◦ C over a 3 min period in a Shimadzu UV-1601PC UV–vis spectrophotometer with a thermostatted cuvette holder. The first order rate constant (k) was calculated from the slope of the plot of ln(Amax –At ) against t, where Amax is the maximum absorbance and At is absorbance at time t. The catalytic efficiency (kcat /Km ) was determined by plotting rate constants against enzyme
188
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
concentration [34]. In assays in which drugs were included, they were added as 1 l amounts of 1000 × the desired concentration, prepared in appropriate solvent (see above). One microliter of solvent alone served as a control. To monitor non-enzymatic spontaneous isomerisation, the assay was performed in the absence of recombinant protein. 2.7. Calcineurin inhibition The phosphatase activity of 40 nM bovine brain calcineurin (Sigma–Aldrich) in the presence or absence of inhibitors was measured using the ProFluor serine/threonine phosphatase assay (Promega). This assay is based on the fluorescence of a rhodamine-conjugated peptide substrate that, upon dephosphorylation by calcineurin, is digested by a protease. Because only the cleaved product is fluorescent, the level of fluorescence can be correlated with calcineurin activity. To ensure that reduction of rhodamine fluorescence was not due to inhibition of the protease, a control aminomethylcoumarin-conjugated peptide, whose fluorescence is independent of phosphorylated state, was incorporated into each reaction. Each reaction (100 l volume), supplemented with calmodulin (Sigma–Aldrich), was performed according to the manufacturer’s instructions. For reactions that included recombinant protein alone or drug alone, 5 l of 20 M stock solution were added (final concentration of 1 M); for reactions that included both recombinant protein and drug, 2.5 l of 40 M stock solutions were used (final concentration of 1 M for both). Fluorescence was monitored using a Perkin-Elmer LS 50B fluorescence spectrometer. 2.8. Citrate synthase aggregation assay The thermal denaturation of pig heart mitochondrial citrate synthase (Sigma–Aldrich) was achieved essentially as described [35]. Prior to use in the assay, the ammonium sulphate suspension of citrate synthase was dialysed into TE buffer (50 mM Tris–HCl pH 8, 2 mM EDTA), concentrated to the original volume in a Microcon-10 concentrator (Millipore), and the concentration was determined according to the Beer-Lambert law, with ε = 1.78 mg ml−1 cm−1 at 280 nm. Citrate synthase (1.5 M monomer) was incubated at 43 ◦ C in 40 mM HEPES pH 7.5 for 30 min and aggregation during the denaturation process was measured by monitoring the increase in absorbance at 360 nm in a Shimadzu UV–1601PC UV–vis spectrophotometer with a thermostatted cuvette holder using a quartz microcuvette. The effects of additional components on citrate synthase aggregation were assessed as described in the results section. 2.9. Rhodanese aggregation assay The thermal denaturation of bovine liver rhodanese (Sigma–Aldrich) was achieved essentially as described [36]. Rhodanese (4.4 M) was incubated at 44 ◦ C in 40 mM sodium phosphate pH 8.0 for 30 min, and aggregation was
monitored as for citrate synthase. The effects of additional components on rhodanese aggregation were assessed as described in the results section. 2.10. Citrate synthase activity assay The ability of MBP-PfFKBP35-His6 to prevent the loss of activity of citrate synthase upon heat treatment was assessed essentially as described [35]. Briefly, citrate synthase (0.15 M monomer) was incubated for 10 min at 43 ◦ C in 40 mM HEPES buffer, pH 7.5. At time points, samples were removed and stored on ice. The activity of citrate synthase remaining in each sample was assayed by mixing 20 l of the sample with 980 l of assay buffer (100 M oxaloacetic acid, 100 M 5,5 -dithio-bis(2-nitrobenzoic acid)), 150 M acetyl CoA [Sigma–Aldrich], made up in TE buffer), and monitoring the increase in absorbance at 412 nm at 25 ◦ C for 3 min. The specific activity of each sample was calculated as described [35]. S. cerevisiae Hsp90 (Sigma–Aldrich) served as a control.
3. Results Previous work by Bell and colleagues had shown that all the detectable PPIase activity in P. falciparum extracts was inhibitable by cyclosporin A (CsA) but not by FK506 or rapamycin, and therefore consisted of one or more cyclophilins (the other main class of PPIases), but no FKBP [3]. Furthermore, we were unable to purify any FKBP from P. falciparum extracts by affinity chromatography using an immobilised FK506 derivative (A. Bell, unpublished data), a technique that has been used successfully in other systems [37]. It was therefore decided to produce PfFKBP35 as a recombinant protein in E. coli. Using the consensus FKBP domain sequence reported by Kay [7], a data mining approach led to the identification of an open-reading frame encoding a putative FKBP in the genome of P. falciparum (http://www.plasmodb.org/; chromosome 12, pfl2275c/). Reverse transcriptase PCR analysis showed this to be expressed in the erythrocytic-stage parasite (data not shown). The protein product was predicted to be 34.8 kDa, and was named PfFKBP35 (GenBank accession no.: NP 701815). Analysis of the derived amino acid sequence of PfFKBP35 showed it to be comprised of a single, N-terminal, FKBP domain and a C-terminal tetratricopeptide repeat (TPR) domain (Fig. 1). The FKBP domain exhibits 44% identity and 72% similarity to the archetypal FKBP, hFKBP12 (Fig. 1A). This degree of similarity is consistent with those of FKBP domains from other proteins. Importantly, from the point of view of correlating the anti-malarial activity of FK506 with effects on the activity of this protein, twelve of the fourteen residues that have been shown in hFKBP12 physically to contact FK506 [7,38] are conserved in the PfFKBP35 sequence (Fig. 1A). The amino acids from hFKBP12 that are known to interact with calcineurin in the hFKBP12-FK506-calcineurin ternary
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
189
Fig. 1. Amino acid sequence analysis of PfFKBP35. (A) Alignment of hFKBP12 with the FKBP domain of PfFKBP35. Identical residues are highlighted in black, with conservative substitutions highlighted in grey. Black circles above the hFKBP12 sequence indicate the residues that interact with FK506, white circles indicate those that interact with calcineurin in the hFKBP12-FK506-calcineurin ternary complex. The double underline indicates an unusual hydrophilic doublet in PfFKBP35. The black star designates a glycine residue that lies on the rear surface of hFKBP12 and is highly conserved throughout the FKBP family, but is substituted by an asparagine in PfFKBP35. The predicted secondary structure of PfFKBP35 corresponds to that of hFKBP12, with the residues forming the five strands of the -sheet (5 comprises two sections) and intervening ␣-helix indicated by  and ␣, respectively. (B) Comparison of the modular structures of representative FKBP domain proteins. Each protein is named according to the organism from which it is obtained (prefix: Pf: Plasmodium falciparum; h: human; Sc: Streptomyces chrysomallus; y: yeast (Saccharomyces cerevisiae)) and its molecular weight in kilodaltons (numerical suffix). Black boxes represent FKBP domains, speckled boxes symbolise TPR motifs, checkered boxes indicate calmodulin-binding motifs, and the hatched box represents a transmembrane segment. The percentage values beneath the FKBP domains refer to their percentage identity to the primary sequence of the FKBP domain of PfFKBP35. Accession numbers are given in parenthesis.
complex [39] show limited conservation in the primary sequence of PfFKBP35 (Fig. 1A). The Gly89/Ile90 doublet in hFKBP12 is a highly conserved region of all FKBPs. Only a handful of known FKBPs exhibit substitutions at this position, and those that do generally retain the hydrophobic character of this dipeptide. The hydrophilic nature of this doublet in PfFKBP35 is striking. Gly69 of hFKBP12 is an exceptionally conserved position throughout the FKBP family. The corresponding residue of PfFKBP35, however, is asparagine. Conserved Domain-BLAST analysis showed the protein to contain three TPR motifs towards the C-terminus (Fig. 1B). These motifs are degenerate 34-amino acid repeats that are structurally homologous, but show little conservation at the
primary sequence level [8,9]. The presence of these repeats is of interest as these are implicated in a diverse range of protein–protein interactions in a multitude of protein families. The overall domain architecture of PfFKBP35 shows remarkable similarity to other known FKBPs, particularly hFKBP36, hFKBP37 and hFKBP38 (Fig. 1B). A recombinant form of PfFKBP35 was generated as a maltose-binding protein (MBP)-fusion (MBP-PfFKBP35). However, this product proved difficult to purify to homogeneity, so the construct was engineered to include a Cterminal His6 tag (Fig. 2). Previous attempts at generating a His6 -PfFKBP35 fusion protein resulted in very poor yields of recombinant protein (data not shown). The resulting re-
190
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
Fig. 2. Production in E. coli and purification of recombinant PfFKBP35 and truncated forms. (A) Schematic representation of the different recombinant proteins generated. All proteins were fused at the N-terminus to MBP (hatched box), and at the C-terminus to His6 (white box—a cloning artifact gave rise to two extra His residues in MBP-His8 ). FKBP-derived domains correspond to Fig. 1C. The numbering above each product refers to the PfFKBP35 residues incorporated between the two tags. (B) SDS-PAGE (12.5%, v/v) gel of purified recombinant proteins (3 g) stained with Coomassie Blue. Lanes 1–4 correspond to proteins 1–4 from panel A (MW: molecular weight standards).
combinant protein (MBP-PfFKBP35-His6 ) was purified by means of nickel-chelate affinity chromatography followed by ion-exchange chromatography (Fig. 2B). Although the Nterminal MBP-tag could be cleaved from the construct by the protease factor Xa (data not shown), the cleaved PfFKBP35His6 proved difficult to purify in sufficient quantities from the resulting mixture. The MBP-PfFKBP35-His6 construct was therefore used for the characterisation studies. In order to exclude any effects of the two tag regions, control experiments in all cases were performed with an MBP-His8 protein purified in the same fashion (Fig. 2B, lane 4—note that a cloning artifact gave rise to two extra His residues). To investigate if MBP-PfFKBP35-His6 possessed PPIase activity, the chymotrypsin-coupled spectrophotometric assay of Kofron et al. [33] was employed. This assay monitors the isomerisation of the peptidyl–prolyl bond in a tetrapeptide (succinyl-Ala-Leu-Pro-Phe) linked at the C-terminus to the chromagen para-nitroanilide (p-NA). The anilide bond tethering the chromagen to the tetrapeptide can be hydrolysed by ␣-chymotrypsin, releasing p-NA into solution, but only when the Leu Pro bond in the test peptide is in the trans conformation. If this bond is initially in the cis conformation, the PPIase activity of an added enzyme can be assessed by monitoring how quickly the ␣-chymotrypsin-mediated cleavage occurs by measuring the concomitant increase in absorbance of free p-NA at 390 nm. MBP-PfFKBP35-His6 exhibited strong PPIase activity (Fig. 3A) with a clear concentrationdependent effect (Fig. 3B), and a catalytic efficiency (kcat /Km ) of 1.7 × 104 s−1 M−1 . This value is within the range reported for FKBPs in the literature, but we cannot rule out the possibility that the MBP and/or His6 tags have had some effect on the catalytic efficiency. Both FK506 and rapamycin inhibited the PPIase activity of MBP-PfFKBP35-His6 with IC50 values of 0.32 M and 0.48 M, respectively, against 0.25 M enzyme (Fig. 3C). CsA, an unrelated immunosuppressive drug
that potently inhibits the enzymatic activity of cyclophilins, had no inhibitory effect at up to 5 M. To ascertain whether this enzymatic activity was attributable to the FKBP domain of the protein, truncated forms of PfFKBP35 were generated. The FKBP domain and the TPR domain of PfFKBP35 were produced as isolated polypeptides, fused at the N-termini to MBP, and at the C-termini to His6 (MBP-FKBP-His6 and MBP-TPR-His6 , respectively (Fig. 2). From analysis of the PPIase activity of these recombinant proteins, it is evident that the PPIase activity of PfFKBP35 is attributed to its N-terminal portion, which encompasses the FKBP domain (Fig. 4). The MBP-His8 control protein conferred no PPIase activity to the recombinant molecule. The fact that the FKBP domain has FK506/rapamycin-inhibitable PPIase activity provides strong evidence that this is, as expected, the drug-binding domain. As was the case for the full-length protein, CsA at up to 5 M had no effect on the PPIase activity of the isolated FKBP domain. To investigate whether the complex of PfFKBP35 and FK506 could inhibit calcineurin, the phosphatase activity of bovine brain calcineurin was measured in the presence and absence of PfFKBP35 and/or FK506 using a fluorescence assay (Fig. 5). Surprisingly, MBP-PfFKBP35-His6 inhibited calcineurin in the absence of FK506, albeit weakly—a phenomenon that has only been reported for one other FKBP, hFKBP38 [40]. FKBP51 has been shown to interact with calcineurin in the absence of FK506 [41], but the phosphatase activity is only inhibited in the presence of FK506 [42]. The C-terminal region of hFKBP51, not the FKBP domain, mediates its interaction with calcineurin [41]. The inhibition of calcineurin by PfFKBP35, however, was mediated through the FKBP domain (Fig. 5). Numerous TPR-containing proteins are known to act as molecular chaperones, including hFKBP51 and hFKBP52
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
191
Fig. 4. PPIase activity of isolated domains of PfFKBP35. The PPIase activities of both the FKBP domain (0.25 M MBP-FKBP-His6 ) and TPR domain (0.25 M MBP-TPR-His6 ) of PfFKBP35 were measured and compared with that of the full-length protein (PPIase activity of 0.25 M MBPPfFKBP35-His6 set as 100%). For the case of MBP-FKBP-His6 , the effects of FK506, rapamycin, CsA (all at 5 M) and drug vehicle (ethanol) on its PPIase activity were also assessed. Bars show SEM of three or more replicates.
the TPR domain that confers such activity. To assess whether this was the case for PfFKBP35, the N-terminal (FKBP) and the C-terminal (TPR) domains (MBP-FKBP-His6 and MBPTPR-His6 respectively) were tested separately against citrate synthase. To our surprise, both domains prevented citrate synthase from aggregating. This effect was also seen for the inhibition of thermal aggregation of another model substrate, rhodanese (Fig. 6B). The MBP-His8 control protein had no chaperone effects in either system. The effect of FK506 on the chaperone activity of MBP-PfFKBP35-His6 , as well as the two separate domains, was assessed in both model systems (Fig. 6C and D). While the drug had no detectable effect on the chaperone abilities of either MBP-PfFKBP35-His6 or
Fig. 3. PPIase activity of recombinant PfFKBP35. (A) Representative curves showing increase in absorbance over time as a consequence of isomerisation of the Leu Pro bond in a synthetic peptide substrate. The peptide and ␣-chymotrypsin were treated with (䊉) no additional protein, () 0.25 M MBP-PfFKBP35-His6 or (♦) 0.25 M MBP-His8 . (B) Concentration-dependence of PPIase activity of MBP-PfFKBP35-His6. The assay was repeated with various concentrations of enzyme, and first order rate constants (k) and the catalytic efficiency (kcat /Km ) were calculated as described in Section 2. The dashed line represents the background isomerisation rate in the absence of enzyme. (C) Effects of () FK506, () rapamycin and (䊉) CsA on PPIase activity of MBP-PfFKBP35-His6 (0.25 M). The activity of 0.25 M MBP-PfFKBP35-His6 in the absence of drug was set at 100%. Bars show SEM of three or more replicates.
[15]. The ability to prevent the thermal aggregation of citrate synthase is the most commonly used model system for assessing chaperone capability of a given protein [35]. Citrate synthase begins to aggregate within 1–2 min of incubation at 43 ◦ C, but in the presence of MBP-PfFKBP35-His6 this aggregation was suppressed (Fig. 6A). For the majority of TPR-containing proteins that exhibit chaperone abilities, it is
Fig. 5. Inhibition of calcineurin by PfFKBP35. Activity of calcineurin was measured by the fluorescence of a rhodamine-conjugated peptide substrate that, upon dephosphorylation by calcineurin, is digested by a protease, releasing highly fluorescent rhodamine. The fluorescence attributable to 40 nM calcineurin was set as 100%. The effects of various proteins and/or drugs on the activity of calcineurin were assessed. All additional components were at 1 M. Bars show the SEM of five or more replicate experiments. To ensure that reduced fluorescence was not due to inhibition of the protease, a control peptide whose fluorescence is independent of phosphorylated state was incorporated into each reaction. No inhibition of protease occurred (data not shown).
192
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
Fig. 6. Inhibition of thermal aggregation of citrate synthase and rhodanese by PfFKBP35. Aggregation of the model substrates was monitored in the absence of additional components (䊉), or in the presence of: MBP-PfFKBP35-His6 (); MBP-FKBP-His6 (); MBP-TPR-His6 (); MBP-His8 (). (A) Chaperone activity of recombinant proteins (1.5 M) on citrate synthase (1.5 M). (B) Chaperone activity of recombinant proteins (4.4 M) on rhodanese (4.4 M). (C) Chaperone activity of recombinant proteins (1.5 M) on citrate synthase (1.5 M) in the presence of FK506 (15 M). (D) Chaperone activity of recombinant proteins (4.4 M) on rhodanese (4.4 M) in the presence of FK506 (22 M).
MBP-TPR-His6 , it did partly suppress the chaperone activity of the MBP-FKBP-His6 . The same effects were found for rapamycin (data not shown). While all molecular chaperones can suppress the aggregation of partner proteins, this does not necessarily mean that they prevent the substrate from losing activity. Hsp90, for example, prevents partner proteins from becoming inactivated, while Hsp25 does not [35]. The activity of citrate synthase was measured during incubation at 43 ◦ C in the presence or absence of MBP-PfFKBP35-His6 . The half-time for the loss of citrate synthase activity in the absence of additional components was 1.1 min, compared to 1.6 min and 7.5 min in the presence of MBP-PfFKBP35-His6 and yeast Hsp90, respectively (Fig. 7).
Comparison of the derived amino acid sequence of the FKBP domain shows it to be highly similar to other FKBPs. Not all FKBPs exhibit PPIase activity in vitro, and many don’t even bind FK506. Those that do interact with the drug
4. Discussion In order to gain insights in the mechanisms of action of FK506 and rapamycin, with the ultimate hope of designing derivatives suitable for malaria chemotherapy, here we provide detailed molecular and biochemical analyses of the first member of the FKBP family to be identified in P. falciparum, PfFKBP35.
Fig. 7. Loss of activity of citrate synthase during incubation at 43 ◦ C. 0.15 M citrate synthase was incubated at 43 ◦ C in the absence of additional components (䊉), or in the presence of: 1.5 M MBP-PfFKBP35-His6 (), or 0.9 M Hsp90 from S. cerevisiae (). At indicated time-points, samples were withdrawn and the remaining activity of citrate synthase was measured. The activity of citrate synthase at time = 0 min was set to 100%. All points represent averaged values from at least two replicate experiments.
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
show an exceptionally high degree of conservation within the fourteen residues of hFKBP12 that are known to interact with FK506, according to the atomic structure of the hFKBP12-FK506 complex [38]. Twelve of these are conserved in PfFKBP35. The Ala81Gly and His87Cys substitutions (nomenclature based on hFKBP12) have been observed in a number of other FKBPs, and are unlikely to have any major impact on drug binding. The substitution of the hydrophobic doublet (Gly89/Ile90) from hFKBP12 to a hydrophilic doublet (Glu108/Ser109) in PfFKBP35 is of interest as this is a highly conserved region of all FKBPs. Due to the positioning of this doublet within a flap region that appears to partially cover FK506 in the hFKBP12-FK506 binary complex, the substitution observed at this region in PfFKBP35 may have important implications for the design of specific inhibitors. Gly69 is not known to be involved in any binding event in hFKBP12, which is unsurprising considering its location on the rear surface of the molecule, far away from the active site and FK506/calcineurin binding region. However, this is an exceptionally conserved position throughout the FKBP family, occurring within a region where two loops that interconnect -strands cross each other—a highly unusual topological feature that, prior to the determination of the structure of FKBP domains, was thought to be prohibited in anti-parallel -sheets due to difficulties in packing side chains efficiently [43]. PfFKBP35’s arrangement of a single, N-terminal, FKBP domain followed by a tripartite TPR domain is strikingly similar to the domain architecture of hFKBP36, hFKBP37 and hFKBP38. Although, hFKBP51 and hFKBP52 each include a second FKBP domain, their overall modular structures are also very similar to PfFKBP35. The presence of the TPR motifs in PfFKBP35 strongly suggests that this protein has the ability to interact with another protein or proteins, and work in our laboratory is currently focussed on identifying intracellular binding partners for PfFKBP35, and ascertaining the involvement of the TPR motifs in any interaction. Various isoforms of FKBPs are often found within the same organism. We scanned the P. falciparum genome database in search of other members of the FKBP family aside from PfFKBP35. Such analysis suggested PfFKBP35 to be the only FKBP expressed by P. falciparum. The presence of only a single FKBP gene is unusual, particularly as the parasite has at least three different cyclophilins, the other major group of PPIases [44]. One model by which FK506 and rapamycin could exert an anti-malarial effect through PfFKBP35, by analogy with the current model of the drugs’ immunosuppressive actions, is that a drug-PfFKBP35 binary complex may be formed that could subsequently inhibit an essential parasite target. The target of FK506-FKBP12 in T-lymphocytes is calcineurin [26], and the target of rapamycin-FKBP12 is TOR (target of rapamycin), a protein serine/threonine kinase [45]. The finding that PfFKBP35 inhibits calcineurin in the absence of FK506 is highly unusual. hFKBP38, which is suggested to
193
regulate important cellular processes by modulating the activity of calcineurin, is the only other FKBP for which this phenomenon has been reported [40]. As noted previously, the domain architectures of hFKBP38 and PfFKBP35 are strikingly similar. Little is known about P. falciparum calcineurin, although activity attributable to a calcineurin-like phosphatase has been identified in parasite extracts [46] and preliminary studies of a recombinant form have recently been reported [47]. Until the function of this parasite phosphatase is characterised in detail, the biological significance, if any, of PfFKBP35’s inhibitory effects on calcineurin will remain unclear. The recombinant forms of PfFKBP35 used throughout these analyses exhibited chaperone activity against two model substrates, citrate synthase and rhodanese. The chaperone activity of MBP-PfFKBP35-His6 was not affected by either FK506 or rapamycin, suggesting that it is independent of PPIase activity. Therefore, it was expected that the chaperone activity of PfFKBP35 would be located exclusively in the TPR domain, as is the case for hFKBP52 [36]. However, when truncated forms of PfFKBP35 were tested, both the FKBP and TPR domains were able to suppress the thermal aggregation of citrate synthase and rhodanese. The FKBP domainassociated chaperone activity was inhibited by FK506 and rapamycin. While the finding that the FKBP domain can act as a chaperone was unexpected and unusual, it is not unprecedented. A 28.3-kDa FKBP from the archaebacterium Methanococcus thermoautotrophicum, which does not include a TPR, prevents the thermal aggregation of rhodanese in vitro [13]. Its FKBP domain alone also displays this activity, albeit it to a lesser extent than the entire protein, suggesting that the FKBP domain contributes to the chaperone activity of PfFKBP35. The natural function of PfFKBP35 within the parasite remains to be elucidated, but these findings suggest that this protein could serve an important role in the folding of proteins, either as a folding catalyst, a chaperone, or both. Additionally, the presence of a TPR domain is highly suggestive of a role in protein transport or modulation of protein function. Our interest in FKBPs of P. falciparum was initiated by the finding that FK506 and rapamycin had anti-malarial activity [3]. This suggested that a then unidentified FKBP was being targeted. The existence of FKBPs in P. falciparum is hardly surprising, considering the diverse range of organisms in which they have previously been described. The finding that PfFKBP35 is apparently the only member of the FKBP family in P. falciparum leads to speculation that the anti-malarial mode of action of both FK506 and rapamycin is mediated through this protein. Further molecular and biochemical characterisation of PfFKBP35 offers the opportunity to study the anti-malarial effects of these compounds in more detail, with the ultimate hope of designing analogues that lack immunosuppressive action and are more potent antimalarials. Further studies of the protein, especially with respect to interacting protein partners, will be invaluable in this regard.
194
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
Acknowledgements This work was supported by grants from the Health Research Board of Ireland (Ref. 40/99) and the Wellcome Trust (Ref. 048253) to A.B.
References [1] L´opez-Antu˜nano FJ, Schmunis GA. Plasmodia in humans. In: Kreier JP, editor. Parasitic protozoa, vol. 5. San Diego: Academic Press; 1993. p. 135–266. [2] Bremen JG. The ears of the hippopotamus: manifestations, determinants, and estimates of the malaria burden. Am J Trop Med Hyg 2001;64S:1–11. [3] Bell A, Wernli B, Franklin RM. Roles of peptidyl–prolyl cis–trans isomerase and calcineurin in the mechanisms of antimalarial action of cyclosporin A, FK506, and rapamycin. Biochem Pharmacol 1994;48:495–503. [4] Harding MW, Galat A, Uehling DE, Schreiber SL. A receptor for the immunosuppressant FK506 is a cis–trans peptidyl–prolyl isomerase. Nature 1989;341:758–60. [5] Siekierka JJ, Hung SHY, Poe M, Lin CS, Sigal NH. A cytosolic binding protein for the immunosuppressant FK506 has peptidyl–prolyl isomerase activity but is distinct from cyclophilin. Nature 1989;341:755–7. [6] Fischer G, Aum¨uller T. Regulation of peptide bond cis/trans isomerization by enzyme catalysis and its implication in physiological processes. Rev Physiol Biochem Pharmacol 2003;148:105–50. [7] Kay JE. Structure-function relationships in the FK506-binding protein (FKBP) family of peptidylprolyl cis–trans isomerases. Biochem J 1996;314:361–85. [8] Blatch GL, L¨assle M. The tetratricopeptide repeat: a structural motif mediating protein–protein interactions. Bioessays 1999;21:932–9. [9] D’Andrea LD, Regan L. TPR proteins: the versatile helix. Trends Biochem Sci 2003;28:655–62. [10] Galat A, Metcalfe SM. Peptidylproline cis/trans isomerases. Prog Biophys Mol Biol 1995;63:67–118. [11] Pal D, Chakrabarti P. Cis peptide bonds in proteins: residues involved, their conformations, interactions and locations. J Mol Biol 1999;294:271–88. [12] Scholz C, Stoller G, Zarnt T, Fischer G, Schmid FX. Cooperation of enzymatic and chaperone functions of trigger factor in the catalysis of protein folding. EMBO J 1997;16:54–8. [13] Ideno A, Yoshida T, Furutani M, Maruyama T. The 28.3 kDa FK506 binding protein from a thermophilic archaeum, Methanobacterium thermoautotrophicum, protects the denaturation of proteins in vitro. Eur J Biochem 2000;267:3139–48. [14] Ari´e JP, Sassoon N, Betton JM. Chaperone function of FkpA, a heat shock prolyl isomerase, in the periplasm of Escherichia coli. Mol Microbiol 2001;39:199–210. [15] Pirkl F, Buchner J. Functional analysis of the Hsp90-assocaited human peptidyl prolyl cis/trans isomerases FKBP51, FKBP52 and Cyp40. J Mol Biol 2001;308:795–806. [16] Kamphausen T, Fangh¨anel J, Neumann D, Schulz B, Rahfeld JU. Characterisation of Arabidopsis thaliana AtFKBP42 that is membrane-bound and interacts with Hsp90. Plant J 2002;32:263–76. [17] Suzuki R, Nagata K, Yumoto F, et al. Three-dimensional solution structure of an archael FKBP with a dual function of peptidyl prolyl cis–trans isomerase and chaperone-like activities. J Mol Biol 2003;328:1149–60. [18] Jayaraman T, Brilliantes AM, Timerman AP, et al. FK506 binding protein associated with the calcium release channel (ryanodine channel). J Biol Chem 1992;267:9474–7.
[19] Brilliantes AMB, Ondraiˇs K, Scott A, et al. Stabilisation of calcium release channel (ryanodine receptor) function by FK506-binding protein. Cell 1994;77:513–23. [20] Cameron AM, Steiner JP, Sabatini DM, Kaplin AI, Walensky LD, Snyder SH. Immunophilin FK506 binding protein associated with inositol 1,4,5-trisphosphate receptor modulates calcium flux. Proc Natl Acad Sci USA 1995;92:1784–8. [21] Cameron AM, Nucifora FC, Fung ET, et al. FKBP12 binds the inositol 1,4,5-trisphosphate receptor at leucine-proline (1400-1401) and anchors calcineurin to this FK506-like domain. J Biol Chem 1997;272:27582–8. [22] Wang T, Li BY, Danielson PD, et al. The immunophilin FKBP12 functions as a common inhibitor of the TGF family type I receptors. Cell 1996;86:435–44. [23] Chen YG, Liu F, Massagu´e J. Mechanism of TGF receptor inhibition by FKBP12. EMBO J 1997;16:3866–76. [24] Pratt WB, Toft DO. Regulation of signalling protein function and trafficking by the hsp90/hsp70-based chaperone machinery. Exp Biol Med 2003;228:111–33. [25] Moro A, Ruiz-Cabello F, Fernandez-Cano A, Stock SP, Gonzalez A. Secretion by Trypanosoma cruzi of a peptidyl–prolyl cis–trans isomerase involved in cell infection. EMBO J 1995;14:2483– 90. [26] Schreiber SL, Crabtree GR. The mechanism of action of cyclosporin A and FK506. Immunol Today 1992;13:136–42. [27] Braun PD, Barglow KT, Lin Y, et al. A bifunctional molecule that displays context-dependent cellular activity. J Am Chem Soc 2003;125:7575–80. [28] Bell A, Wernli B, Franklin RM. Effects of microtubule inhibitors on protein synthesis in Plasmodium falciparum. Parasitol Res 1993;79:146–52. [29] Zuckerman A. Harvesting of Plasmodium falciparum with saponin. Bull WHO 1967;37:431–6. [30] Maniatis T, Fritsch EF, Sambrook J. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press; 1982. [31] Birnboim HC, Doly J. A rapid alkaline extraction procedure for the screening of recombinant plasmid DNA. Nuclei Acid Res 1979;7:1513. [32] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilising the principle of protein dye binding. Anal Biochem 1976;72:248–54. [33] Kofron JL, Kuzmic P, Kishore V, Colon-Bonilla E, Rich DH. Determination of kinetic constants for peptidyl prolyl cis–trans isomerases by an improved spectrophotometric assay. Biochemistry 1991;30:6127–34. [34] Harrison RK, Stein RL. Substrate specificities of the peptidyl prolyl cis–trans isomerase activities of cyclophilin and FK-506 binding protein: evidence for the existence of a family of distinct enzymes. Biochemistry 1990;29:3813–6. [35] Buchner J, Grallert H, Jakob U. Analysis of chaperone function using citrate synthase as nonnative substrate protein. Method Enzymol 1998;290:323–38. [36] Pirkl F, Fischer E, Modrow S, Buchner J. Localization of the chaperone domain of FKBP52. J Biol Chem 2001;276:37034–41. [37] Manning-Krieg UC, Henr´ıquez R, Cammas F, Graff P, Gav´eriaux S, Movva NR. Purification of FKBP-70, a novel immunophilin from Saccharomyces cerevisiae, and cloning of its structural gene FPR3. FEBS Lett 1994;352:98–103. [38] van Duyne GD, Standaert RF, Karplus PA, Schreiber SL, Clardy J. Atomic structure of the human FKBP-12 complexes with FK506 and rapamycin. J Mol Biol 1993;229:105–24. [39] Ke H, Huai Q. Structures of calcineurin and its complexes with immunophilins-immunosuppressants. Biochem Biophys Res Commun 2003;311:1095–102. [40] Shirane M, Nakayama KI. Inherent calcineurin inhibitor FKBP38 targets Bcl-2 to mitochondria and inhibts apoptosis. Nature Cell Biol 2003;5:1–10.
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195 [41] Li TK, Baksh S, Cristillo AD, Bierer BE. Calcium- and FK506independent interaction between immunophilin FKBP51 and calcineurin. J Cell Biochem 2002;84:460–71. [42] Baughman G, Wiederrecht GL, Chang F, Martin MM, Bourgeois S. Tissue distribution and abundance of human FKBP51, an FK506binding protein that can mediate calcineurin inhibition. Biochem Biophys Res Commun 1997;232:437–43. [43] Richardson JS. -Sheet topology and the relatedness of proteins. Nature 1977;268:495–500. [44] Gavigan CS, Kiely SP, Hirtzlin J, Bell A. Cyclosporin-binding proteins of Plasmodium falciparum. Int J Parasitol 2003;33:987–96.
195
[45] Lorberg A, Hall MN. TOR: the first 10 years. Curr Opin Microbiol Immunol 2004;279:1–18. [46] Dobson S, May T, Berriman M, et al. Characterization of protein ser/thr phosphatases of the malaria parasite, Plasmodium falciparum: inhibition of the parasite calcineurin by cyclophilin-cyclosporin complex. Mol Biochem Parasitol 1999;99:167–81. [47] Kumar R, Musiyenko A, Oldenburg A, Adams B, Barik S. Posttranslational generation of constitutively active cores from larger phosphatases in the malarial parasite Plasmodium falciparum: implications for proteomics. BMC Mol Biol 2004;5:6.
A Plasmodium falciparum FK506-binding protein (FKBP) with peptidyl–prolyl cis–trans isomerase and chaperone activities Paul Monaghan, Angus Bell∗ Department of Microbiology, Moyne Institute of Preventive Medicine, Trinity College, Dublin 2, Ireland Received in revised form 27 October 2004; accepted 30 October 2004 Available online 2 December 2004
Abstract The immunosuppressive drugs FK506 and rapamycin have anti-malarial properties but their mechanisms of action against malaria parasites remain unknown. The pathway by which these drugs cause immunosuppression in humans is known to involve an FK506-binding protein (FKBP). Homologues of FKBPs have been identified in almost every organism in which they have been sought. Here, we describe the characterisation of the first member of the FKBP family identified in the human malarial parasite, Plasmodium falciparum. This 35-kDa protein, PfFKBP35, comprises a single, N-terminal, FKBP domain and a C-terminal tripartite tetratricopeptide repeat domain. A recombinant form of PfFKBP35, like most other FKBPs, displayed peptidyl–prolyl cis–trans isomerase activity that was inhibitable by FK506 and rapamycin. Unusually the phosphatase activity of calcineurin, the target of the FK506-FKBP complex in T-lymphocytes, was inhibited by PfFKBP35 independently of FK506 binding. PfFKBP35 also inhibited the thermal aggregation in vitro of two model substrates, suggesting that it has general chaperone properties. Analysis of the P. falciparum genome database suggested this to be the only FKBP present in the parasite. The function of this protein remains unknown but the presence of tetratricopeptide repeat motifs suggests a role in intracellular protein transport or modulation of protein function. © 2004 Elsevier B.V. All rights reserved. Keywords: Malaria; Plasmodium; FK506-binding protein; Protein folding; Molecular chaperone
1. Introduction Plasmodium falciparum remains the major human malarial parasite and one of the most important microbial pathogens worldwide [1,2]. The identification of proteins that may serve as novel targets for anti-malarial drugs has intensified in recent years as parasites continue to develop resistance to currently used drugs. The immunosuppressive macrolide drugs FK506 and rapamycin have activity against P. falciparum in culture [3], suggesting the likely presence of a P. falciparum FK506-binding protein (FKBP) homologue.
Abbreviations: CsA, cyclosporin A; FKBP, FK506-binding protein; Hsp, heat shock protein; MBP, maltose binding protein; TPR, tetratricopeptide repeat; p-NA, para-nitroanilide; PPIase, peptidyl–prolyl cis–trans isomerase ∗ Corresponding author. Tel.: +353 1 608 1414; fax: +353 1 679 9294. E-mail address: [email protected] (A. Bell). 0166-6851/$ – see front matter © 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.molbiopara.2004.10.007
The 12-kDa FKBP (hFKBP12) is the major binding protein for both FK506 and rapamycin in human T-lymphocytes [4,5]. Since this protein was first discovered in 1989, a plethora of proteins exhibiting varying degrees of similarity to hFKBP12 have been described in all self-replicating life forms in which they have been sought, with many organisms containing various FKBP isoforms. For example, the human FKBP repertoire includes 16 proteins, ranging from 12 to 135 kDa in size that are distributed amongst a variety of tissues and subcellular compartments [6]. Saccharomyces cerevisiae, whose proteome is comparable in size to that of P. falciparum, has four FKBPs [7]. Certain higher-molecular-weight FKBPs, exemplified by the 52-kDa human isoform hFKBP52, exhibit additional motifs such as tetratricopeptide repeats (TPRs) and calmodulin-binding motifs. TPRs are 34-amino acid repeat motifs that have been identified in a wide range of proteins of diverse biological
186
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
function and are implicated in protein–protein interactions [8,9]. The natural function(s) of FKBPs remain unclear, but the finding that they possess peptidyl–prolyl cis–trans isomerase (PPIase–EC 5.2.1.8) activity in vitro [4,5], is strongly supportive of a role in protein folding. Due to their partial double bond character, peptide bonds can only exist in one of two conformations, cis or trans [10,11]. During protein synthesis, all peptide bonds are inserted into the growing polypeptide chain in the trans conformation due to steric hindrance between the functional groups in the alternative cis conformation. However, analyses of known protein structures show that an estimated 5–7% of peptidyl–prolyl bonds are in the cis conformation [11]. Therefore, in order to achieve their correct three-dimensional structures, many proteins require certain peptidyl–prolyl bonds to be isomerised from the trans to the cis conformation. This isomerisation of specific peptidyl–prolyl bond is one of the slowest steps in protein folding. Certain FKBPs also exhibit chaperone-like activity in vitro, suggesting that they may have a more general role in protein folding [12–17]. A role for FKBPs in regulating cellular signalling events is suggested by their interactions with the receptors for ryanodine [18,19], inositol 1,4,5-trisphosphate [20,21], transforming growth factor- [22,23] and steroid hormones [24]. At least one protozoal FKBP, that of Trypanosoma cruzi, has been implicated in host cell invasion [25]. Although FK506 inhibits the PPIase activity of most FKBPs, this is not its mechanism of immunosuppression. Rather, the binary complex formed between FK506 and hFKBP12 within the cytosol of T-lymphoctyes binds to the serine/threonine protein phosphatase calcineurin. The phosphatase activity of calcineurin is inhibited by this event, thereby disrupting an important signal transduction pathway that ordinarily results in the activation of the T-lymphocyte upon antigen presentation [26]. Neither hFKBP12 nor FK506 alone can bind calcineurin to a significant extent. The first hint of the presence of FKBPs in P. falciparum came from the report of the inhibitory actions of FK506 and rapamycin in cell culture experiments [3]. One possible explanation for the drugs’ effects was that an important cellular process mediated by a putative P. falciparum FKBP was being affected. The first report of an FKBP in this organism was by Braun et al. [27]. It was shown to have a molecular mass of 35 kDa, and was therefore termed PfFKBP35. It was located in the parasite cytosol, and estimated to have an intracellular concentration of 50–100 nM. Independently, we had identified the gene encoding PfFKBP35 by data mining the P. falciparum genome sequence. To gain insights into the antimalarial mechanism of FK506 and rapamycin, with the ultimate hope of designing non-immunosuppressive derivatives with anti-malarial activity, we have cloned and expressed PfFKBP35 and here we report the molecular and biochemical characterisation of this protein, and describe its unusual bifunctional properties.
2. Materials and methods 2.1. Chemicals and reagents FK506 was a kind gift of Fujisawa GmbH (Munich, Germany). Rapamycin and CsA were purchased from Sigma–Aldrich (Tallaght, Ireland). FK506 and rapamycin were prepared as 10 mM stock solutions in ethanol, and cyclosporin A as an 8.3 mM stock solution in 95% ethanol/5% Tween 40. Primers were from Sigma Genosys (Cambridge, UK). All other reagents were from Roche (Lewes, East Sussex, UK) unless otherwise stated. 2.2. Isolation of P. falciparum genomic DNA Asynchronous parasites (clone FCH5.C2), grown in culture as previously described [28], and harvested from human erythrocytes by the method of Zuckerman [29], were lysed in 10 volumes of lysis buffer (10 mM Tris–HCl pH 7.5, 2 mM MgCl2 , 10 mM EDTA, 400 mM NaCl, 5% (v/v) sodium dodecyl sulphate (SDS), 0.2 mg ml−1 proteinase K) overnight at 37 ◦ C. The lysate was incubated with an equal volume of phenol:chloroform:isoamyl alcohol (15:14:1) for 15 min at 65 ◦ C, and centrifuged at 18,000 × g for 10 min. The extraction was repeated before precipitating the genomic DNA from the aqueous phase with ethanol. The precipitated DNA was pelleted by centrifugation at 18,000 × g for 15 min, left to air dry for 10–15 min, and resuspended in an appropriate volume of deionised water. 2.3. Cloning of PfFKBP35 gene The PfFKBP35 sequence was identified in the genome of P. falciparum 3D7 by tBLASTn analysis (http://www. ncbi.nlm.nih.gov/BLAST/) using the consensus FKBP domain amino acid sequence described by Kay [7]. Primers (5 -GCGCGGATCCATGACTACCGAACAAGAATTTG-3 and 5 -GCGCCTGCAGCTTATAAGAAATATTAATTTGC3 ) were used to amplify the coding sequence of the predicted protein with a BamHI site and a PstI site (underlined) at the 5 and 3 ends, respectively, to facilitate subsequent cloning into the pQE30 expression vector (Qiagen). “Hotstart” PCR was performed using ∼2 g genomic DNA, 0.4 M primers, 2.5 U of Pfu Turbo DNA polymerase (Stratagene) and 0.2 mM each of dATP, dTTP, dGTP and dCTP in a Hybaid thermocycler (94 ◦ C for 5 min, 55 ◦ C for 1 min, 72 ◦ C for 1 min; followed by 29 cycles of 94 ◦ C for 1 min, 55 ◦ C for 1 min, 72 ◦ C for 1 min; followed by 1 cycle of 94 ◦ C for 1 min, 55 ◦ C for 1 min, 72 ◦ C for 10 min). The PCR-amplified coding sequence and pQE30 were sequentially digested with BamHI and PstI for 2 h at 37 ◦ C. The products of these reactions were purified using phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation, and ligated together using T4 DNA Ligase at 16 ◦ C overnight. Competent Escherichia coli XL-1 Blue cells were transformed using the heat shock
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
method of Maniaitis et al. [30] and plated on to L-agar supplemented with 100 g ml−1 of ampicillin and incubated overnight at 37 ◦ C. Resulting colonies were screened for the presence of the desired construct (pQE-PfFKBP35) by the method of Birnboim and Doly [31]. Recombinant protein expression was analysed (as described below), but due to low expression levels and difficulties in purifying the recombinant product, the PfFKBP35 gene was sub-cloned into pMAL-c2X (New England Biolabs, Hertfordshire, UK) using the same techniques as above except using pQE-PfFKBP35 as template and E. coli TB1 (New England Biolabs) as the recipient strain, to create pMAL-PfFKBP35. This plasmid served as the template in an inverse PCR to create pMAL-PfFKBP35-His6 . Briefly, a forward primer (5 GCGCCTCGAGTCATTTCTTATAAGCTGCAGGCAAGC3 ) and a reverse primer (5 -GCGCCTCGAGTTAGTGATGGTGATGGTGATGATTTGCACTATTTTTTTTTTC3 ) were used such that priming occurred in opposite directions from the extreme 3 end of the PfFKBP35 coding sequence. This resulted in the replication of pMALPfFKBP35 with the addition of sequence encoding a His6 tag (italicised sequence in reverse primer), a stop codon (double underlined sequence in reverse primer) and a XhoI site (single underlined sequence in reverse primer) at one end, immediately downstream of the PfFKBP35 sequence, and a XhoI site at the other (underlined sequence in forward primer). The PCR conditions and cycle parameters were as above, except with 10 ng of template per reaction, and an elongation time of 16 min. The resulting product was digested with XhoI and subsequently ligated to itself to create pMAL-PfFKBP35-His6 . This construct in turn served as the template in inverse PCRs to generate pMALFKBP-His6 (directs expression of MBP-FKBP-His6 [i.e., the FKBP domain of PfFKBP35 only]) using the primers 5 -GCGCACTAGTCATCACCATCACCATCAC-3 and 5 GCGCACTAGTTCTAAAGCTTAATAATTCAATTTC-3 ; pMAL-TPR-His6 (directs expression of MBP-TPR-His6 [i.e., the TPR domain of PfFKBP35 only]) using the primers 5 -GCGCACTAGTGAAGCTAAAAAAAGTATATAT-3 and 5 -GCGCACTAGTGGATCCGAATTCTGAAATC-3 and pMAL-His8 (directs expression of MBP-His8 ) using the primers 5 -GCGCACTAGTCATCACCATCACCATCAC-3 and 5 -GCGCACTAGTGGATCCGAATTCTGAAATC-3 (the underlined sequence in each of these primers introduced SpeI restriction sites which facilitated recircularisation of the PCR products after treatment with SpeI). 2.4. Reverse transcriptase PCR Two-stage reverse transcriptase PCR was performed on total RNA isolated from P. falciparum using RNA Isolater (Sigma–Aldrich). Firstly, cDNA synthesis was performed on ∼2 g RNA in the presence of oligo(dT)12–18 primer, 0.2 mM of each dNTP, 1/20 RNAguard, 10 mM dithiothreitol and avian myeloblastosis virus reverse transcriptase. The samples were incubated at 42 ◦ C for 45 min, followed by 5 min at
187
95 ◦ C to inactivate the enzyme. Amplification of cDNA was performed as for the PCR described in the cloning section, except with the template being cDNA rather than genomic DNA. 2.5. Overexpression and purification of recombinant PfFKBP35 Recombinant proteins were produced by inoculating L-broth, supplemented with 100 g ml−1 ampicillin, with overnight cultures of the strain of E. coli harbouring the desired plasmid, and grown at 37 ◦ C with agitation at 200 rpm to an A600 of 0.5–0.7. Protein expression was induced by the addition of 0.35 mM isopropyl-l--thiogalactopyranoside (IPTG—Melford Laboratories, UK) and the culture incubated for an additional 3 h. Cells were harvested by centrifugation at 6000 × g for 15 min at 4 ◦ C. Pellets were resuspended in MCAC buffer (25 mM sodium phosphate, 500 mM NaCl, pH 7.4) supplemented with Complete Mini protease inhibitor tablets. The cells were lysed by passage through a French Press, and clarified by spinning at 35,000 × g in an SS-34 rotor (Sorvall) for 1 h at 4 ◦ C. The fusion proteins were purified through (i) a nickel-nitrilotriacetic acidagarose (HiTrap chelating column, Amersham Pharmacia) equilibrated with MCAC buffer, eluted with a step gradient up to 110 mM imidazole, and (ii) a anion-exchange column (Mono Q; Amersham Pharmacia) equilibrated with 20 mM Tris–HCl pH 8.0, 25 mM NaCl, eluted in a step gradient up to 200 mM NaCl. Eluates were concentrated by ultrafiltration through Amicon Ultra 15 concentrators (Millipore), and purity was assessed by SDS-PAGE. Protein concentration was determined by the method of Bradford [32] with bovine serum albumin (Sigma–Aldrich) as the standard. 2.6. PPIase assay The PPIase activity of recombinant proteins was assessed by the method of Kofron et al. [33] using the tetrapeptide substrate succinyl-Ala-Leu-Pro-Phe-p-nitroanilide (Bachem, Bubendorf, Switzerland). All reagents were pre-equilibrated at 0 ◦ C prior to use. In a 1 ml glass cuvette, recombinant protein (50–400 nM final concentration diluted from 120 M stock) was mixed with 100 l ␣-chymotrypsin (Sigma–Aldrich—60 mg ml−1 in 1 mM HCl), and the volume brought up to 975 l with assay buffer (50 mM HEPES, 100 mM NaCl, pH 8.0 at 0 ◦ C). The reaction was initiated by the addition of 25 l substrate (4 mM tetrapeptide in 470 mM anhydrous LiCl prepared in trifluoroethanol [Sigma–Aldrich]). Changes in absorbance due to released pNA were monitored at 390 nm at 0 ◦ C over a 3 min period in a Shimadzu UV-1601PC UV–vis spectrophotometer with a thermostatted cuvette holder. The first order rate constant (k) was calculated from the slope of the plot of ln(Amax –At ) against t, where Amax is the maximum absorbance and At is absorbance at time t. The catalytic efficiency (kcat /Km ) was determined by plotting rate constants against enzyme
188
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
concentration [34]. In assays in which drugs were included, they were added as 1 l amounts of 1000 × the desired concentration, prepared in appropriate solvent (see above). One microliter of solvent alone served as a control. To monitor non-enzymatic spontaneous isomerisation, the assay was performed in the absence of recombinant protein. 2.7. Calcineurin inhibition The phosphatase activity of 40 nM bovine brain calcineurin (Sigma–Aldrich) in the presence or absence of inhibitors was measured using the ProFluor serine/threonine phosphatase assay (Promega). This assay is based on the fluorescence of a rhodamine-conjugated peptide substrate that, upon dephosphorylation by calcineurin, is digested by a protease. Because only the cleaved product is fluorescent, the level of fluorescence can be correlated with calcineurin activity. To ensure that reduction of rhodamine fluorescence was not due to inhibition of the protease, a control aminomethylcoumarin-conjugated peptide, whose fluorescence is independent of phosphorylated state, was incorporated into each reaction. Each reaction (100 l volume), supplemented with calmodulin (Sigma–Aldrich), was performed according to the manufacturer’s instructions. For reactions that included recombinant protein alone or drug alone, 5 l of 20 M stock solution were added (final concentration of 1 M); for reactions that included both recombinant protein and drug, 2.5 l of 40 M stock solutions were used (final concentration of 1 M for both). Fluorescence was monitored using a Perkin-Elmer LS 50B fluorescence spectrometer. 2.8. Citrate synthase aggregation assay The thermal denaturation of pig heart mitochondrial citrate synthase (Sigma–Aldrich) was achieved essentially as described [35]. Prior to use in the assay, the ammonium sulphate suspension of citrate synthase was dialysed into TE buffer (50 mM Tris–HCl pH 8, 2 mM EDTA), concentrated to the original volume in a Microcon-10 concentrator (Millipore), and the concentration was determined according to the Beer-Lambert law, with ε = 1.78 mg ml−1 cm−1 at 280 nm. Citrate synthase (1.5 M monomer) was incubated at 43 ◦ C in 40 mM HEPES pH 7.5 for 30 min and aggregation during the denaturation process was measured by monitoring the increase in absorbance at 360 nm in a Shimadzu UV–1601PC UV–vis spectrophotometer with a thermostatted cuvette holder using a quartz microcuvette. The effects of additional components on citrate synthase aggregation were assessed as described in the results section. 2.9. Rhodanese aggregation assay The thermal denaturation of bovine liver rhodanese (Sigma–Aldrich) was achieved essentially as described [36]. Rhodanese (4.4 M) was incubated at 44 ◦ C in 40 mM sodium phosphate pH 8.0 for 30 min, and aggregation was
monitored as for citrate synthase. The effects of additional components on rhodanese aggregation were assessed as described in the results section. 2.10. Citrate synthase activity assay The ability of MBP-PfFKBP35-His6 to prevent the loss of activity of citrate synthase upon heat treatment was assessed essentially as described [35]. Briefly, citrate synthase (0.15 M monomer) was incubated for 10 min at 43 ◦ C in 40 mM HEPES buffer, pH 7.5. At time points, samples were removed and stored on ice. The activity of citrate synthase remaining in each sample was assayed by mixing 20 l of the sample with 980 l of assay buffer (100 M oxaloacetic acid, 100 M 5,5 -dithio-bis(2-nitrobenzoic acid)), 150 M acetyl CoA [Sigma–Aldrich], made up in TE buffer), and monitoring the increase in absorbance at 412 nm at 25 ◦ C for 3 min. The specific activity of each sample was calculated as described [35]. S. cerevisiae Hsp90 (Sigma–Aldrich) served as a control.
3. Results Previous work by Bell and colleagues had shown that all the detectable PPIase activity in P. falciparum extracts was inhibitable by cyclosporin A (CsA) but not by FK506 or rapamycin, and therefore consisted of one or more cyclophilins (the other main class of PPIases), but no FKBP [3]. Furthermore, we were unable to purify any FKBP from P. falciparum extracts by affinity chromatography using an immobilised FK506 derivative (A. Bell, unpublished data), a technique that has been used successfully in other systems [37]. It was therefore decided to produce PfFKBP35 as a recombinant protein in E. coli. Using the consensus FKBP domain sequence reported by Kay [7], a data mining approach led to the identification of an open-reading frame encoding a putative FKBP in the genome of P. falciparum (http://www.plasmodb.org/; chromosome 12, pfl2275c/). Reverse transcriptase PCR analysis showed this to be expressed in the erythrocytic-stage parasite (data not shown). The protein product was predicted to be 34.8 kDa, and was named PfFKBP35 (GenBank accession no.: NP 701815). Analysis of the derived amino acid sequence of PfFKBP35 showed it to be comprised of a single, N-terminal, FKBP domain and a C-terminal tetratricopeptide repeat (TPR) domain (Fig. 1). The FKBP domain exhibits 44% identity and 72% similarity to the archetypal FKBP, hFKBP12 (Fig. 1A). This degree of similarity is consistent with those of FKBP domains from other proteins. Importantly, from the point of view of correlating the anti-malarial activity of FK506 with effects on the activity of this protein, twelve of the fourteen residues that have been shown in hFKBP12 physically to contact FK506 [7,38] are conserved in the PfFKBP35 sequence (Fig. 1A). The amino acids from hFKBP12 that are known to interact with calcineurin in the hFKBP12-FK506-calcineurin ternary
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
189
Fig. 1. Amino acid sequence analysis of PfFKBP35. (A) Alignment of hFKBP12 with the FKBP domain of PfFKBP35. Identical residues are highlighted in black, with conservative substitutions highlighted in grey. Black circles above the hFKBP12 sequence indicate the residues that interact with FK506, white circles indicate those that interact with calcineurin in the hFKBP12-FK506-calcineurin ternary complex. The double underline indicates an unusual hydrophilic doublet in PfFKBP35. The black star designates a glycine residue that lies on the rear surface of hFKBP12 and is highly conserved throughout the FKBP family, but is substituted by an asparagine in PfFKBP35. The predicted secondary structure of PfFKBP35 corresponds to that of hFKBP12, with the residues forming the five strands of the -sheet (5 comprises two sections) and intervening ␣-helix indicated by  and ␣, respectively. (B) Comparison of the modular structures of representative FKBP domain proteins. Each protein is named according to the organism from which it is obtained (prefix: Pf: Plasmodium falciparum; h: human; Sc: Streptomyces chrysomallus; y: yeast (Saccharomyces cerevisiae)) and its molecular weight in kilodaltons (numerical suffix). Black boxes represent FKBP domains, speckled boxes symbolise TPR motifs, checkered boxes indicate calmodulin-binding motifs, and the hatched box represents a transmembrane segment. The percentage values beneath the FKBP domains refer to their percentage identity to the primary sequence of the FKBP domain of PfFKBP35. Accession numbers are given in parenthesis.
complex [39] show limited conservation in the primary sequence of PfFKBP35 (Fig. 1A). The Gly89/Ile90 doublet in hFKBP12 is a highly conserved region of all FKBPs. Only a handful of known FKBPs exhibit substitutions at this position, and those that do generally retain the hydrophobic character of this dipeptide. The hydrophilic nature of this doublet in PfFKBP35 is striking. Gly69 of hFKBP12 is an exceptionally conserved position throughout the FKBP family. The corresponding residue of PfFKBP35, however, is asparagine. Conserved Domain-BLAST analysis showed the protein to contain three TPR motifs towards the C-terminus (Fig. 1B). These motifs are degenerate 34-amino acid repeats that are structurally homologous, but show little conservation at the
primary sequence level [8,9]. The presence of these repeats is of interest as these are implicated in a diverse range of protein–protein interactions in a multitude of protein families. The overall domain architecture of PfFKBP35 shows remarkable similarity to other known FKBPs, particularly hFKBP36, hFKBP37 and hFKBP38 (Fig. 1B). A recombinant form of PfFKBP35 was generated as a maltose-binding protein (MBP)-fusion (MBP-PfFKBP35). However, this product proved difficult to purify to homogeneity, so the construct was engineered to include a Cterminal His6 tag (Fig. 2). Previous attempts at generating a His6 -PfFKBP35 fusion protein resulted in very poor yields of recombinant protein (data not shown). The resulting re-
190
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
Fig. 2. Production in E. coli and purification of recombinant PfFKBP35 and truncated forms. (A) Schematic representation of the different recombinant proteins generated. All proteins were fused at the N-terminus to MBP (hatched box), and at the C-terminus to His6 (white box—a cloning artifact gave rise to two extra His residues in MBP-His8 ). FKBP-derived domains correspond to Fig. 1C. The numbering above each product refers to the PfFKBP35 residues incorporated between the two tags. (B) SDS-PAGE (12.5%, v/v) gel of purified recombinant proteins (3 g) stained with Coomassie Blue. Lanes 1–4 correspond to proteins 1–4 from panel A (MW: molecular weight standards).
combinant protein (MBP-PfFKBP35-His6 ) was purified by means of nickel-chelate affinity chromatography followed by ion-exchange chromatography (Fig. 2B). Although the Nterminal MBP-tag could be cleaved from the construct by the protease factor Xa (data not shown), the cleaved PfFKBP35His6 proved difficult to purify in sufficient quantities from the resulting mixture. The MBP-PfFKBP35-His6 construct was therefore used for the characterisation studies. In order to exclude any effects of the two tag regions, control experiments in all cases were performed with an MBP-His8 protein purified in the same fashion (Fig. 2B, lane 4—note that a cloning artifact gave rise to two extra His residues). To investigate if MBP-PfFKBP35-His6 possessed PPIase activity, the chymotrypsin-coupled spectrophotometric assay of Kofron et al. [33] was employed. This assay monitors the isomerisation of the peptidyl–prolyl bond in a tetrapeptide (succinyl-Ala-Leu-Pro-Phe) linked at the C-terminus to the chromagen para-nitroanilide (p-NA). The anilide bond tethering the chromagen to the tetrapeptide can be hydrolysed by ␣-chymotrypsin, releasing p-NA into solution, but only when the Leu Pro bond in the test peptide is in the trans conformation. If this bond is initially in the cis conformation, the PPIase activity of an added enzyme can be assessed by monitoring how quickly the ␣-chymotrypsin-mediated cleavage occurs by measuring the concomitant increase in absorbance of free p-NA at 390 nm. MBP-PfFKBP35-His6 exhibited strong PPIase activity (Fig. 3A) with a clear concentrationdependent effect (Fig. 3B), and a catalytic efficiency (kcat /Km ) of 1.7 × 104 s−1 M−1 . This value is within the range reported for FKBPs in the literature, but we cannot rule out the possibility that the MBP and/or His6 tags have had some effect on the catalytic efficiency. Both FK506 and rapamycin inhibited the PPIase activity of MBP-PfFKBP35-His6 with IC50 values of 0.32 M and 0.48 M, respectively, against 0.25 M enzyme (Fig. 3C). CsA, an unrelated immunosuppressive drug
that potently inhibits the enzymatic activity of cyclophilins, had no inhibitory effect at up to 5 M. To ascertain whether this enzymatic activity was attributable to the FKBP domain of the protein, truncated forms of PfFKBP35 were generated. The FKBP domain and the TPR domain of PfFKBP35 were produced as isolated polypeptides, fused at the N-termini to MBP, and at the C-termini to His6 (MBP-FKBP-His6 and MBP-TPR-His6 , respectively (Fig. 2). From analysis of the PPIase activity of these recombinant proteins, it is evident that the PPIase activity of PfFKBP35 is attributed to its N-terminal portion, which encompasses the FKBP domain (Fig. 4). The MBP-His8 control protein conferred no PPIase activity to the recombinant molecule. The fact that the FKBP domain has FK506/rapamycin-inhibitable PPIase activity provides strong evidence that this is, as expected, the drug-binding domain. As was the case for the full-length protein, CsA at up to 5 M had no effect on the PPIase activity of the isolated FKBP domain. To investigate whether the complex of PfFKBP35 and FK506 could inhibit calcineurin, the phosphatase activity of bovine brain calcineurin was measured in the presence and absence of PfFKBP35 and/or FK506 using a fluorescence assay (Fig. 5). Surprisingly, MBP-PfFKBP35-His6 inhibited calcineurin in the absence of FK506, albeit weakly—a phenomenon that has only been reported for one other FKBP, hFKBP38 [40]. FKBP51 has been shown to interact with calcineurin in the absence of FK506 [41], but the phosphatase activity is only inhibited in the presence of FK506 [42]. The C-terminal region of hFKBP51, not the FKBP domain, mediates its interaction with calcineurin [41]. The inhibition of calcineurin by PfFKBP35, however, was mediated through the FKBP domain (Fig. 5). Numerous TPR-containing proteins are known to act as molecular chaperones, including hFKBP51 and hFKBP52
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
191
Fig. 4. PPIase activity of isolated domains of PfFKBP35. The PPIase activities of both the FKBP domain (0.25 M MBP-FKBP-His6 ) and TPR domain (0.25 M MBP-TPR-His6 ) of PfFKBP35 were measured and compared with that of the full-length protein (PPIase activity of 0.25 M MBPPfFKBP35-His6 set as 100%). For the case of MBP-FKBP-His6 , the effects of FK506, rapamycin, CsA (all at 5 M) and drug vehicle (ethanol) on its PPIase activity were also assessed. Bars show SEM of three or more replicates.
the TPR domain that confers such activity. To assess whether this was the case for PfFKBP35, the N-terminal (FKBP) and the C-terminal (TPR) domains (MBP-FKBP-His6 and MBPTPR-His6 respectively) were tested separately against citrate synthase. To our surprise, both domains prevented citrate synthase from aggregating. This effect was also seen for the inhibition of thermal aggregation of another model substrate, rhodanese (Fig. 6B). The MBP-His8 control protein had no chaperone effects in either system. The effect of FK506 on the chaperone activity of MBP-PfFKBP35-His6 , as well as the two separate domains, was assessed in both model systems (Fig. 6C and D). While the drug had no detectable effect on the chaperone abilities of either MBP-PfFKBP35-His6 or
Fig. 3. PPIase activity of recombinant PfFKBP35. (A) Representative curves showing increase in absorbance over time as a consequence of isomerisation of the Leu Pro bond in a synthetic peptide substrate. The peptide and ␣-chymotrypsin were treated with (䊉) no additional protein, () 0.25 M MBP-PfFKBP35-His6 or (♦) 0.25 M MBP-His8 . (B) Concentration-dependence of PPIase activity of MBP-PfFKBP35-His6. The assay was repeated with various concentrations of enzyme, and first order rate constants (k) and the catalytic efficiency (kcat /Km ) were calculated as described in Section 2. The dashed line represents the background isomerisation rate in the absence of enzyme. (C) Effects of () FK506, () rapamycin and (䊉) CsA on PPIase activity of MBP-PfFKBP35-His6 (0.25 M). The activity of 0.25 M MBP-PfFKBP35-His6 in the absence of drug was set at 100%. Bars show SEM of three or more replicates.
[15]. The ability to prevent the thermal aggregation of citrate synthase is the most commonly used model system for assessing chaperone capability of a given protein [35]. Citrate synthase begins to aggregate within 1–2 min of incubation at 43 ◦ C, but in the presence of MBP-PfFKBP35-His6 this aggregation was suppressed (Fig. 6A). For the majority of TPR-containing proteins that exhibit chaperone abilities, it is
Fig. 5. Inhibition of calcineurin by PfFKBP35. Activity of calcineurin was measured by the fluorescence of a rhodamine-conjugated peptide substrate that, upon dephosphorylation by calcineurin, is digested by a protease, releasing highly fluorescent rhodamine. The fluorescence attributable to 40 nM calcineurin was set as 100%. The effects of various proteins and/or drugs on the activity of calcineurin were assessed. All additional components were at 1 M. Bars show the SEM of five or more replicate experiments. To ensure that reduced fluorescence was not due to inhibition of the protease, a control peptide whose fluorescence is independent of phosphorylated state was incorporated into each reaction. No inhibition of protease occurred (data not shown).
192
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
Fig. 6. Inhibition of thermal aggregation of citrate synthase and rhodanese by PfFKBP35. Aggregation of the model substrates was monitored in the absence of additional components (䊉), or in the presence of: MBP-PfFKBP35-His6 (); MBP-FKBP-His6 (); MBP-TPR-His6 (); MBP-His8 (). (A) Chaperone activity of recombinant proteins (1.5 M) on citrate synthase (1.5 M). (B) Chaperone activity of recombinant proteins (4.4 M) on rhodanese (4.4 M). (C) Chaperone activity of recombinant proteins (1.5 M) on citrate synthase (1.5 M) in the presence of FK506 (15 M). (D) Chaperone activity of recombinant proteins (4.4 M) on rhodanese (4.4 M) in the presence of FK506 (22 M).
MBP-TPR-His6 , it did partly suppress the chaperone activity of the MBP-FKBP-His6 . The same effects were found for rapamycin (data not shown). While all molecular chaperones can suppress the aggregation of partner proteins, this does not necessarily mean that they prevent the substrate from losing activity. Hsp90, for example, prevents partner proteins from becoming inactivated, while Hsp25 does not [35]. The activity of citrate synthase was measured during incubation at 43 ◦ C in the presence or absence of MBP-PfFKBP35-His6 . The half-time for the loss of citrate synthase activity in the absence of additional components was 1.1 min, compared to 1.6 min and 7.5 min in the presence of MBP-PfFKBP35-His6 and yeast Hsp90, respectively (Fig. 7).
Comparison of the derived amino acid sequence of the FKBP domain shows it to be highly similar to other FKBPs. Not all FKBPs exhibit PPIase activity in vitro, and many don’t even bind FK506. Those that do interact with the drug
4. Discussion In order to gain insights in the mechanisms of action of FK506 and rapamycin, with the ultimate hope of designing derivatives suitable for malaria chemotherapy, here we provide detailed molecular and biochemical analyses of the first member of the FKBP family to be identified in P. falciparum, PfFKBP35.
Fig. 7. Loss of activity of citrate synthase during incubation at 43 ◦ C. 0.15 M citrate synthase was incubated at 43 ◦ C in the absence of additional components (䊉), or in the presence of: 1.5 M MBP-PfFKBP35-His6 (), or 0.9 M Hsp90 from S. cerevisiae (). At indicated time-points, samples were withdrawn and the remaining activity of citrate synthase was measured. The activity of citrate synthase at time = 0 min was set to 100%. All points represent averaged values from at least two replicate experiments.
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
show an exceptionally high degree of conservation within the fourteen residues of hFKBP12 that are known to interact with FK506, according to the atomic structure of the hFKBP12-FK506 complex [38]. Twelve of these are conserved in PfFKBP35. The Ala81Gly and His87Cys substitutions (nomenclature based on hFKBP12) have been observed in a number of other FKBPs, and are unlikely to have any major impact on drug binding. The substitution of the hydrophobic doublet (Gly89/Ile90) from hFKBP12 to a hydrophilic doublet (Glu108/Ser109) in PfFKBP35 is of interest as this is a highly conserved region of all FKBPs. Due to the positioning of this doublet within a flap region that appears to partially cover FK506 in the hFKBP12-FK506 binary complex, the substitution observed at this region in PfFKBP35 may have important implications for the design of specific inhibitors. Gly69 is not known to be involved in any binding event in hFKBP12, which is unsurprising considering its location on the rear surface of the molecule, far away from the active site and FK506/calcineurin binding region. However, this is an exceptionally conserved position throughout the FKBP family, occurring within a region where two loops that interconnect -strands cross each other—a highly unusual topological feature that, prior to the determination of the structure of FKBP domains, was thought to be prohibited in anti-parallel -sheets due to difficulties in packing side chains efficiently [43]. PfFKBP35’s arrangement of a single, N-terminal, FKBP domain followed by a tripartite TPR domain is strikingly similar to the domain architecture of hFKBP36, hFKBP37 and hFKBP38. Although, hFKBP51 and hFKBP52 each include a second FKBP domain, their overall modular structures are also very similar to PfFKBP35. The presence of the TPR motifs in PfFKBP35 strongly suggests that this protein has the ability to interact with another protein or proteins, and work in our laboratory is currently focussed on identifying intracellular binding partners for PfFKBP35, and ascertaining the involvement of the TPR motifs in any interaction. Various isoforms of FKBPs are often found within the same organism. We scanned the P. falciparum genome database in search of other members of the FKBP family aside from PfFKBP35. Such analysis suggested PfFKBP35 to be the only FKBP expressed by P. falciparum. The presence of only a single FKBP gene is unusual, particularly as the parasite has at least three different cyclophilins, the other major group of PPIases [44]. One model by which FK506 and rapamycin could exert an anti-malarial effect through PfFKBP35, by analogy with the current model of the drugs’ immunosuppressive actions, is that a drug-PfFKBP35 binary complex may be formed that could subsequently inhibit an essential parasite target. The target of FK506-FKBP12 in T-lymphocytes is calcineurin [26], and the target of rapamycin-FKBP12 is TOR (target of rapamycin), a protein serine/threonine kinase [45]. The finding that PfFKBP35 inhibits calcineurin in the absence of FK506 is highly unusual. hFKBP38, which is suggested to
193
regulate important cellular processes by modulating the activity of calcineurin, is the only other FKBP for which this phenomenon has been reported [40]. As noted previously, the domain architectures of hFKBP38 and PfFKBP35 are strikingly similar. Little is known about P. falciparum calcineurin, although activity attributable to a calcineurin-like phosphatase has been identified in parasite extracts [46] and preliminary studies of a recombinant form have recently been reported [47]. Until the function of this parasite phosphatase is characterised in detail, the biological significance, if any, of PfFKBP35’s inhibitory effects on calcineurin will remain unclear. The recombinant forms of PfFKBP35 used throughout these analyses exhibited chaperone activity against two model substrates, citrate synthase and rhodanese. The chaperone activity of MBP-PfFKBP35-His6 was not affected by either FK506 or rapamycin, suggesting that it is independent of PPIase activity. Therefore, it was expected that the chaperone activity of PfFKBP35 would be located exclusively in the TPR domain, as is the case for hFKBP52 [36]. However, when truncated forms of PfFKBP35 were tested, both the FKBP and TPR domains were able to suppress the thermal aggregation of citrate synthase and rhodanese. The FKBP domainassociated chaperone activity was inhibited by FK506 and rapamycin. While the finding that the FKBP domain can act as a chaperone was unexpected and unusual, it is not unprecedented. A 28.3-kDa FKBP from the archaebacterium Methanococcus thermoautotrophicum, which does not include a TPR, prevents the thermal aggregation of rhodanese in vitro [13]. Its FKBP domain alone also displays this activity, albeit it to a lesser extent than the entire protein, suggesting that the FKBP domain contributes to the chaperone activity of PfFKBP35. The natural function of PfFKBP35 within the parasite remains to be elucidated, but these findings suggest that this protein could serve an important role in the folding of proteins, either as a folding catalyst, a chaperone, or both. Additionally, the presence of a TPR domain is highly suggestive of a role in protein transport or modulation of protein function. Our interest in FKBPs of P. falciparum was initiated by the finding that FK506 and rapamycin had anti-malarial activity [3]. This suggested that a then unidentified FKBP was being targeted. The existence of FKBPs in P. falciparum is hardly surprising, considering the diverse range of organisms in which they have previously been described. The finding that PfFKBP35 is apparently the only member of the FKBP family in P. falciparum leads to speculation that the anti-malarial mode of action of both FK506 and rapamycin is mediated through this protein. Further molecular and biochemical characterisation of PfFKBP35 offers the opportunity to study the anti-malarial effects of these compounds in more detail, with the ultimate hope of designing analogues that lack immunosuppressive action and are more potent antimalarials. Further studies of the protein, especially with respect to interacting protein partners, will be invaluable in this regard.
194
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195
Acknowledgements This work was supported by grants from the Health Research Board of Ireland (Ref. 40/99) and the Wellcome Trust (Ref. 048253) to A.B.
References [1] L´opez-Antu˜nano FJ, Schmunis GA. Plasmodia in humans. In: Kreier JP, editor. Parasitic protozoa, vol. 5. San Diego: Academic Press; 1993. p. 135–266. [2] Bremen JG. The ears of the hippopotamus: manifestations, determinants, and estimates of the malaria burden. Am J Trop Med Hyg 2001;64S:1–11. [3] Bell A, Wernli B, Franklin RM. Roles of peptidyl–prolyl cis–trans isomerase and calcineurin in the mechanisms of antimalarial action of cyclosporin A, FK506, and rapamycin. Biochem Pharmacol 1994;48:495–503. [4] Harding MW, Galat A, Uehling DE, Schreiber SL. A receptor for the immunosuppressant FK506 is a cis–trans peptidyl–prolyl isomerase. Nature 1989;341:758–60. [5] Siekierka JJ, Hung SHY, Poe M, Lin CS, Sigal NH. A cytosolic binding protein for the immunosuppressant FK506 has peptidyl–prolyl isomerase activity but is distinct from cyclophilin. Nature 1989;341:755–7. [6] Fischer G, Aum¨uller T. Regulation of peptide bond cis/trans isomerization by enzyme catalysis and its implication in physiological processes. Rev Physiol Biochem Pharmacol 2003;148:105–50. [7] Kay JE. Structure-function relationships in the FK506-binding protein (FKBP) family of peptidylprolyl cis–trans isomerases. Biochem J 1996;314:361–85. [8] Blatch GL, L¨assle M. The tetratricopeptide repeat: a structural motif mediating protein–protein interactions. Bioessays 1999;21:932–9. [9] D’Andrea LD, Regan L. TPR proteins: the versatile helix. Trends Biochem Sci 2003;28:655–62. [10] Galat A, Metcalfe SM. Peptidylproline cis/trans isomerases. Prog Biophys Mol Biol 1995;63:67–118. [11] Pal D, Chakrabarti P. Cis peptide bonds in proteins: residues involved, their conformations, interactions and locations. J Mol Biol 1999;294:271–88. [12] Scholz C, Stoller G, Zarnt T, Fischer G, Schmid FX. Cooperation of enzymatic and chaperone functions of trigger factor in the catalysis of protein folding. EMBO J 1997;16:54–8. [13] Ideno A, Yoshida T, Furutani M, Maruyama T. The 28.3 kDa FK506 binding protein from a thermophilic archaeum, Methanobacterium thermoautotrophicum, protects the denaturation of proteins in vitro. Eur J Biochem 2000;267:3139–48. [14] Ari´e JP, Sassoon N, Betton JM. Chaperone function of FkpA, a heat shock prolyl isomerase, in the periplasm of Escherichia coli. Mol Microbiol 2001;39:199–210. [15] Pirkl F, Buchner J. Functional analysis of the Hsp90-assocaited human peptidyl prolyl cis/trans isomerases FKBP51, FKBP52 and Cyp40. J Mol Biol 2001;308:795–806. [16] Kamphausen T, Fangh¨anel J, Neumann D, Schulz B, Rahfeld JU. Characterisation of Arabidopsis thaliana AtFKBP42 that is membrane-bound and interacts with Hsp90. Plant J 2002;32:263–76. [17] Suzuki R, Nagata K, Yumoto F, et al. Three-dimensional solution structure of an archael FKBP with a dual function of peptidyl prolyl cis–trans isomerase and chaperone-like activities. J Mol Biol 2003;328:1149–60. [18] Jayaraman T, Brilliantes AM, Timerman AP, et al. FK506 binding protein associated with the calcium release channel (ryanodine channel). J Biol Chem 1992;267:9474–7.
[19] Brilliantes AMB, Ondraiˇs K, Scott A, et al. Stabilisation of calcium release channel (ryanodine receptor) function by FK506-binding protein. Cell 1994;77:513–23. [20] Cameron AM, Steiner JP, Sabatini DM, Kaplin AI, Walensky LD, Snyder SH. Immunophilin FK506 binding protein associated with inositol 1,4,5-trisphosphate receptor modulates calcium flux. Proc Natl Acad Sci USA 1995;92:1784–8. [21] Cameron AM, Nucifora FC, Fung ET, et al. FKBP12 binds the inositol 1,4,5-trisphosphate receptor at leucine-proline (1400-1401) and anchors calcineurin to this FK506-like domain. J Biol Chem 1997;272:27582–8. [22] Wang T, Li BY, Danielson PD, et al. The immunophilin FKBP12 functions as a common inhibitor of the TGF family type I receptors. Cell 1996;86:435–44. [23] Chen YG, Liu F, Massagu´e J. Mechanism of TGF receptor inhibition by FKBP12. EMBO J 1997;16:3866–76. [24] Pratt WB, Toft DO. Regulation of signalling protein function and trafficking by the hsp90/hsp70-based chaperone machinery. Exp Biol Med 2003;228:111–33. [25] Moro A, Ruiz-Cabello F, Fernandez-Cano A, Stock SP, Gonzalez A. Secretion by Trypanosoma cruzi of a peptidyl–prolyl cis–trans isomerase involved in cell infection. EMBO J 1995;14:2483– 90. [26] Schreiber SL, Crabtree GR. The mechanism of action of cyclosporin A and FK506. Immunol Today 1992;13:136–42. [27] Braun PD, Barglow KT, Lin Y, et al. A bifunctional molecule that displays context-dependent cellular activity. J Am Chem Soc 2003;125:7575–80. [28] Bell A, Wernli B, Franklin RM. Effects of microtubule inhibitors on protein synthesis in Plasmodium falciparum. Parasitol Res 1993;79:146–52. [29] Zuckerman A. Harvesting of Plasmodium falciparum with saponin. Bull WHO 1967;37:431–6. [30] Maniatis T, Fritsch EF, Sambrook J. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press; 1982. [31] Birnboim HC, Doly J. A rapid alkaline extraction procedure for the screening of recombinant plasmid DNA. Nuclei Acid Res 1979;7:1513. [32] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilising the principle of protein dye binding. Anal Biochem 1976;72:248–54. [33] Kofron JL, Kuzmic P, Kishore V, Colon-Bonilla E, Rich DH. Determination of kinetic constants for peptidyl prolyl cis–trans isomerases by an improved spectrophotometric assay. Biochemistry 1991;30:6127–34. [34] Harrison RK, Stein RL. Substrate specificities of the peptidyl prolyl cis–trans isomerase activities of cyclophilin and FK-506 binding protein: evidence for the existence of a family of distinct enzymes. Biochemistry 1990;29:3813–6. [35] Buchner J, Grallert H, Jakob U. Analysis of chaperone function using citrate synthase as nonnative substrate protein. Method Enzymol 1998;290:323–38. [36] Pirkl F, Fischer E, Modrow S, Buchner J. Localization of the chaperone domain of FKBP52. J Biol Chem 2001;276:37034–41. [37] Manning-Krieg UC, Henr´ıquez R, Cammas F, Graff P, Gav´eriaux S, Movva NR. Purification of FKBP-70, a novel immunophilin from Saccharomyces cerevisiae, and cloning of its structural gene FPR3. FEBS Lett 1994;352:98–103. [38] van Duyne GD, Standaert RF, Karplus PA, Schreiber SL, Clardy J. Atomic structure of the human FKBP-12 complexes with FK506 and rapamycin. J Mol Biol 1993;229:105–24. [39] Ke H, Huai Q. Structures of calcineurin and its complexes with immunophilins-immunosuppressants. Biochem Biophys Res Commun 2003;311:1095–102. [40] Shirane M, Nakayama KI. Inherent calcineurin inhibitor FKBP38 targets Bcl-2 to mitochondria and inhibts apoptosis. Nature Cell Biol 2003;5:1–10.
P. Monaghan, A. Bell / Molecular & Biochemical Parasitology 139 (2005) 185–195 [41] Li TK, Baksh S, Cristillo AD, Bierer BE. Calcium- and FK506independent interaction between immunophilin FKBP51 and calcineurin. J Cell Biochem 2002;84:460–71. [42] Baughman G, Wiederrecht GL, Chang F, Martin MM, Bourgeois S. Tissue distribution and abundance of human FKBP51, an FK506binding protein that can mediate calcineurin inhibition. Biochem Biophys Res Commun 1997;232:437–43. [43] Richardson JS. -Sheet topology and the relatedness of proteins. Nature 1977;268:495–500. [44] Gavigan CS, Kiely SP, Hirtzlin J, Bell A. Cyclosporin-binding proteins of Plasmodium falciparum. Int J Parasitol 2003;33:987–96.
195
[45] Lorberg A, Hall MN. TOR: the first 10 years. Curr Opin Microbiol Immunol 2004;279:1–18. [46] Dobson S, May T, Berriman M, et al. Characterization of protein ser/thr phosphatases of the malaria parasite, Plasmodium falciparum: inhibition of the parasite calcineurin by cyclophilin-cyclosporin complex. Mol Biochem Parasitol 1999;99:167–81. [47] Kumar R, Musiyenko A, Oldenburg A, Adams B, Barik S. Posttranslational generation of constitutively active cores from larger phosphatases in the malarial parasite Plasmodium falciparum: implications for proteomics. BMC Mol Biol 2004;5:6.