A Point Mutation of Acetylcholinesterase Associated with Azinphosmethyl Resistance and Reduced Fitness in Colorado Potato Beetle

PESTICIDE BIOCHEMISTRY AND PHYSIOLOGY ARTICLE NO.

55, 100–108 (1996)

0039

A Point Mutation of Acetylcholinesterase Associated with Azinphosmethyl Resistance and Reduced Fitness in Colorado Potato Beetle KUN YAN ZHU,1 SI HYEOCK LEE,2

AND

J. MARSHALL CLARK3

Department of Entomology, Fernald Hall, University of Massachusetts, Amherst, Massachusetts 01003 Received March 14, 1996; accepted June 26, 1996 A serine to glycine point mutation of acetylcholinesterase (AChE, EC 1.1.1.7) was identified in an azinphosmethyl-resistant strain of Colorado potato beetle [Leptinotarsa decemlineata (Say)]. The position of the mutation corresponds to Val 238 of the Torpedo AChE and represents the first amino acid residue to form the a-helix, a-E1* . The predicted secondary structure of the mutation-containing region of AChE suggested that the transition from the turn to the a-helix occurs sooner in the sequence when serine is replaced by glycine. Thus, conformational changes in the AChE due to the a-helix deformation were expected to impinge upon both the catalytic and the peripheral binding sites, resulting in the modification of the bindings of organophosphorus insecticides and other ligands to these sites. The mutation appeared to be associated with the fitness of the beetle. The intrinsic rate of increase of the azinphosmethyl-resistant (AZ-R) strain was relatively low when the beetles were reared on the Russet Burbank potato cultivar, but was relatively high when they were reared on the NDA 1725-1 potato cultivar. Because these two potato cultivars contain different amounts of steroidal glycoalkaloids (e.g., a-solanine and a-chaconine), the different fitness of the AZ-R strain on different potato cultivars may be partially attributed to the increased sensitivity of the azinphosmethyl-resistant form of AChE to the inhibition by a-solanine and reduced sensitivity to a-chaconine as previously reported. q 1996 Academic Press, Inc.

INTRODUCTION 4

Acetylcholinesterase (AChE, EC 3.1.1.7) plays a crucial role in insect cholinergic synaptic transmission and is the target site of inhibition by organophosphorus and carbamate insecticides (1). Alterations in the structure of AChE can reduce the level of inhibition by these extensively used insecticides and confer resistance in insects and other arthropod species (2, 3). Although the quantitative change 1 Present address: Department of Entomology, Waters Hall, Kansas State University, Manhattan, KS 66506. 2 Present address: Department of Entomology, New York State Agricultural Experiment Station, Cornell University, Geneva, NY 14456. 3 To whom correspondence should be addressed. 4 Abbreviations used: AChE, acetylcholinesterase; CPB, Colorado potato beetle; cDNA, complementary DNA; AZ-R, nearly isogenic azinphosmethyl-resistant strain of CPB; SS, azinphosmethyl-susceptible strain of CPB; RT-PCR, reverse transcription followed by polymerase chain reaction.

of AChE has been suggested to contribute to the resistance in Drosophila (4), recent molecular studies have demonstrated that decreased sensitivity of AChE is due to structural changes in the AChE gene (4, 5). Furthermore, different resistance patterns can originate from combinations of several point mutations in the AChE gene and high levels of AChE insensitivity could come from the combination of several point mutations (5). Molecular studies on AChE, however, have been limited largely to non-plant-eating dipterous species (5–9), and attempts to understand the genetic basis of altered AChE in pest species have had limited success (10). In the Colorado potato beetle [CPB, Leptinotarsa decemlineata (Say)], we have demonstrated that an altered AChE is a major contributing factor in azinphosmethyl resistance (11) and that resistance is associated with a fitness disadvantage (12). Detailed biochemical and pharmacological studies have further estab-

100 0048-3575/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.

AID

PEST 2215

/

al02$$$$41

10-21-96 18:11:56

pesta

AP: PEST

101

A POINT MUTATION OF ACETYLCHOLINESTERASE

lished that the alteration affected both the esteratic subsite and the peripheral anionic site (13, 14). The successful cloning and sequencing of the AChE complementary DNA (cDNA) from a nearly isogenic strain of this insect allowed us to identify the insecticideresistance mutation (15). The purposes of this study were to understand the biochemical and molecular mechanisms of the altered AChE insensitive to inhibition by azinphosmethyl-oxon in an azinphosmethyl-resistant strain (AZ-R) of CPB; we also wanted to examine the relationship between the sensitivity of AChE from both azinphosmethyl-susceptible (SS) and AZ-R strains of CPB to inhibition by steroidal glycoalkaloids such as a-solanine and a-chaconine and the fitness of both strains reared on different potato cultivars containing different amount of steroidal glycoalkaloids. The information obtained from this study is necessary for the development and implementation of effective and accurate resistance monitoring systems and potentially provides a novel means for the control of plant-eating pest insects and resistance management. MATERIALS AND METHODS

Insect strains and rearing conditions. Both SS and AZ-R strains of CPB were routinely reared on approximately 30-day-old greenhouse grown potato plants (Russet Burbank cultivar) in the laboratory under conditions as described by Argentine et al. (16). Fourth instars were exclusively used for biochemical and molecular studies. Chemicals. Acetylthiocholine iodide, 5,5*dithio-bis-(2-nitrobenzoic acid) (DTNB), and Triton X-100 were purchased from Sigma Chemical Co. (St. Louis, MO). Azinphosmethyl-oxon (O,O-dimethyl-S-[(4-oxo-1,2,3benzotriazin-3-(4H)-yl)methyl] phosphorothioate, 95% pure) was obtained from Mobay Chemical Corp. (Kansas City, MO). Biochemical determination of AChE sensitivity in individual insects. Twenty-four forth instars were randomly collected from each strain. Insects were starved for approximately

AID

PEST 2215

/

al02$$$$42

24 hr to eliminate the food contents from the bodies. Each insect was cut in two between the prothorax and mesothorax on a cold plate with a razor blade. The anterior body part (i.e., head and prothorax) was used for extraction of AChE, whereas the posterior body part (i.e., meso- and metathoraxes and abdomen) was used for extraction of total RNA for DNA analysis (see Fig. 2). The anterior body part was individually homogenized for 30 sec in 150 ml of ice-cold 0.1 M phosphate buffer (pH 7.5) containing 0.3% (v/v) Triton X-100. The homogenate was centrifuged at 16,000g for 20 min at 47C and the supernatant containing AChE was used as enzyme source. The AChE activity was determined according to the method of Ellman et al. (17) using acetylthiocholine as a substrate. The reaction mixture consisted of 0.5 mM acetylthiocholine, 0.4 mM DTNB, 50 mM azinphosmethyl-oxon, and 50 ml AChE preparation in 150 ml of 0.1 M phosphate buffer (pH 7.5). After the reaction was equilibrated for 15 min at 257C, absorbance was recorded for 15 min at 405 nm at 257C with an UVmax kinetic microplate reader (Molecular Devices Corp., Menlo Park, CA). The remaining AChE activity was determined against the control that was performed in parallel but lacked azinphosmethyl-oxon. Molecular analysis of AChE cDNA in individual insects. Total RNA was extracted from the posterior body parts of individual insects following the determination of the AChE sensitivity using a microscale total RNA separator kit (Clontech Laboratories, Inc., Palo Alto, CA). Two micrograms of total RNA from each insect was used to synthesize the first strand cDNA by reverse transcription reaction in 30 ml using cDNA synthesis system (Gibco BRL, Grand Island, NY). The reverse transcription of RNA was followed by the polymerase chain reaction (RT-PCR) (18). A second round of PCR followed the initial PCR using a seminested primer set. Three fragments (1068, 622, and 575 base pairs), with their ends overlapped, were individually amplified from the open reading frame of the

10-21-96 18:11:56

pesta

AP: PEST

102

ZHU, LEE, AND CLARK TABLE 1 Location and Sequence of Oligonucleotide Primers Used for Seminested Polymerase Chain Reaction Following Reverse Transcription (RT-PCR) of RNA

Fragment I

II

III

Primera

Locationb

Oligonucleotide sequence (5* to 3*)c

Forward Reverse A Reverse B Forward Reverse A Reverse B Forward Reverse A Reverse

42–63 1129–1102 1093–1072 1011–1032 1660–1633 1616–1595 1551–1572 2189–2162 2109–2088

ATGAGCTCATTCACTCGGTGAATCGCCCTT GGAATAGGAGTTCCATTGTTGTAGCGAG ACGAATTCAGCATCCACTGCTCTCATACAG ATGAGCTCTCATACAGGACTGTGGCTGCAA TCTTGAGTTGAACTGCAGAGACATGTTC ACGAATTCCGTATTCCACTTCATCTCCGTG ATGAGCTCATAGGACGAGCACGTCGTTATG GGGTAGAATTACGATTTATAAGTGACCC ACGAATTCGAGCATGCGACATTCATACAAG

a

Forward and reverse A primers were used for the first round of PCR. The same forward primer and reverse B primer were used as seminested primer set for the second round of PCR. b The nucleotide locations were based on the previously published AChE cDNA sequence from the Colorado potato beetle (Ref. 15). c The underlined nucleotide sequences are built-in restriction sites (GAGCTC for SacI and GAATTC for EcoRI) to facilitate subcloning of the PCR products.

AChE cDNA using three sets of seminested PCR primers (Table 1). These primer sets (28or 30-mer) were designed based on the locations of the published AChE cDNA sequence from CPB (15). For the first round of PCR, 5–10 ml of the reverse transcription reaction was added to a final volume of 50 ml of reaction mixture containing 50 mM KCl, 10 mM Tris–HCl (pH 10 for the first set of primers and pH 9.5 for the second and third sets of primers), 1.5 mM (for the first set of primers), or 2.0 mM (for the second and third sets of primers) MgCl2 , 200 mM each of four dNTPs, 1 mM each of forward and reverse A primers, and 1.2 units of AmpliTaq DNA polymerase (Perkin Elmer Cetus, Norwalk, CT). For the second round of PCR, 5 ml of the 20-fold diluted reaction from the first round of PCR was used as template with seminested PCR primers (i.e., the same forward and reverse B primers) to amplify each fragment under the same conditions as the first round of PCR. All the PCR was run for 35 cycles, each consisting of 947C for 1 min, 557C for 1 min and 727C for 2 min, after initial denaturation of the templates at 947C for 3 min in a DNA thermal cycler (Model 480, Perkin Elmer

AID

PEST 2215

/

al02$$$$42

Cetus). The PCR products, which contained the predesigned restriction sites (EcoRI and SacI), were subcloned into Bluescript plasmid vector (Strategene, La Jolla, CA) for sequencing. To avoid any potential PCR-introduced mutation, the overnight bacterial cultures from four to five positive clones from each fragment were pooled for DNA preparation. The double strand DNA was sequenced by the dideoxy chain termination method (19) using sequenase version 2 (U.S. Biochemical Corp., Cleveland, OH). The DNA sequences were compared between strains as well as within strains. Fitness comparison. The experimental protocols were modified from Argentine et al. (12). To determine the developmental status and time more accurately, four potato plants (approximately 30-day-old) in a caged pot were initially infested with 100 newly hatched larvae, and the infestation was replicated three times. As the larvae grew, up to six pots of potato plants (approximately 24 plants) were provided. Larval mortality and average body weight were recorded 8 days later, and the developmental time and total number of emerged adults were recorded from 27 to 34 days after infestation.

10-21-96 18:11:56

pesta

AP: PEST

103

A POINT MUTATION OF ACETYLCHOLINESTERASE

In order to estimate biotic potential, each of 7 to 12 pairs of reproductive adults obtained from the above experiment was used to infest approximately four potato plants in a caged pot and allowed to lay eggs. The mean number of eggs and the mean number of hatched larvae were determined every 1–3 days for 35 days. The mean replacement rate (No. of female progeny produced from a single mating female per generation) and the intrinsic rate of increase (r) were calculated as follows: mean replacement rate Å (fecundity) (hatchability) (eclosion rate)/2, where eclosion rate is defined as proportion of the first instars surviving to adults; and r Å (log mean replacement rate)/(developmental time). RESULTS AND DISCUSSION

Our molecular analysis of AChE was coupled with an enzyme inhibition assay using azinphosmethyl-oxon in individual insects. The susceptibilities of AChEs extracted from the heads and prothoraxes of forth instars of the SS and AZ-R strains of CPB are given in Fig. 1. The remaining activity of AChE inhibited by 50 mM azinphosmethyl-oxon was 26.3% { 11.6 (mean { SD, n Å 24) for the SS strain and 53.2% { 6.5 (mean { SD, n Å 24) for the AZ-R strain. AChE inhibition in the SS strain was more variable than that from the AZ-R strain as judged by the SD values. Following AChE determination, the remaining body segments (i.e., meso- and metathoraxes and abdomen) of four individuals with the most sensitive AChE from the SS strain and six individuals with the least sensitive AChE from the AZ-R strain were used for molecular analysis. The Arg/Lys mutation (location 198) occurred in only four of six AZ-R beetles (i.e., insects 1, 2, 3, and 4, AZR strain) (Fig. 2). This mutation is located in the first amino acid residue of mature AChE (15) and is not likely to affect significantly the protein structure. Insect 3 had a Met/Thr mutation (location 771), and insect 5 had a Phe/Ser mutation (location 1143). The position of the Phe/Ser mutation is the same as that of the Phe/Tyr mutation which contributes

AID

PEST 2215

/

al02$$$$42

to insecticide resistance in Drosophila melanogaster (4, 5). The inconsistent occurrence of these mutations, however, suggests that they are not likely to be responsible for any reduction of the AChE sensitivity to inhibition by azinphosmethyl-oxon because all six beetles possessed AChEs with virtually the same level of insensitivity to azinphosmethyl-oxon (Fig. 1). Thus, the only nonsilent mutation consistent with our AChE inhibition data and that occurs in all AZ-R beetles examined is the Ser/Gly (location 980, Fig. 2). The Ser/Gly mutation was also found in approximately 80% of AChE cDNA sequences amplified by PCR from the nearly isogenic AZ-R strain (Zhu and Clark, unpublished results). When PCR amplification of specific alleles (PASA) (20) and AChE inhibition assays were used to identify the mutation in the individual beetles, the mutation was found in all 13 AZ-R beetles but was absent in all 13 SS beetles (Zhu and Clark, unpublished results). These findings further support our contention that the Ser/Gly mutation is essentially responsible for the reduced sensitivity of AChE to inhibition by azinphosmethyloxon in the AZ-R strain and for this aspect of azinphosmethyl resistance. Thus, the coupling of molecular analysis with the enzyme inhibition assay of AChE in individual beetles from nearly isogenic strains has proven to be a most useful approach. The Ser/Gly mutation results in an amino acid change that does not occur within either the esteratic subsite or the peripheral anionic site of AChE (Fig. 3a). This amino acid residue corresponds to Val 238 of the Torpedo AChE and represents the first amino acid residue to form the a-helix, a-E*1 , from the turn sequence that precedes it (21). The predicted secondary structure of the mutation-containing region of AChE from CPB (DNASIS software package, Hitachi Software Engineering Co., Ltd, San Bruno, CA) indicates that the transition from the turn to the a-helix occurs sooner in the sequence when serine is replaced by glycine (Fig. 3b). Because glycine

10-21-96 18:11:56

pesta

AP: PEST

104

ZHU, LEE, AND CLARK

FIG. 1. Profiles of the susceptibilities of AChE from individual insects of the SS and AZ-R strains of Colorado potato beetle to inhibition by 50 mM azinphosmethyl-oxon. Stars and solid circles indicate the individuals that possessed the least sensitive AChE from the AZ-R strain (Nos. 1–6) and the most sensitive AChE from the SS strain (Nos. 1–4), respectively. These same insects were used for AChE molecular analysis (see Fig. 2).

is the smallest amino acid and is not optically active, the mutation is expected to increase the flexibility in the folding of the protein due to the lack of the side chain at the a-carbon

of Gly. Furthermore, unlike serine, glycine does not have a hydroxyl group for cross-hydrogen bonding (22). Thus, the Ser/Gly mutation is consistent with a destabilization in the

FIG. 2. Summary of nonsilent mutations found in the AChE cDNA from the AZ-R strains of CPB. The location in the first column indicates where the change of the nucleotide occurs corresponding to the published AChE cDNA sequence from CPB (ref. 15). The insect numbers under each strain correspond to those in Fig. 1, and the underlined codons represent the mutations/polymorphisms.

AID

PEST 2215

/

al02$$$$42

10-21-96 18:11:56

pesta

AP: PEST

105

A POINT MUTATION OF ACETYLCHOLINESTERASE

FIG. 3. (a) The position of the Ser/Gly mutation found in the AZ-R strain of CPB in relation to the structural elements involved in the binding and catalytic sites in the primary structure of Torpedo AChE (Ref. 28). (b) Secondary structure predictions of the Ser/Gly mutation containing region of AChE in CPB using DNASIS software (Hitachi Software Engineering Co., Ltd., San Bruno, CA). (c) Ribbon diagram of the Ser/Gly mutation containing region of AChE showing the most likely effects of the mutation on both the esteratic subsite and the peripheral anionic site. The ribbon diagram was generated from amino acid residues 80 to 90 and from 198 to 315 based on the structure of the Torpedo AChE (Ref. 21).

aE*1-helix structure, leading to an altered secondary structure of the resistant AChE. Conformational changes in the AChE due to the helix deformation are expected to impinge upon both the catalytic and peripheral binding sites due to the location of the Ser/Gly mutation (Fig. 3c). This hypothesis is supported by our detailed biochemical and pharmacological data, which indicates that the alteration of the

AID

PEST 2215

/

al02$$$$42

highly purified AChE from the AZ-R strain modifies the bindings of organophosphorus insecticides and other ligands to both esteratic subsite in the catalytic center and peripheral anionic site (14). Azinphosmethyl-oxon is a relatively potent AChE inhibitor that binds to the catalytic center of AChE. AChE purified from the AZ-R strain was 16-fold less sensitive to inhibition

10-21-96 18:11:56

pesta

AP: PEST

106

ZHU, LEE, AND CLARK TABLE 2 Fitness Comparison between the SS and AZ-R Strains of Colorado Potato Beetle Reared on Potato Plants with Low (Russet Burbank) or High (NDA 1725-1) a-Chaconine Content Russet Burbank SS

Larval mortality [% (SE)] Mean forth instar weight [mg (SE)] Eclosion rate (SE)a Development time [day (SE)] Fecundity (eggs/female) Hatchabilityc Mean replacement rated Intrinsic rate of increase (r)e Relative r f

NDA 1725-1

AZ-R

11.3 (2.9) 172.1 (3.4) 0.60 (0.08) 29.6 (0.8) 460 0.59 81 0.065 1.00

13.0 (2.6) 162.5 (8.3) 0.54 (0.08) 29.9 (0.6) 403 0.53 58 0.059 0.91

SS

AZ-R

12.6 (2.3) 171.3 (6.7) 0.60 (0.13) 29.9 (0.4) 338 0.54 55 0.058 1.00

13.0 (4.4) 173.9 (1.8) 0.47 (0.09) 27.9 (0.3)b 449 0.55 58 0.063 1.09

a

Proportion of the first instars surviving to adults. Statistically significant difference from the SS strain (t test, P õ 0.05). c Proportion of egg hatch. d Mean replacement rate (i.e., number of adult females produced per female per generation) Å (fecundity) (hatchability) (eclosion rate)/2. e Intrinsic rate of increase (r) Å (log mean replacement rate)/(developmental time). f Relative r Å r (SS or AZ-R strain)/r (SS strain) in the same potato cultivar. b

by azinphosmethyl-oxon than the AChE from the SS strain (14). Evidence also suggests that the overall fitness of the AZ-R strain is reduced, placing those individuals at a reproductive disadvantage as compared with the SS strain (12). Potatoes and other solanaceous plants, which serve as the sole food source for CPB, contain high levels of steroidal glycoalkaloids, such as a-chaconine and a-solanine. These plant compounds are potent AChE inhibitors and their anticholinesterase activity has been attributed to their interaction with the peripheral anionic site of AChE (14, 23, 24). We have previously reported that AChE from the AZ-R strain was 1.7- and 1.8-fold more sensitive to inhibition by a-solanine and tomatine, respectively, but was 1.3-fold less sensitive to inhibition by a-chaconine than AChE from the SS strain (14). Because achaconine is the major steroidal glycoalkaloid in potato, whereas tomatine is very low or absent, one might speculate that the alteration of AChE in the AZ-R beetles may impart a fitness advantage over the SS strain if they are reared on the potato plants containing high levels of a-chaconine.

AID

PEST 2215

/

al02$$$$42

To test this hypothesis, the relative fitness of the AZ-R and SS strains were examined when the insects were reared on potato plants with high (NDA 1725-1) or low (Russet Burbank) a-chaconine content. The NDA 17251 potato cultivar contains approximately sevenfold more a-chaconine compared to the Russet cultivar (25). The AZ-R strain has a reduced intrinsic rate of increase (r) compared to the SS strain when both strains were reared on the Russet cultivar containing low levels of a-chaconine (Table 2), which this agrees with the original finding by Argentine et al. (12). This decreased intrinsic rate of increase may be partially attributed to the increased sensitivity of the azinphosmethyl-resistant form of AChE to a-solanine that commonly coexists with a-chaconine in potato cultivars (14). Because many insects may have a considerable excess of AChE relative to what they strictly need (26), this finding may seem inconsistent. CPB, however, has extremely low amount of AChE and the AChE activity is low as compared with those from other animal species (13). Thus, the decreased affinity and lower hydrolyzing efficiency of AChE to sub-

10-21-96 18:11:56

pesta

AP: PEST

107

A POINT MUTATION OF ACETYLCHOLINESTERASE

strates in the AZ-R strain may reasonably affect their fitness (14). In contrast, the intrinsic rate of increase of the AZ-R strain was higher than the SS strain when the insects were reared on the NDA 1725-1 cultivar containing a high level of achaconine. Because potato plants normally contain ca. 1.5- to 2.0-fold more a-chaconine than a-solanine (25) and a-chaconine is a more potent inhibitor of AChE than a-solanine (14), the higher a-chaconine content in the NDA 1725-1 cultivar may play a predominant role, resulting in higher fitness in the AZR strain than in the SS strain. These results are consistent with the suggestion that the fitness disadvantage associated with the AZ-R strain is due, in part, to the allelic selection of an altered AChE. The altered AChE is less sensitive to inhibition by azinphosmethyl-oxon and a-chaconine (14) and may provide the AZ-R beetles with a fitness advantage when grown on a cultivar containing high levels of the antiacetylcholinesterase, a-chaconine. Conversely, it is expected that SS strain will have a fitness advantage over the AZ-R strain if grown on host plants that contain high levels of a-solanine and tomatine. Such a fitness disadvantage associated with insecticide resistance potentially provides a novel strategy for insect control and resistance management (27). For example, careful selection of potato cultivars with relatively high a-solanine contents or rotation with crops such as tomatoes containing high tomatine contents is likely to reduce the frequency of the mutation within the CPB population. Further study is necessary, however, to examine how a fitness disadvantage associated with the mutation is regulated and how plant biochemicals modify such genetic regulation. ACKNOWLEDGMENTS The authors thank Dr. D. Fournier (Laboratoire d’Entomologie, Universite´ Paul Sabatier, France) for his kind help in generating ribbon diagrams of Torpedo acetylcholinesterase. This research was supported by research Grants, USDA (NAPIAP)-TPSU-UM-3361-529, USDA (NRICGP)-9502111, MAES (Hatch Grant 617), and USDA Regional Research Grant NE (180).

AID

PEST 2215

/

al02$$$$42

REFERENCES 1. B. N. Smallman and A. Mansingh, The cholinergic system in insect development, Annu. Rev. Ent. 14, 387 (1969). 2. F. J. Oppenoorth, Biochemistry and genetics of insecticide resistance, in ‘‘Comprehensive Insect Physiology, Biochemistry and Pharmacology’’ (G. A. Kerkut and L. I. Gilbert, Eds.), Vol. 12, pp. 731–773, Pergamon, New York, 1985. 3. D. Fournier and A. Mutero, Modification of acetylcholinesterase as a mechanism of resistance to insecticides, Comp. Biochem. Physiol. 108C, 19 (1994). 4. D. Fournier, J.-M. Bride, F. Hoffmann, and F. Karch, Acetylcholinesterase: Two types of modifications confer resistance to insecticide, J. Biol. Chem. 267, 14,270 (1992). 5. A. Mutero, M. Pralavorio, J.-M. Bride, and D. Fournier, Resistance-associated point mutations in insecticide-insensitive acetylcholinesterase, Proc. Natl. Acad. Sci. USA 91, 5,922 (1994). 6. L. M. C. Hall and P. Spierer, The Ace locus of Drosophila melanogaster: Structural gene for acetylcholinesterase with an unusual 5* leader, EMBO J. 5, 2949 (1986). 7. D. Fournier, F. Karch, J.-M. Bride, L. M. C. Hall, J. B. Berge´, and P. Spierer, Drosophila melanogaster acetylcholinesterase gene: Structure, evolution and mutations, J. Mol. Biol. 210, 15 (1989). 8. L. M. C. Hall and C. A. Malcolm, The acetylcholinesterase gene of Anopheles stephensi, Cell. Mol. Neurobiol. 11, 131 (1991). 9. M. S. Williamson, G. D. Moores, and A. L. Devonshire, Altered forms of acetylcholinesterase in insecticide resistant houseflies (Musca domestica), in ‘‘Muftidisciplinary Approaches to Cholinesterase Functions’’ (A. Shafferman and B. Velan, Eds.), pp. 83–86, Plenum, New York, 1992. 10. A. L. Devonshire, L. M. Field, and M. S. Williamson, Molecular biology of insecticide resistance, in ‘‘Insect Molecular Science’’ (J. M. Crampton and P. Eggleston, Eds.), pp. 173–183, Academic Press, San Diego, 1992. 11. J. A. Argentine, K. Y. Zhu, S. H. Lee, and J. M. Clark, Biochemical mechanisms of azinphosmethyl resistance in isogenic strains of Colorado potato beetle, Pestic. Biochem. Physiol. 48, 63 (1994). 12. J. A. Argentine, J. M. Clark, and D. N. Ferro, Relative fitness of insecticide-resistant Colorado potato beetle strains (Coleoptera: Chrysomelidae), Environ. Entomol. 18, 705 (1989). 13. K. Y. Zhu and J. M. Clark, Purification and characterization of acetylcholinesterase from the Colorado potato beetle, Leptinotarsa decemlineata (Say), Insect Biochem. Molec. Biol. 24, 453 (1994). 14. K. Y. Zhu and J. M. Clark, Comparison of kinetic properties of acetylcholinesterase purified from azinphosmethyl-susceptible and resistant strains of Colo-

10-21-96 18:11:56

pesta

AP: PEST

108

15.

16.

17.

18.

19.

20.

21.

ZHU, LEE, AND CLARK

rado potato beetle, Pestic. Biochem. Physiol. 51, 57 (1995). K. Y. Zhu and J. M. Clark, Cloning and sequencing of a cDNA encoding acetylcholinesterase in Colorado potato beetle, Leptinotarsa decemlineata (Say), Insect Biochem. Mol. Biol. 25, 1129 (1995). J. A. Argentine, J. M. Clark, and D. N. Ferro, Genetics and synergism of azinphosmethyl and permethrin in the Colorado potato beetle (Coleoptera: Chrysomelidae), J. Econ. Entomol. 82, 698 (1989). G. L. Ellman, K. D. Courtney, V. Andres, Jr., and R. M. Featherstone, A new and rapid colorimetric determination of acetylcholinesterase activity, Biochem. Pharmacol. 7, 88 (1961). D. A. Pappolee, D. Mark, M. J. Banda, and Z. Werb, Would macrophages express TGF-a and other growth factors in vivo: Analysis by mRNA phenotyping, Science 241, 708 (1991). F. Sanger, S. Nicklen, and A. R. Coulson, DNA sequencing with chain-terminating inhibitors, Proc. Natl. Acad. Sci. USA 74, 5463 (1977). K. Y. Zhu and J. M. Clark, Addition of a competitive primer can dramatically improve the specificity of PCR amplification of specific alleles (PASA), BioTechniques, in press. J. L. Sussman, M. Harel, F. Frolow, C. Oefner, A. Goldman, L. Toker, and I. Silman, Atomic structure of acetylcholinesterase from Torpedo californica: A

AID

PEST 2215

/

al02$$$$43

22. 23.

24.

25.

26.

27.

28.

prototypic acetylcholine-binding protein, Science 253, 872 (1991). J. E. Bell and E. T. Bell, ‘‘Proteins and Enzymes,’’ Prentice-Hall, Englewood Cliffs, NJ, 1988. S. A. Miller, Food additives and contaminants, in ‘‘Casarett and Doull’s Toxicology: The Basic Science of Poisons’’ (M. O. Amdur, J. Doull, and C. D. Klaassen, Eds.), 4th ed., pp. 819–853, Pergamon, New York, 1991. J. M. Wierenga and R. M. Hollingworth, Inhibition of insect acetylcholinesterase by the potato glycoalkaloid a-chaconine, Nat. Toxins 1, 96 (1992). M. Friedman and L. Dao, Distribution of glycoalkaloids in potato plants and commercial potato products, J. Agric. Food Chem. 40, 419 (1992). H. R. Smissaert, F. M. Abd El Hamid, and W. P. J. Overmeer, The minimum acetylcholinesterase (AChE) fraction compatible with life derived by aid of a simple model explaining the degree of dominance of resistance to inhibitors in AChE ‘‘mutants,’’ Biochem. Pharmacol. 24, 1043 (1975). G. P. Georghiou, Management of resistance in arthropods, in ‘‘Pest Resistance to Pesticides’’ (G. P. Georghiou and T. Saito, Eds.), pp. 769–792, Plenum, New York, 1983. J. Massoulie´, L. Pezzementi, S. Bon, E. Krejci, and F.-M. Vallette, Molecular and cellular biology of cholinesterase, Prog. Neurobiol. 41, 31 (1993).

10-21-96 18:11:56

pesta

AP: PEST