A point mutation in a silencer module reduces the promoter activity for the human mercaptopyruvate sulfurtransferase

Biochimica et Biophysica Acta 1680 (2004) 176 – 184 http://www.elsevier.com/locate/bba

Short communication

A point mutation in a silencer module reduces the promoter activity for the human mercaptopyruvate sulfurtransferase Noriyuki Nagaharaa,*, V.G. Sreejaa, Qing Lia, Takako Shimizua, Terumasa Tsuchiyab, Yoshiaki Fujii-Kuriyamac b

a Department of Environmental Medicine, Nippon Medical School, 1-1-5 Sendagi, Bunkyo-ku, Tokyo 113-8602, Japan Department of Molecular Medicine, Research Center for Molecular Medical Science, 35-1 Shimo, Fussa, Tokyo 197-0023, Japan c Center for Tsukuba Advanced Research Alliance, University of Tsukuba, 1-1-1 Tennoudai, Tsukuba, Ibaragi 305-8577, Japan

Received 15 July 2004; received in revised form 14 September 2004; accepted 20 September 2004 Available online 2 October 2004

Abstract A promoter region of human mercaptopyruvate sulfurtransferase (MST) [EC 2.8.1.2] is G+C-rich and TATA-less, showing features of a house-keeping gene. In the core promoter, a GC box ( 284:GGGGCGTGGC: 275) and an initiator ( 219:TTATATG: 225) are found. A cap site hunting analysis for human liver cDNA revealed four possible transcriptional start sites, nucleotides 223, 159, 35 and 25. Point mutagenesis and deletion studies suggest that a module of the silencer element is 394:GCTG: 391. A replacement of 391G to C lost the silencer function; on the other hand, a replacement of 394G to T or C, 393C to T or 392T to G markedly reduced the promoter activity. D 2004 Elsevier B.V. All rights reserved. Keywords: Cap site hunting; Dual luciferase assay; Mercaptopyruvate sulfurtransferase; Silencer

1. Introduction Mercaptopyruvate sulfurtransferase (MST, EC 2.8.1.2) catalyzes transsulfuration from mercaptopyruvate or thiosulfate to nucleophilic acceptors such as mercaptopyruvate itself, mercaptoethanol or cyanide [1–4]. MST is widely distributed in all tissues in the rat, but the cellular distribution is different in each tissue: MST is predominantly localized in neuroglial cells in the brain, proximal tubular cells in the kidney and pericentral hepatocytes in the liver [5]. MST contributes to cysteine degradation and serves to defend against cyanide toxicity [6,7]. Another biological function can be considered because congenital insufficiency or deficiency of MST activity causes an inheritable disease, mercaptolactate-cysteine disulfiduria (MCDU), which is associated with oversecretion of

* Corresponding author. Tel.: +81 3 3822 2131; fax: +81 3 5685 3065. E-mail address: [email protected] (N. Nagahara). 0167-4781/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.bbaexp.2004.09.007

mercaptolactate-cysteine disulfide in urine, with or without mental retardation [8–14]; however, the mechanism remains unknown. The human MST gene consists of two 595- and 299-bp exons divided by a 4405-bp intron and possesses a common property of house-keeping gene, i.e., contains a prominent G+C-rich sequence with many CpG and GpC dinucleotides, a GC box instead of a TATA box in the promoter region [15], and an initiator element which contains a transcriptional start point in a core promoter [16]. In the intron, a sequence (TCACGCTA) corresponding to a complementary xenobiotic responsive element [17,18] was found, however, it did not affect the promoter activity. There is no information of the features of MST genomic DNA, although the amino acid sequence of human MST was determined by Pallini et al. [19] and the role of amino acid residues in the catalytic site have been clarified [3,4,20,21]. To elucidate general map of cis-element in the promoter region and the intron, we cloned human MST

N. Nagahara et al. / Biochimica et Biophysica Acta 1680 (2004) 176–184

gene from lymphocytes by genomic PCR. Cap site hunting analysis for human liver cap site cDNA was performed [22–24] with mouse Hepa I cells to determine a transcriptional start site. A dual luciferase assay was performed to map cis-acting elements which regulate the promoter activity. We first found that replacement of bases in the silencer element enhanced the silencing function, suggesting that this impairment can be a new pathogenesis of MCDU.

177

product as a template. PCR conditions were same as those for the first PCR. Each PCR product was electrophorized in agarose gel, extracted with a QIAquick Gel Extraction Kit (QIAGEN), and subcloned into pT7Blue (R) (TAKARA Bio Inc., Otsu, Japan). The sequence of each PCR product was determined with a sequencer (ABI PRISM 310, PE Biosystems, California, USA). 2.3. Cloning of the promoter region

2. Materials and methods 2.1. Chemicals and genomic DNA The sample of human peripheral blood was obtained from a healthy Japanese donor with agreement of the subjects. Human genomic DNA was collected from blood with a Genomic-tip (QIAGEN, Tokyo, Japan). All reagents were analytical grade. 2.2. Cap site hunting analysis for determination of the transcriptional start site The transcriptional start site of the human MST gene was determined by the cap site hunting analysis with human liver cap site cDNA (CapSite cDNAk, Nippon Gene, Toyama, Japan). In this method, the cap was removed with tobacco acid pyrophosphatase from mRNAs and oligoribonucleotide was linked to the decapped mRNAs with T4 RNA ligase. The cDNA library (cap site cDNA) was synthesized by reverse transcription using random primers (22–24). The cap site region of MST mRNA was determined by PCR using the primer corresponding to the capped oligonucleotide and the anti-sense primer designed from MST gene. PCR primers for nested PCR were designed with reference to the genomic DNA sequence of human MST (directly submitted by Hunt, A. in 1998, locus: HSE146D10, accession: Z73420). 3V-Antisense primer, hMAS 7 (TGGTCGATGTCGAAGAAAGCG: nucleotide 190 to 170 of human MST cDNA; nucleotide A of initiation ATG is designated as +1) and the other 3V-antisense primer, hMAS 8 (GATGTGGCGCTCCTCGAACT: nucleotide 161 to 142), were synthesized. First PCR was performed with hMAS 8 and 1RC1 (a sense primer for cap site hunting analysis for the first PCR, CapSite cDNAk, Nippon Gene) primers and with human liver cDNA for cap site hunting analysis (CapSite cDNAk, Nippon Gene) as a template; initial denaturing was carried out at 94 8C for 5 min followed by 35 cycles of annealing at 60 8C for 30 s, extension at 72 8C for 45 s, and denaturation at 94 8C for 30 s. Second PCR was performed with hMAS 7 and 1RC2 (a sense primer for cap site hunting analysis for the 2nd PCR, CapSite cDNAk, Nippon Gene) primers, and with the first PCR

PCR primers for genomic PCR were designed with reference to the genomic DNA sequence of human MST (directly submitted by Hunt, A. in 1998, locus: HSE146D10, accession: Z73420). A 5V- sense primer, HMST-S1 (CAGAGCTCCTGGGATTACAAGCGTGAGCCA: 686 to 665 bp of genomic DNA of human MST, with an additional C and A bases and a SacI restriction site), and 3Vantisense primer, HMST-2A (CTAAGCTTATATAAA CACAAGCTCCGAGTG: nucleotide 241 to 220 with an additional C and T bases and a HindIII restriction site), were synthesized. Genomic PCR was performed with genomic DNA as a template using LA Taq polymerase (TAKARA Bio) with GC-rich buffer II (TAKARA Bio): initial denaturing was carried out at 94 8C for 10 s followed by 35 cycles of denaturing at 94 8C for 15 s, and annealing and extension at 65 8C for 10 min, and added by final extension at 72 8C for 10 min. The 482-bp cDNA obtained was subcloned into pT7Blue (R) (TAKARA Bio), which is designated as pThGMST21. The cloned DNA was confirmed by sequencing. 2.4. Construction of reporter plasmids for promoter activity assays PCR primers for synthesis of a reporter plasmid containing a part of the promoter region were designed with reference to the genomic DNA sequence of human MST. Each 5V-sense primer with an additional C and A base and a SacI restriction site at the 5V side was synthesized as shown in Table 1. PCR was performed with each synthesized primer and HMST-2A, and with pThGMST21 as a template. PCR conditions were as follows: initial denaturing was carried out at 94 8C for 10 s followed by 35 cycles of denaturing at 94 8C for 15 s, and annealing and extension at 58 8C (for HMST-S152, 153, 154, 155 and 156) and at 55 8C (for the other primers) for 5 min. Final extension was at 72 8C for 10 min. Each PCR product was subcloned into a pT7Blue (R) vector. Each digested DNA fragment (containing SacI and HindIII sites) was inserted into a PicaGene Basic Vector (Firefly luciferase vector, TOYO INK MGF Co., Ltd., Tokyo, Japan) for a reporter gene assay between the SacI and HindIII sites. These vectors are assigned as pGVM2n (n: ID number of each primer). All cloned DNAs were confirmed by sequencing.

178

N. Nagahara et al. / Biochimica et Biophysica Acta 1680 (2004) 176–184

Table 1 PCR primers for synthesis of a reporter plasmid Nucleotidea

Primer From HMST-S3 HMST-S5 HMST-S7 HMST-S9 HMST-S11 HMST-S13 HMST-S15 HMST-S152 HMST-S153 HMST-S154 HMST-S155 HMST-S156 HMST-S157 HMST-S25 HMST-S158 HMST-S5a HMST-S5b HMST-S5c HMST-S5d HMST-S5e HMST-S5f HMST-S160 HMST-S161 HMST-S35 HMST-S36 HMST-S37 a

523 387 501 479 457 432 411 405 402 399 396 393 390 387 384 381 378 375 372 369 366 363 342 323 300 277

To 502 366 480 458 433 412 389 383 380 377 374 371 368 365 362 359 356 353 350 347 344 341 324 301 278 255

Nucleotide A of initiation ATG is designated as +1.

2.5. Mutagenesis for the silencer element PCR primers for mutagenesis of silencer codes were designed with reference to the genomic DNA sequence of human MST. Each 5V-sense primer (nucleotides 396 to 375) with an additional C and A base and a SacI restriction site was synthesized as shown in Table 2. The PCR mixture contained each primer and HMST-2A, and with pThGMST21 as a template in GC rich Buffer II. PCR was carried out using LA Taq polymerase; initial denaturing at 94 8C for 10 s followed by 35 cycles of denaturing at 94 8C for 15 s, and annealing and extension at 50 8C (for HMST-S1575), 53 8C (for HMST-S1579/2) or 55 8C (for the others) for 5 min, with final extension at 72 8C for 10 min. Each PCR product was subcloned into pT7Blue (R) and each digested DNA fragment (SacI/HindIII) was inserted into a PicaGene Basic Vector for a reporter gene assay between SacI and HindIII sites (assigned as pGVM2n, n: ID number of each primer). All cloned DNAs were confirmed by sequencing of inserted DNAs. 2.6. Transfection of the reporter gene to Hepa I cells Hepa I cells were seeded in 96-well culture plates (0.3104 cells per well) in Dulbecco’s MEM medium (Invitrogen, Tokyo, Japan) containing 10% FBS (Invitrogen) and 60 mg/ml of kanamycin (Sigma-Aldrich, Tokyo, Japan) (Medium A). They were cultured in 5% CO2 at 37 8C

for 24 h to an approximately 60% confluent condition. The mixture for transfection containing 100 ng/well of each pGVM vector, 5 ng/well of PRL-TK (pRL family of Renilla luciferase control vector, Promega, Tokyo, Japan), Effectene (5 ng/well, Effectenek Transfection Reagent, QIAGEN) and Enhancer (0.8 ng/well, Effectenek Transfection Reagent, QIAGEN) was made 10 min before transfection. One hundred microliters of Medium A was transferred to each well and then 30 Al of each transfection mixture was added. Cells were then cultured for 48 h in 5% CO2 at 37 8C. 2.7. Dual luciferase assay Cells were rinsed with a potassium phosphate buffer, pH 7.4 without Ca2+ and Mg2+. Luciferase activities were Table 2 PCR primers for mutagenesis of silencer codes Primer

Nucleotide replacement(s)a

HMST-S15534 HMST-S15535 HMST-S15536 HMST-S15531 HMST-S15532 HMST-S15533 HMST-S155/28 HMST-S155/29 HMST-S155/30 HMST-S155/22 HMST-S155/23 HMST-S155/24 HMST-S1554 HMST-S155/32 HMST-S1555 HMST-S1552 HMST-S1551 HMST-S157/2 HMST-S1587 HMST-S1571 HMST-S158 HMST-S1587/2 HMST-S1571/2 HMST–S1585/2 HMST-S1591/2 HMST-S1573/2 HMST-S1577/2 HMST-S1595/2 HMST-S1578 HMST-S1596/2 HMST-S1594/2 HMST-S1575/2 HMST-S1589/2 HMST-S1559 HMST-S1557 HMST-S15512 HMST-S15511 HMST-S15510 HMST-S155/25 HMST-S155/26 HMST-S155/27

396GYC 396GYT 396GYA 395AYC 395AYT –395AYG 394GYT 394GYA 394GYC 393CYA 393CYT 393CYG 392TYC 392TYG 392TYC 391GYT 391GYA 391GYC 391GYC and 390CYG 391GYC and 390CYT 391GYC and 390CYA 390CYG 390CYT 390CYA 389AYC 389AYG 389AYT 390CYT and 388AYG 390CYT and 388AYC 388TYA 388TYC 388TYG 389AYT and 388TYA 387CYT 387CYA 386TYG 386TYC 386TYA 385TYA 385TYC 385TYG

a

Nucleotide A of initiation ATG is designated as +1.

N. Nagahara et al. / Biochimica et Biophysica Acta 1680 (2004) 176–184

179

measured with a Dual-Luciferasek Reporter Assay System (PROMEGA) by a luminometer (Lumat LB 9507, EG & H BERTHOLD, Pfoezheim, Germany). Each relative promoter activity was represented as a ratio of Firefly luciferase activity of each experimental vector to each control Renilla luciferase activity.

The nucleotide sequence b 225:TTATATG: 219Q corresponds to that of an initiator element with the consensus sequence bA/T-A/T-A (+1)-N-T/A-A/T-A/TQ (/ or +1, a transcriptional start site; and N, any nucleotides). Thus, nucleotide 223 was considered to be a major start site.

2.8. Statistical analysis

3.1.2. Core promoter Consensus sequences of binding sites for transcription regulator proteins were checked with computer software (DNASIS, Hitachi software engineering Co., Ltd.; GENETYX, Software development Co., Ltd.; and TRASFAC, Gene Regulation Co.) from nucleotides 608 to 1 from the initiation codon. The nucleotide sequence b 284: GGGGCGTGGC: 275Q corresponds to that of the GC box; the consensus sequence is bG/T-G/A-G-G-C-G-G/TG/A-G/A-C/TQ. The results of a dual luciferase assay (Fig. 3) showed that deletion of nucleotides from 300 to 278 (pGVM237) resulted in the loss of a major part of the GC box, and the promoter activity (defined under Materials and methods) was significantly decreased to about 1/3.5 of the basal transcriptional level (pGVM215), ( P=4.710 6; n=5). The nucleotide sequence 225: TTATATG: 219 corresponded to an initiator element as described above.

All values are expressed as the meanFS.D. The significance of difference between values was estimated by Student’s t-test.

3. Results 3.1. General map of the promoter region 3.1.1. Transcriptional start site The transcriptional start point was determined by cap site hunting analysis according to the procedure under Materials and methods. After a nested PCR, gel electrophoresis for PCR products was performed (Fig. 1). Three bands were observed with the molecular mass (a, 420 bps, b, 340 bps and c, 240 bps). DNA sequencing of products a and b revealed that transcriptional start sites were nucleotide 223 (product a) and nucleotide 159 (product b). Product c contained two PCR products and transcriptional start sites were nucleotides 35 and 25 (designed as c1 and c2, respectively) (Fig. 2). The result of analysis with liver cap site cDNA was identical to that with brain cap site (data not shown).

Fig. 1. Electrophoresis of PCR products of cap site hunting analysis. First PCR was performed with hMAS 8 (a gene specific primer) and 1RC1 primers and with human liver cap site cDNA as a template. Nested PCR was performed with hMAS 7 (a gene specific primer) and 1RC2 (a sense primer for cap site hunting for 2nd PCR) primers, and with the first PCR product as a template. The PCR product was electrophorized on 2% agarose gel. Three different bands (a, 420 bps; b, 340 bps; and c, 240 bps) were detected. M, molecular marker.

3.2. Enhancer and silencer elements A deletion study for the promoter region was performed to investigate features of enhancer and silencer elements. The results of a dual luciferase assay (Fig. 3) showed that serial deletion of nucleotides from nucleotides 523 to 397 (pGVM2155) did not change the relative promoter activity compared to the basal promoter activity (pGVM215; (5.58F0.78)10 1, n=5). Further deletion of nucleotides from 396G (pGVM2155) to 394G (pGVM2156) significantly decreased the relative promoter activity to about 1/ 7 ( P=2.5910 5, n=5). Moreover, serial deletion of three nucleotides to 391G (pGVM2157) significantly increased the relative promoter activity to about 6.3-fold ( P=2.08 10 6, n=5) and about 1.6-fold ( P=2.3710 6, n=5), compared to that of pGVM2155 and pGVM2156, respectively. The maximum activity level (pGVM2157) was maintained by further deletion of each of the three nucleotides to 379G (pGVM25b). Serial deletion of three nucleotides to 376G (pGVM25c) significantly decreased the promoter activity to the basal level ( P=6.1010 4; n=5). Further deletion of each of the three nucleotides of nucleotides to 301C (pGVM236) did not change the activity level. Serial deletion of three nucleotides to 278T (pGVM237) significantly decreased the relative promoter activity to 1/3.5 ( P=4.6810 6; n=5). These results suggest that the core sequence of the silencer element is localized around nucleotide 390 (C), and that of the enhancer element is placed around nucleotide 377 (G).

180

N. Nagahara et al. / Biochimica et Biophysica Acta 1680 (2004) 176–184

Fig. 2. Overview of 5V-flanking region of the human MST gene. A dotted underline shows a core sequence of silencer element. A simple underline shows GC box. The transcriptional start sites were determined by cap site hunting analysis and indicated by an arrow: (a), (b), (c1) and (c2). The arrowed underlines show some PCR primers, HMST-S15 for a construction of pGVM215, HMST-S5 for a construction of pGVM25 and HMST-S5c for a construction of pGVM25c, and an antisense primer, HMST-A2 for deletion study of the promoter activity (refer to Fig. 3). The nucleotide number is counted from the first base of the initiation codon (ATG). *, the initiator element.

3.3. The silencer module The results of a mutagenesis study between nucleotides 396 and 385 are shown in Fig. 4. A wild-type (control) promoter, pGVM215, showed basal transcriptional activity. Replacement of nucleotide 396 (G) or 395 (A) with the other one did not affect the promoter activity (pGVM215534, 215535, 215536, 215511, 215512 and 215513). When 394G was replaced with T (pGVM2155/28) or C (pGVM2155/30) the silencer function was significantly enhanced; the promoter activity was depressed, resulting in marked depression of transcription. These relative promoter activities were (1.27F0.18)10 3 and (1.70F0.10)10 3, respectively (n=4). Compared to the basal transcription activity (pGVM215), these values were significantly decreased ( P=7.3410 4 and 7.2410 4, respectively). Replacement of 393C with T (pGVM2155/23) also significantly enhanced the silencing function and the relative promoter activity was decreased to (1.34F0.24) 10 2 (n=4) ( P=7.7310 4). When 392T was substituted by G (pGVM2155/32), the silencing function was significantly enhanced and the value was decreased to (3.81F 0.87)10 4 (n=4) ( P=7.3410 4). It was therefore concluded that a point mutation of 394G to T, 394G to C, 393C to T or 392T to G markedly enhanced the silencing effect. On the other hand, replacement of 391G with C (pGVM2157/2) reduced the silencer effect and the relative promoter activity was increased to (5.21F0.36)10 1 (n=4), corresponding to the maximum activity level (pGVM2155/ 27) (Fig. 4). However, double replacements of 391G with C and 390C with G (pGVM21587) did not change the

silencing effect. Therefore, nucleotide 391 should be G, T or A to maintain the silencing function. An incomplete repeat sequence, 400:AGCCGAGCTG: 391, was found around the silencer element (Figs. 2 and 5); the latter half of the sequence, 394:GCTG: 391, was critical for the silencing function (a silencer module). On the other hand, a deletion study (Fig. 3) revealed that another sequence, 401:GCCG: 396, did not contribute to the silencing function. Based on these results, the marked decrease in promoter activity of pGVM2156 (Fig. 3) resulted from replacement of 394G with C, which is a base of the additional restriction site of SacI (GAGCTC); the silencer module was changed to 394:CCTG: 391 (Fig. 3). When an original base C was put back into nucleotide 394 (G), the relative promoter activity would be increased to that of pGVM2156. Relative promoter activity of pGVM2157 also would be modified as a core silencer element was deleted and a restriction site added, SacI; the silencer module was changed to 394:GCTC: 391.

4. Discussion In this study we used mouse cells for analysis of human MST promoter activity because three promoter activities, of pGVM23 (original promoter sequence), 25 (deletion of a silencer element from the original promoter sequence) and 25c (deletion of a silencer and enhancer elements) in human Hep3B and NT2 cells (unpublished data), were similar to those in mouse Hepa I cells. It is noteworthy that a sequence of human promoter region of MST is similar to that of mouse especially in the sequence around a silencer element

N. Nagahara et al. / Biochimica et Biophysica Acta 1680 (2004) 176–184

181

Fig. 3. Deletion study of promoter activity for the human MST gene. Predetermined numbers of bases were deleted from nucleotide 523 in the MST promoter and a pGMV vector was inserted with each DNA. 100 ng/well of each vector and 5 ng/well of PRL-TK vector were co-transfected into Hepa I cells with Effectene. Dual luciferase assay was performed as described under Materials and methods. A ratio of mean value of Firefly luciferase activity in an experimental vector to each mean value of Renilla luciferase activity in control PRL-TK vector was defined as a relative promoter activity. Values are expressed as the meanFS.D. A scale shows a ratio of a relative promoter activity in each vector to that of pGMV 215. In pGVM2155, 396:GAGCTGCAT: 389 is a 5Vflanking sequence which is the original promoter. In pGVM2156 ( 396:CTCCTGCAT: 389), the first three bases in the sequence of pGVM2155 are replaced with CTC which is the 3V-end of restriction site, SacI. In pGVM2157 ( 396:GAGCTCCAT: 389), the first six bases in the sequence of pGVM2155 are placed with GAGCTC, which is the 3V-end of restriction site, SacI. a, b, c and d indicate a significant difference ( P=2.0810 6, P=2.3710 6, P=6.1010 4 and P=4.6810 6, respectively). (T) Firefly luciferase gene.

(Fig. 5). These findings suggest that human MST promoter elements function in both human and mouse cells. We also investigated a function of a sequence (TCACGCTA) corresponding to a complementary xenobiotic responsive element in the intron of MST gene. Ultimately the sequence did not facilitate the promoter activity by addition of 3methylcholanthrene, which associates with Ah receptor and binds to xenobiotic responsive element [25,26]. The MST promoter consists of a GC box and an initiator instead of a TATA box, indicating that MST gene is a housekeeping. This result is consistent with our results of RT-PCR study that MST could not be induced by heavy metals (Cd2+, Co2+, Ni2+, Fe2+ and Mn2+), amino acids (cysteine or cystine as a precursor of a substrate), hypoxic condition, or chemical compounds (3-methylcholanthrene as an inducer of a xenobiotic responsive element or cyanide as a substrate) in human Hep3B cells (unpublished data). Cap site hunting analysis with human liver cap site cDNA revealed four possible transcriptional start sites at

223, 159, 35 and 25. Cap site hunting analysis for the human brain revealed the same transcriptional start sites. In these start sites, a 223A corresponded to the third base of an initiator element (T-T-A (+1)-T-A-T), however, the other start sites were not confirmed. An incomplete repeat sequence, 400:AGCCGAGCTG: 391, containing the core silencer element, 394:GCTG: 391, was found; the first half sequence, 400:AGCCG: 396, in which 396G was replaced with C, is not needed for the silencing function. It is noteworthy that a part of 5Vflanking region of the mouse MST gene ( 391: AGCTGGGCTA: 382) is very similar to a silencer element of the human MST( 400:AGCCGAGCTG: 391) (Fig. 5). The first half of the mouse sequence, 391:AGCTG: 386, is identical to the human silencer module, 395:AGCTG: 391. The latter half of mouse sequence, 390:GGCTA: 382, is an incomplete repeat of AGCTG. A silencer element containing the sequence bGCTGQ is also found in the chicken lysozyme gene (TTGACCC-

182

N. Nagahara et al. / Biochimica et Biophysica Acta 1680 (2004) 176–184

Fig. 4. Mutation study of a silencer element with the surrounding sequence. Mutagenesis of one or two bases in the silencer element was performed with primer containing replacement of base(s). Each PCR product was subcloned into a pGMV vector and co-transfected into Hepa I cells with a PRL-TK vector. Dual luciferase assay was performed as described under Materials and methods. A ratio of mean value of Firefly luciferase activity in an experimental vector to each mean value of Renilla luciferase activity in control PRL-TK vector was defined as a relative promoter activity. Values are expressed as the meanFS.D. A scale shows a ratio of a relative promoter activity in each vector to that of pGMV 215. Outlined figures represent mutated bases. (T) Firefly luciferase gene; Y, significant enhancement of silencing effect; *, loss or reduction of silencing effect.

Fig. 5. Comparison a sequence containing silencer element in the promoter between the human and the mouse MST gene. The sequence ( 405 to 365) consisting of silencer element in the human MST promoter region is markedly similar to that ( 396 to 356) in a possible promoter region of the mouse MST gene (NT039632) that was estimated by a data based on the sequence homology (73% identity; *, identical base). A core sequence of silencer element (GCTG) is also found in the mouse MST gene and underlined bases indicate nucleotide number is counted from the first base of the initiation codon.

N. Nagahara et al. / Biochimica et Biophysica Acta 1680 (2004) 176–184

CAGCTGAGGTCAA) [27], the rat m4 muscarinic acetylcholine receptor gene (GGAGCTGTCCGAGGTGCTGAA) [28] and another locus of the rat m4 muscarinic acetylcholine receptor gene (GGAGCTGTCCGAGGTGCTGAA) [29]. Repressors for the chicken lysozyme gene and the rat m4 mucarinic acetylcholine receptor gene were determined to be NEP1/CTCF [27] and NRSF [29], respectively. Surrounding bases of GCTG were essential for these factors to recognize the element; on the other hand, a possible repressor of MST could recognize the human MST silencer element with only four bases, however, the repressor has not been found. A mutation ( 391GYC) in the silencer module loses the silencing function. It is a common property of a silencer module, a mutation in the silencer missed its activity [30]. On the other hand, it is a new finding that a point mutation in the silencer module ( 394GYT or C, 393CYT or 392TYG) markedly enhances the silencing function and reduces translation of MST. It has been considered that a mutation in the exon of MST gene causes MCDU. On the other hand, the results of the present study strongly suggest that a mutation in the silencer element can impair translation of MST.

Acknowledgments We thank Dr. Junsei Mimura (Center for Tsukuba Advanced Research Alliance, University of Tsukuba) for helpful suggestions. This work was supported by Yokohama Foundation for Advancement of Medical Science and The Naito Foundation.

References [1] A. Meister, Conversion of a-keto analogue of cysteine to pyruvate and sulfur, Fed. Proc. 12 (1953) 245. [2] J.L. Wood, H. Fiedler, Beta-Mercapto-pyruvate, a substrate for rhodanese, J. Biol. Chem. 205 (1953) 231 – 234. [3] N. Nagahara, T. Okazaki, T. Nishino, Cytosolic mercaptopyruvate sulfurtransferase is evolutionarily related to mitochondrial rhodanese. Striking similarity in active site amino acid sequence and the increase in the mercaptopyruvate sulfurtransferase activity of rhodanese by site-directed mutagenesis, J. Biol. Chem. 270 (1995) 16230 – 16235. [4] N. Nagahara, T. Nishino, Role of amino acid residues in the active site of rat liver mercaptopyruvate sulfurtransferase. cDNA cloning, overexpression, and site-directed mutagenesis, J. Biol. Chem. 271 (1996) 27395 – 27401. [5] N. Nagahara, T. Ito, H. Kitamura, T. Nishino, Tissue and subcellular distribution of mercaptopyruvate sulfurtransferase in the rat: confocal laser fluorescence and immunoelectron microscopic studies combined with biochemical analysis, Histochem. Cell Biol. 110 (1998) 243 – 250. [6] G.E. Isom, S.I. Baskin, Enzyme involved in cyanide metabolism, in: I.G. Sipes, C. McQueen, A.J. Gandolifi, F.P. Guengerich (Eds.), Comprehensive Toxicology, Elsevier Science, UK, 1997, pp. 477 – 488. [7] N. Nagahara, T. Ito, M. Minami, Mercaptopyruvate sulfurtransferase as a defense against cyanide toxication: molecular properties and mode of detoxification, Histol. Histopathol. 14 (1999) 1277 – 1286.

183

[8] J.C. Crawhall, R. Parker, E.P. Young, M.G. Ampola, M.L. Efron, E.M. Bixby, Beta-mercaptolactate-cysteine disulfide analog of cystine in the urine of a mentally retarded patient, Science 160 (1968) 419 – 420. [9] M.G. Ampola, M.L. Efron, E.M. Bixby, E. Meshorer, Mental deficiency and a new aminoaciduria, Am. J. Dis. Child. 117 (1969) 66 – 70. [10] J.C. Crawhall, Beta-mercaptolactate-cysteine disulfiduria, in: J.B. Stanbury, J.B. Wyngaarden, D.S. Fredrickson (Eds.), Metabolic Basis of Inherited Disease, 4th ed., McGraw-Hill Pub., New York, 1978, pp. 504 – 513. [11] J.C. Crawhall, K. Bir, P. Purkiss, J.B. Stanbury, Sulfur amino acids as precursors of h-mercaptolactate-cysteine disulfiduria in human subjects, Biochem. Med. 5 (1971) 109 – 115. [12] J.C. Crawhall, R. Parker, W. Sneddon, E.P. Young, Mental deficiency and new aminoaciduria, Am. J. Dis. Child. 117 (1969) 71 – 82. [13] U. Hannestad, J. Martensson, R. Sjodahl, B. Sorbo, 3-Mercaptolactate-cysteine disulfiduria in the urine of a mentally retarded patient, Biochem. Med. 26 (1981) 106 – 114. [14] A. Niederwieser, P. Giliberti, K. Baerlocher, Beta-mercaptolactatecysteine disulfiduria in two normal sisters. Isolation and characterization of beta-disulfiduria, Clin. Chim. Acta 43 (1973) 405 – 416. [15] M. Gardiner-Garden, M. Frommer, CpG islands in vertebrate genomes, J. Mol. Biol. 196 (1987) 261 – 282. [16] S.T. Smale, A. Jain, J. Kaufmann, K.H. Emami, K. Lo, I.P. Garraway, The initiator element: a paradigm for core promoter heterogeneity within metazoan protein-coding genes, Cold Spring Harbor Symp. Quant. Biol. 63 (1998) 21 – 31. [17] A. Fujisawa-Sehara, K. Sogawa, M. Yamane, Y. Fujii-Kuriyama, Characterization of xenobiotic responsive elements upstream from the drug-metabolizing cytochrome P-450c gene: a similarity to glucocorticoid regulatory elements, Nucleic Acids Res. 15 (1987) 4179 – 4191. [18] A. Fujisawa-Sehara, M. Yamane, Y. Fujii-Kuriyama, A DNA-binding factor specific for xenobiotic responsive elements of P-450c gene exists as a cryptic form in cytoplasm: its possible translocation to nucleus, Proc. Natl. Acad. Sci. U. S. A. 85 (1988) 5859 – 5863. [19] R. Pallini, G.C. Guazzi, C. Cannella, M.G. Cacace, Cloning and sequence analysis of the human liver rhodanese: comparison with the bovine and chicken enzymes, Biochem. Biophys. Res. Commun. 180 (1991) 887 – 893. [20] M.S. Alphey, R.A. Williams, J.C. Mottram, G.H. Coombs, W.N. Hunter, The crystal structure of Leishmania major 3-mercaptopyruvate sulfurtransferase. A three-domain architecture with a serine protease-like triad at the active site, J. Biol. Chem. 278 (2003) 48219 – 48227. [21] A. Spallarossa, F. Forlani, A. Carpen, A. Armirotti, S. Pagani, M. Bolognesi, D. Bordo, The brhodaneseQ fold and catalytic mechanism of 3-mercaptopyruvate sulfurtransferases: crystal structure of SseA from Escherichia coli, J. Mol. Biol. 335 (2004) 583 – 593. [22] K. Maruyama, S Sugano, Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides, Gene 138 (1994) 171 – 174. [23] B.C. Schaefer, Revolutions in rapid amplification of cDNA ends: new strategies for polymerase chain reaction cloning of full-length cDNA ends, Anal. Biochem. 227 (1995) 255 – 273. [24] Y. Matsuzaki, K. Miyazawa, T. Yokota, T. Hitomi, H. Yamagishi, T. Sakai, Molecular cloning and characterization of the human p19(INK4d) gene promoter, FEBS Lett. 517 (2002) 272 – 276. [25] S. Bandiera, S. Safe, A.B. Okey, Binding of polychlorinated biphenyls classified as either phenobarbitone-,3-methylcholanthrene- or mixedtype inducers to cytosolic Ah receptor, Chem.-Biol. Interact. 39 (1982) 259 – 277. [26] N. Matsushita, K. Sogawa, M. Ema, A. Yoshida, Y. Fujii-Kuriyama, A factor binding to the xenobiotic responsive element (XRE) of P4501A1 gene consists of at least two helix-loop-helix proteins, Ah receptor and Arnt, J. Biol. Chem. 268 (1993) 21002 – 21006.

184

N. Nagahara et al. / Biochimica et Biophysica Acta 1680 (2004) 176–184

[27] A. Baniahmad, C. Steiner, A.C. Kohne, R. Renkawitz, Modular structure of a chicken lysozyme silencer: involvement of an unusual thyroid hormone receptor binding site, Cell 61 (1990) 505 – 514. [28] M. Mieda, T. Haga, D.W. Saffen, Promoter region of the rat m4 muscarinic acetylcholine receptor gene contains a cell type-specific silencer element, J. Biol. Chem. 271 (1996) 5177 – 5182.

[29] I.C. Wood, A. Roopra, N.J. Buckley, Neural specific expression of the m4 muscarinic acetylcholine receptor gene is mediated by a RE1/NRSE-type silencing element, J. Biol. Chem. 271 (1996) 14221 – 14225. [30] S. Ogbourne, M. Antalis, Transcriptional control and the role of silencers in transcriptional regulation in eukaryotes, Biochem. J. 331 (1998) 1 – 14.