A polyvalent DNA vaccine expressing an ESAT6–Ag85B fusion protein protects mice against a primary infection with Mycobacterium tuberculosis and boosts BCG-induced protective immunity

Vaccine 23 (2004) 780–788

A polyvalent DNA vaccine expressing an ESAT6–Ag85B fusion protein protects mice against a primary infection with Mycobacterium tuberculosis and boosts BCG-induced protective immunity Steven C. Derrick, Amy Li Yang, Sheldon L. Morris∗ Laboratory of Mycobacterial Diseases and Cellular Immunology, Center for Biologics Evaluation and Research, United States Food and Drug Administration, Building 29, Room 502, CBER/FDA, 29 Lincoln Drive, Bethesda, MD 20892, USA Received 22 December 2003; received in revised form 10 May 2004; accepted 6 July 2004 Available online 25 August 2004

Abstract In this study, we evaluated the protective efficacy of a DNA vaccine (pE6/85) expressing an ESAT6–Ag85B fusion protein against a primary Mycobacterium tuberculosis infection in mice. In short-term studies, vaccination with pE6/85 protected as well as Mycobacterium bovis BCG immunization with similar lung pathology and bacterial burdens detected 28 days after a low dose aerogenic challenge (>1.0 log10 reduction relative to na¨ıves). In a survival experiment, the protection induced by pE6/85 immunization was also not significantly different than that elicited by BCG vaccination with the mean-times-to-death (±standard error of the mean) being 102 ± 20, 271 ± 32 and 299 ± 14 days for na¨ıve, pE6/85 and BCG-vaccinated mice, respectively. Furthermore, boosting with pE6/85 but not BCG or a DNA vaccine cocktail at 1 year after an initial BCG immunization (when BCG-induced protection was declining), augmented protection in the lung at 15 and 18 months to levels detected at 3 months post-BCG vaccination. © 2004 Elsevier Ltd. All rights reserved. Keywords: Tuberculosis; BCG; Vaccine

1. Introduction The tuberculosis epidemic is a global public health tragedy that is being fueled by the spread of HIV/AIDS and the increasing incidence of multiple drug resistance [1,2]. The WHO has estimated that in the next two decades more than a billion people will be newly infected and about 36 million people will die from TB if control of this disease is not substantially strengthened [3]. Importantly, only 40% of new cases of pulmonary TB are currently detected [4]. This modest rate of case detection suggests that even highly effective drug therapy programs will fail to curb the overall epidemic. Although the current TB vaccine, Mycobacterium bovis BCG, has been widely used for decades, its efficacy has been shown to be highly variable in several well-controlled clinical ∗

Corresponding author. Tel.: +1 301 496 5978; fax: +1 301 435 5675. E-mail address: [email protected] (S.L. Morris).

0264-410X/$ – see front matter © 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.vaccine.2004.07.036

trials [5]. While BCG immunization is generally protective against miliary and menigial TB in children, the inadequacy of BCG results primarily from its inability to protect against primary lung infections including the most prevalent form of the disease, adult pulmonary TB [5,6]. Unfortunately, this adult form of tuberculosis is responsible for a significant proportion of the global burden of TB. This failure of the BCG vaccine to protect in older age groups likely results because of waning anti-tuberculous protective immune responses about one decade after the initial immunization [7]. In fact, there is minimal evidence that BCG-induced protection last longer that 15 years [6]. Several countries have instituted BCG revaccination programs to counter these temporal declines in BCG-induced protective immunity. However, formal clinical trials have shown that revaccination with BCG in early adulthood does not appear to prevent adult pulmonary disease regardless of the age of the boosted individual or the time interval between vaccinations [8]. Furthermore, results

S.C. Derrick et al. / Vaccine 23 (2004) 780–788

for the Chingleput trial has emphasized an additional concern relating to BCG boosting of adolescents and adults. In individuals evaluated in this trial that were negative to tuberculin (<8 mm response) and older than 15 years of age, BCG vaccination seemed to increase susceptibility to TB and enhance the overall risk of disease [9]. Clearly, the development of new, more effective vaccines and immunization strategies designed to protect against primary infection and to boost waning BCG-induced protective responses are needed to facilitate worldwide control of tuberculosis. As a consequence, the search for new vaccines has intensified recently with at least two vaccines currently being tested in the clinic and several others approaching the clinical evaluation phase [10]. Since DNA vaccines can induce substantial cellular immunity and can evoke both CD4 and CD8 T cell responses, DNA immunization has become a viable strategy in the development of new vaccines against intracellular pathogens [10,11]. DNA vaccines expressing single TB antigens have been shown to elicit protective immune responses against primary TB infections and to amplify BCG responses using prime/boost strategies [12–15]. In a mouse model of pulmonary TB, our group has shown that DNA vaccine cocktails can elicit sustained anti-tuberculosis protective immunity that is essentially equivalent to BCG-induced protective responses [16]. In recent years, the genetic immunization approach has been extended to include multi-gene DNA vaccines with DNA plasmids encoding HIV and leishmania multiepitope polyproteins being currently developed and characterized [17,18]. The multigenic vaccine approach is attractive because broad immune responses can be generated by simultaneously targeting several antigens. A vaccine containing a variety of different protective epitopes is also less likely to suffer MHC-related non-responsiveness in the heterogeneous human population. Furthermore, a single multi-gene construct vaccine would be easier to standardize and less expensive and time-consuming to manufacture than a multiple component vaccine cocktail preparation. In this manuscript, we describe the development and characterization of a polyvalent TB DNA vaccine that expresses a fusion protein of two highly immunogenic M. tuberculosis antigens, ESAT6 and antigen 85B. We show that immunization with this vaccine construct is protective in a primary Mycobacterium tuberculosis aerogenic infection model. In addition, we demonstrate that administration of this multigene DNA construct boosts declining BCG-induced immune responses in mice. These results suggest that multigenic TB DNA constructs are promising candidates for testing as vaccines in future clinical trials.

781

were maintained under barrier conditions and fed commercial mouse chow and water ad libitum. The mice were 6–8 weeks old at the time of the vaccinations. 2.2. Microorganisms M. tuberculosis Erdman (TMC 107) and M. bovis BCG Pasteur (TMC1011) were obtained from the Trudeau Mycobacterial Culture Collection, Saranac Lake, New York. The Escherichia coli DH5␣ and TOP10 strains (Invitrogen, Carlsbad, CA) were used for cloning. 2.3. Construction of the pE6/85 DNA vaccine construct

2. Materials and methods

The ESAT6 and antigen 85B (Ag85B) genes were amplified from H37Rv chromosomal DNA, using Vent DNA polymerase (New England Biolabs, Beverly, MA) with the following primers encoding appropriate restriction enzyme sites for cloning into the pJW4303 vector: ESAT6F(NheI)—ACGCTAGCATGACAGAGCAGCAGTGG; ESAT6R(EcoRI)—GAGAATTCTGCGAACATCCCAGTGACGTTG; Ag85BF(EcoRI)—ACGAATTCGCTGCTACAGACGTGAGCCGAAAGATTC; Ag85BR(Bam HI)—AGGGATCCTCAGCCGGCGCCTAACGAAC. The pJW4303 plasmid was constructed to contain the tissue– plasminogen activator (tpa) signal sequence between the HindIII and NheI restriction sites. Both PCR products were first cloned into the PCR 2.1Topo vector (Invitrogen) and then amplified in E. coli TOP10 cells in LB medium with 50 ␮g/ml kanamycin. The plasmids were purified from TOP10 cells using a Wizard Plus Miniprep Kit (Promega, Madison, WI). The ESAT6 and Ag85B genes were excised from the PCR 2.1 vector by digestion with NheI and EcoRI for ESAT6 or EcoRI and BamHI for Ag85B, gel-purified and then added together in a ligation reaction with gel-purified pJW4303 previously digested with NheI and BamHI. The resulting construct consisted of ESAT6 and Ag85B fused in frame with the tpa signal sequence (with the Kozak sequence included) at the 5-prime end followed by ESAT6 (with the stop codon deleted) and then Ag85B at the 3 end. The fusion was also designed to include an alanine–alanine spacer between the two protein coding sequences. The tpa-ESAT6–Ag85B construct (pE6/85) was gel-purified from pJW4303 after digesting with HindIII and BamHI and then ligated into the pVAX vector (Invitrogen). The vaccine was maintained and amplified in E. coli DH5␣ grown in LB medium, containing 50 ␮g/ml kanamycin. Endotoxin-free plasmid DNA was purified from E. coli DH5␣ cells using an Endo-free Plasmid Mega Kit (Qiagen, Chatsworth, CA). To verify the integrity of the construct, the entire pE6/85 insert was sequenced.

2.1. Animals

2.4. In vitro expression from the pE6/85 construct

Pathogen-free C57BL/6 female mice were obtained from the Jackson Laboratories (Bar Harbor, Maine). The mice

Rhabdomyosarcoma (RD) cells (ATCC CCL 136) were grown in high-glucose Dulbecco’s modified Eagle medium

782

S.C. Derrick et al. / Vaccine 23 (2004) 780–788

supplemented with 5% fetal bovine serum, 2 mM glutamine, 0.1 mM MEM non-essential amino acids solution, 1 mM MEM sodium pyruvate and 10 mM HEPES. At 90% confluency in wells of a 6-well plate, the cells were transfected with 1 ␮g per well of pE6/85 or pVAX vector using a lipofectamine 2000 kit (Invitrogen). After 48 h, cytoplasmic RNA was harvested [19], treated with DNase I and then reversetranscribed using a Superscript first-strand cDNA synthesis kit (Invitrogen). Two microliters of the cDNA were used in a 50 ␮l PCR reaction, using Platinum Taq DNA polymerase (Invitrogen), the ESAT6 forward primer and the Ag85B reverse primer for pE6/85, and negative control (empty vector) cDNAs. In vitro expression of the tpa-ESAT6–Ag85B fusion protein was also verified by Western blot analysis of transfected RD cells. Cells were transfected as above with 4 ␮g of pE6/85 or empty vector (pVAX), and, after 24 h, 1.5 ␮l of Golgistop reagent (PharMingen, San Diego, CA) was added to each well of a 6-well plate containing 2 ml of DMEM + 5% FBS and incubated 7 h. Cells were lysed with lysis buffer (0.14 M NaCl, 1.5 mM MgCl2 , 10 mM Tris–Cl (pH 8.0), 0.5% Nonidet P-40, and 1 mM DTT), the nuclei were pelleted and the supernatants were stored at −20 ◦ C. The lysates were concentrated, using a Micron YM-30 (Millipore, Bedford, MA) centrifuge filter. The protein content of the cell lysates was determined using a Micro BCA protein assay kit (Pierce, Rockford, IL), and the same amount of protein (20 ␮g) was added to each well of a NuPAGE 4–12% Bis–Tris gel (Invitrogen). After the proteins were transferred to a nitrocellulose membrane, protein bands were visualized using sera from mice immunized with pE6/85 as the primary antibody and alkaline phosphataseconjugated goat, anti-mouse IgG as the secondary antibody. In vivo expression of the fusion protein was verified via an Ag85B ELISA and sera from na¨ıve mice or from mice following the third pE6/85-vaccination (non-infected). Approximately 1 ␮g of rAg85B (obtained from the TB Research Materials Contract, Colorado State University) was bound to a 96-well plate overnight at 4 ◦ C. After blocking with PBS + 20% FBS, sera from SD1-vaccinated or na¨ıve mice was added to the wells for 1 h. Wells were washed and alkaline phosphatase-conjugated goat anti-mouse IgG was then added and incubated for 1 h. A phosphatase substrate system (KPL, Gaithersburg, MD) was added to the washed wells and the OD405 was recorded, using a plate reader (Molecular Devices, Sunnyvale, CA). 2.5. Evaluation of cytokine immune responses The assessment of vaccine-induced cytokine responses involved the utilization of real-time RT-PCR methods and flow cytometric intracellular IFN-␥ staining assays. Initially, lung cells were isolated from three to five mice within each experimental group 10 days post-TB challenge by shredding the pooled lungs with razor blades and incubating the lung

tissue in dispase (GibcoBRL, Gaithersburg, MD) (10 mg/ml in PBS + 10% FBS) for 1 h. The lungs cells were passed through a cell strainer (BD Falcon, Bedford, MA), pelleted and the erythrocytes were removed using ACK lysing buffer (Quality Biological Inc., Gaithersburg, MD). The single cell suspension was then used for real-time RT-PCR or intracellular IFN-␥ staining. For real-time RT-PCR, total RNA was isolated from ≥106 lung cells using an RNAqueous-4PCR kit (Ambion Inc., Austin, TX), treated with DNase, and reversed transcribed using a Superscript first-strand synthesis system (Invitrogen). The same amount of RNA (1 ␮g) from each group was used for the cDNA synthesis reaction. The cDNA was used as template for real-time PCR using probe and primers specific for IFN-␥ and were as follows: forward primer (5 -AGCAACAGCAAGGCGAAAA), reverse primer (5 -CTGGACCTGTGGGTTGTTGA), and probe (5 FAM-CCTCAAACTTGGCAATACTCATGAATGCATCCTAMRA). Pre-developed TaqMan reagents for TNF␣, IL-2 and IL-12 were obtained from Applied Biosystems (Foster City, CA). The PCR amplifications were completed with an ABI Prism 7000 sequence detection system (Applied Biosystems). Glyceraldehyde phosphate dehydrogenase (GAPDH) Taqman reagents (Applied Biosystems) were used to measure GAPDH mRNA levels as an internal standard and the level of cytokine mRNA relative to GAPDH mRNA was calculated using the following formula: Relative mRNA expression = 2−(Ct of cytokine−Ct of GAPDH) For the intracellular IFN-␥ staining experiments, 106 cells from each group were added per well to a 24-well plate previously coated with anti-CD3 (clone 145-2C11, 0.25 ml per well of a 10 ␮g/ml solution in PBS) in 1.0 ml DMEM + 5% FBS. Golgistop (0.7 ␮l/ml) and anti-CD28 (clone 37.51) (2 ␮g/ml final) were added to the wells and the cells were incubated at 37 ◦ C for 5 h. The cells were removed from the wells and incubated with anti-mouse CD16/CD32 (Fc␥ III/II receptor, clone 2.4G2) at 4 ◦ C for 10 min in 50 ␮l PBS + 2% FBS. The cells were then stained for 30 min at 4 ◦ C with antibodies against CD4 (rat anti-mouse CD4 fluorescein isothiocyanate (FITC) Ab, clone GK1.5), and CD8 (rat anti-mouse CD8 phycoerythrin (PE) Ab, clone53-6.7) at 0.2 ␮g/106 cells. After washing with PBS + 2% FBS, the cells were fixed and permeabilized with Cytofix/Cytoperm solution (PharMingen) at 4 ◦ C for 30 min. Subsequently, the mouse cells were washed with Perm/Wash solution (PharMingen) and stained with antibody against IFN-␥ (rat anti-mouse IFN-␥ allophycocyanin [APC] Ab, clone XMG1.2, 0.2 ␮g/106 cells) in 50 ␮l Perm/Wash solution at 4 ◦ C for 30 min. After washing with Perm/Wash solution, the cells were suspended in 1.0 ml FACS buffer (PBS + 2% FBS + 0.1% sodium azide) and analyzed using a LSRII flow cytometer (Becton Dickinson) and FACSDiva software. Isotype controls for each antibody were used. All antibodies were obtained from PharMingen.

S.C. Derrick et al. / Vaccine 23 (2004) 780–788

2.6. Evaluation of vaccine-induced protective immunity in an aerogenic infection model For the pE6/85 DNA vaccine studies, endotoxin-free plasmid was prepared and the mice were vaccinated intramuscularly (i.m.) in all four limbs with a total of 0.2 mg of DNA in 0.2 ml PBS per mouse three times at 3-week intervals. The DNA vaccine cocktail was prepared as described earlier [16]. The cocktail consisted of the following nine constructs: Ag85B, ESAT6, katG, MTB8.4, MTB12, MTB39, MTB63, MTB64, and MTB83. To formulate the cocktail vaccine, each of the nine plasmids making up the cocktail were mixed together in equal amounts to achieve a final concentration of 1 mg/ml in PBS. Each mouse received 0.2 mg total of the cocktail i.m. in all four limbs using the same vaccination schedule. Mice receiving BCG Pasteur were vaccinated once subcutaneously (s.c.) with 106 bacteria in 0.2 ml PBS 10 weeks prior to receiving a M. tuberculosis Erdman challenge. For the bacterial burden experiments, five mice were evaluated for each group. In survival studies, five to nine mice per group were assessed. Mice in the survival experiment were maintained until they became moribund and had to be euthanized. Four to five weeks after the final vaccination, mice were aerogenically challenged with M. tuberculosis Erdman suspended in PBS with 0.04% Tween 80 at a concentration known to deliver around 200 colony forming units (CFUs) in the lungs over a 30-min exposure time in a Middlebrook chamber (Glas Col, Terre Haute, IN). To determine the extent of bacterial growth in the lungs and spleens, mice were sacrificed 28 days post-challenge, and their lungs and spleens were removed aseptically and homogenized separately in PBS with 0.04% Tween 80 using a Seward Stomacher 80 blender (Tekmar, Cincinnati, OH). The lung and spleen homogenates were diluted serially in PBS-Tween 80, and 50 ␮l aliquots were added to Middlebrook 7H11 agar (Difco, Detroit, MI) plates supplemented with 10% Middlebrook OADC Enrichment (Becton Dickinson, Sparks, MD) 10 ␮g/ml ampicillin (Sigma, St. Louis, MO), 50 ␮g/ml cycloheximide (Sigma) and 2 ␮g/ml 2-thiophenecarboxylic acid hydrazide (TCH) (Sigma). The addition of TCH to the growth medium inhibits the growth of BCG but not M. tuberculosis. All plates were incubated at 37 ◦ C for 14–17 days in sealed plastic bags, and the colonies were counted to determine the number of CFUs per organ. 2.7. Evaluation of the BCG booster response To assess temporal declines in protective immunity, C57BL/6 mice were vaccinated s.c. with either BCG Pasteur (106 organisms) or i.m. with the DNA vaccine cocktail as described above. At 3, 9, 12, 15, and 18 months after the initial vaccination, the mice were aerogenically challenged with around 200 CFUs of M. tuberculosis Erdman. Four weeks after the challenge, the lungs and spleens were removed and the bacterial burdens were assessed.

783

The BCG boosting effect was evaluated by administering 0.2 mg of the pE6/85 construct, DNA vaccine cocktail, or the vector control to BCG immunized mice at 12, 13 and 14 months after the primary BCG immunization. A single repeat dose of 106 BCG Pasteur organisms was administered at 12 months. After 15 and 18 months, vaccinated mice were challenged with a low dose airborne infection of M. tuberculosis Erdman. Relative bacterial burdens were then determined using standard procedures. Since injection of the vector control had no boosting effect at 15 months, this control was not repeated at 18 months. 2.8. Statistical analysis The cytokine, bacterial CFU and survival data were evaluated using the one-way analysis of variance (ANOVA) of the Graph Pad InStat program.

3. Results 3.1. Construction and characterization of the ESAT6–Ag85B gene fusion A DNA construct expressing a recombinant ESAT6– Ag85B fusion protein was created by amplifying the ESAT6 and Ag85B genes by PCR, fusing the genes together in tandem and in frame, and cloning the digene fragment into the pVAX DNA vaccine vector. This expression construct was designed to include the addition of a N-terminal tissue plasminogen activator (tpa) signal sequence 5 to the ESAT6 coding region, the deletion of the ESAT6 stop codon, and the addition of a alanine–alanine spacer to link the ESAT6 and Ag85B proteins. The capacity of this construct to express the ESAT6–Ag85B fusion protein was verified using RT-PCR and immunoblot analyses of transfected RD cells. After transfection of RD cells with the pE6/85 construct, a cDNA molecule of the appropriate size was reverse- transcribed from RNA extracted from the transfected cells and amplified using a 5 -ESAT6 primer and 3 -Ag85B primer (data not shown). In contrast, no PCR product was observed from cDNA from cells transfected with empty vector. The in vitro expression of the fusion protein was demonstrated by immunblot analysis with lysates of the transfected cells and an anti-pE6/85 polyclonal mouse sera (Fig. 1). While no reaction was observed in the RD cell lysates transfected with empty vector, a single antibody-reactive band of approximately 50 kDa was detected in pE6/85-transfected cell lysates. The size of the reactive band correlated with the predicted size of the tpa-ESAT6–Ag85B fusion protein. Expression of the full-length protein in vivo was confirmed by comparing humoral immune responses of na¨ıve mice with mice vaccinated with the pE6/85 plasmid. In ELISA evaluations, sera from pE6/85-vaccinated mice bound rAg85B whereas sera from na¨ıve mice did not bind this protein (data not shown).

784

S.C. Derrick et al. / Vaccine 23 (2004) 780–788

Relative mRNA Expression (Vaccinated Vs. Naive)

10

*

8

*

*

6

pE6/85

4

BCG

2 0 IFN-gamma

TNF-alpha

IL-2

IL-12

Fig. 2. Vaccine-induced cytokine mRNA responses. Ten days following an aerogenic challenge with M. tuberculosis Erdman, RNA obtained from lung cells of pE6/85-vaccinated, BCG-vaccinated and naive C57BL/6 mice was used for real-time RT-PCR analysis of IFN-␥, TNF␣, IL-2 and IL-12 mRNA concentrations. The levels of the cytokine mRNAs for each group were normalized based on the levels of gapdh mRNA as described in Section 2. The cytokine mRNA levels were expressed as values relative to the mRNA concentrations of the na¨ıve controls. (*) The mRNA levels are significantly elevated compared to the na¨ıve controls (p < 0.05). Fig. 1. Western blot analysis of cell lysates from rhabdomyosarcoma cells transfected with the pE6/85 construct (lane 1) or empty vector (lane 2). The primary antibody used was mouse antisera against pE6/85 and the secondary antibody was alkaline phosphatase-conjugated goat, anti-mouse IgG antibody.

3.2. Evaluation of cytokine responses induced by immunization with the pE6/85 DNA construct The cellular immune responses elicited by the pE6/85 plasmid were assessed by challenging immunized mice with a low dose of virulent organisms and then evaluating cytokine responses in lung cells at 10 days post-infection. We have recently shown that vaccine-enhanced cytokine responses can be detected 4–12 days after an aerogenic tuberculous challenge in this mouse model (C. Goter-Robinson and S. Morris, unpublished results). Initially, IFN-␥, TNF-␣, IL-2, and IL-12 messenger RNA levels in pulmonary cells were assessed by real-time PCR after an aerogenic challenge. As shown in Fig. 2, similar post-infection cytokine mRNA profiles were detected in mice vaccinated with the pE6/85 plasmid or BCG. In vaccinated mice, a significant six-fold increase in IFN-␥ message levels (relative to na¨ıve controls) and a four to five-fold elevation of IL-2 mRNA concentrations were seen at 10 days after the tuberculous challenge. More modest increases in TNF-␣ and IL-12 mRNA levels were detected in the vaccinated mice. Since elevated IFN-␥ mRNA levels were observed and this cytokine is known to be a key effector molecule in the control of tuberculosis, the relative induction of IFN-␥ was assessed more directly in lung cells of vaccinated and na¨ıve mice using flow cytometric intracellular staining methods. Table 1 shows representative results from one of four flow cytometric studies. As with the cytokine mRNA results, the IFN-␥ intracellular staining assays yielded similar data for the BCG immunized and the pE6/85 DNA vaccinated mice. At 10 days post-challenge, approximately a five-fold increase in CD4+ IFN-␥+ cells and

a two-fold increase in CD8+ IFN-␥+ cells were detected in vaccinated mice relative to na¨ıve controls. 3.3. Immunization with the pE6/85 DNA vaccine induces protective immune responses in a primary tuberculosis infection model The capacity of the pE6/85 multi-gene construct to elicit protective immunity in a primary low dose aerogenic challenge model was initially evaluated by comparing the relative growth of mycobacteria in the lungs and spleens of vaccinated and na¨ıve mice at 4-week post-infection. The pE6/85 vaccine was tested in three separate studies. Protection data from a representative experiment is shown in Table 2. Vaccination with the pE6/85 construct consistently reduced the number of lung CFUs (−1.31 log10 ) at 28 days post-challenge relative to that seen in na¨ıve mice (p < 0.01). Importantly, the protection evoked by the pE6/85 vaccine (that encodes the recombinant ESAT6–Ag85B protein) exceeded the reTable 1 Percentages of CD4+ and CD8+ cells synthesizing IFN-␥ at 10 days post-TB challengea Vaccine groupb

%c CD4+ cellsd

% CD8+ cellsd

Na¨ıve pE6/85 BCG

0.3 1.6 1.7

1.1 2.3 2.0

a

Representative experiment of four experiments. C57BL/6 mice were immunized once with BCG or injected three times with pE6/85 as described in Section 2. c Lung cells were gated on the lymphocyte population based on size, and the percentage of CD4+ - and CD8+ -producing IFN-␥ T cells was obtained by flow cytometric analysis. d Lung cells from three to five mice were pooled for each group 10 days post-TB challenge, stimulated for 5 h with anti-CD3 and anti-CD28 antibodies in the presence of monensin, stained for CD4 and CD8, fixed, permeabilized and stained for intracellular IFN-␥ as described in Section 2. b

S.C. Derrick et al. / Vaccine 23 (2004) 780–788 Table 2 Vaccine-induced protection in a mouse model of pulmonary tuberculosis Vaccine groupa

Lung CFUs

Na¨ıve pE6/85 pESAT6 BCG

5.98 4.67 5.26 4.83

± ± ± ±

Spleen CFUs

0.08 0.29 (−1.31)b,* 0.08 (−0.72)* 0.14 (−1.15)*

5.30 4.01 4.28 3.67

± ± ± ±

0.07 0.12 (−1.29)* 0.08 (−1.02)* 0.13 (−1.67)*

a C57BL/6 mice were immunized once with BCG or injected three times with the DNA vaccine preparations as described in Section 2. b The mean ± S.E.M. number of bacteria (log ) isolated from the organs 10 of mice at 28 days following an aerogenic challenge with about 100 CFUs of M. tuberculosis Erdman per mouse. The values in the parenthesis represent the reduction in bacterial burden relative to the na¨ıve controls. ∗ Statistical significance compared to controls, p < 0.01.

% Survival

sponse elicited by a vaccine plasmid expressing ESAT6 alone (−0.72 log10 protection) and was statistically equivalent to the protection generated in the lung by immunization with live BCG (−1.15 log10 ). In addition, the lung protective responses seen after vaccination with the pE6/85 vaccine clearly surpassed the protection produced by a DNA vaccine encoding Ag85B (−0.5 log10 ) or with the vector control (no significant reduction in bacterial burden) reported in previous studies [15,16,20]. Immunization with the pE6/85 plasmid also significantly decreased dissemination of the pulmonary infection to the spleen relative to na¨ıve controls (p < 0.01). In fact, the bacterial burden in the spleen was reduced by greater than 90% in the pE6/85-vaccinated animals. The capacity of this DNA vaccine to elicit a sustained protective immune response was also assessed in long-term survival studies. For these experiments, the post-challenge survival periods of mice immunized with either pE6/85, ESAT6, or Ag85B DNA vaccine plasmids were compared with the survival of BCG-vaccinated and na¨ıve controls (Fig. 3). After an aerogenic challenge with approximately 200 CFUs of M. tuberculosis Erdman, the mean-timeto-death (MTD ± the standard error of the mean) for the naive mice was 102 ± 24 days. Although immunization with ESAT6 DNA vaccine did not significantly increase the survival period (132 ± 32 days) relative to the na¨ıves, 100 90 80 70 60 50 40 30 20 10 0

Naive

Esat-6 Ag85B

pE6/85

BCG

0

100

200

300

Days

Fig. 3. The survival of mice immunized with the pE6/85, ESAT6, or Ag85B DNA vaccines following an aerogenic challenge with M. tuberculosis Erdman. BCG-vaccinated and na¨ıve mice were challenged to serve as controls. Five to ten mice per group were used in this analysis.

785

substantial extensions of the survival times were detected for the pE6/85 (271 ± 26 days, p < 0.001) and the Ag85B DNA vaccinated mice (216 ± 17 days, p < 0.05) as well as the BCG-immunized animals (299 ± 14 days, p < 0.001). Vaccination with the pE6/85 construct significantly extended the survival period compared to the ESAT6 vaccine group (133 days, p < 0.05), and, while the survival time differences between pE6/85 and Ag85B DNA vaccine groups did not reach statistical significance (p = 0.08), the MTD for mice vaccinated with the pE6/85 construct exceeded by 55 days the MTD for the Ag85B DNA vaccine group. Although the mean survival period for the pE6/85 vaccinated mice was 28 days less than for the BCG immunized group, this difference was not statistically significant. Overall, the bacterial burden assessments and the survival studies demonstrate that the pE6/85 DNA vaccine elicited substantial protective immunity in a primary M. tuberculosis infection model. 3.4. Protective immunity elicited by vaccination with either BCG or DNA vaccine cocktails declines at 15 and 18 months post-immunization A previous report has shown that mice vaccinated with BCG gradually lose their ability to resist an aerogenic challenge with increasing age and that the waning immunity can be boosted by an Ag85B protein/adjuvant mixture [21]. To investigate, whether the pE6/85 DNA vaccine construct could boost BCG-induced protection, we initially determined if BCG-induced protective immunity declined with time in our mouse model. In addition, we evaluated whether a temporal decrease in the protective response elicited by our immunogenic DNA vaccine cocktail could be detected. In earlier studies, we had shown that the protection induced by this DNA vaccine cocktail in mice was essentially equivalent to that evoked by BCG immunization [16]. The capacity to induce protective immune responses at increasing time periods after vaccination was assessed by determining the relative organ bacterial burdens in vaccinated and control mice at 28 days post-challenge. As shown in Fig. 4A, the protective responses in the lung that were induced by BCG vaccination remained relatively vigorous for 1 year with greater than a 90% reduction (−1.06 to −1.30 log10 ) in bacterial numbers (relative to na¨ıves) seen at the 3, 9 and 12 months time points. Subsequently, the lung protective response significantly declined relative to the 3-month evaluation (p < 0.05). At 15 and 18 months post-vaccination, only −0.61 log10 and −0.65 log10 relative decreases in lung CFUs were detected. Similarly, the protective immunity generated by the DNA vaccine cocktail was maintained for 12 months. However, a significant diminution of the lung protection induced by the DNA cocktail was noted at 15 and 18 months (p < 0.05). Surprisingly, the capacity of BCG to reduce the dissemination of the airborne infection to the spleen was retained at high levels during the entire 18 months study (Fig. 4B). At all time points, greater than 0.9 log10 CFU reduction in the spleen was observed. In

786

S.C. Derrick et al. / Vaccine 23 (2004) 780–788

Log10 CFU Reduction

*

** *

BCG DNA

Log10 CFU Reduction

(B) 1.6

(A) 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0

1.4 1.2 1 0.8 0.6 0.4 0.2 0

3 9 12 15 18 Months Post-Vaccination

*

*

BCG DNA

3 9 12 15 18 Months Post-Vaccination

Fig. 4. The relative protective efficacy of BCG and DNA cocktail vaccines over an 18-month time period. Mice received an aerogenic challenge of M. tuberculosis Erdman at different times after vaccination and then were sacrificed 28 days post-challenge to assess the log10 CFU reduction of pulmonary (A) or splenic (B) bacterial burden compared to na¨ıve mice. The results are represented as the mean relative protection ± the standard error of the mean. Asterisks indicate that the protective efficacy of the vaccine had declined significantly compared to 3-month values (p ≤ 0.05). n = 5 mice per group per time period.

contrast, the splenic protective response elicited by the DNA cocktail declined throughout the study. At 15 and 18 months post-vaccination, the splenic CFU values for the DNA vaccine group were not significantly different than the na¨ıve controls. 3.5. Vaccination with the pE6/85 construct boosts declining BCG immunity To determine whether waning BCG responses could be boosted by DNA vaccination, mice were immunized 12, 13, and 14 months after the initial BCG vaccination with either the pE6/85 plasmid or with our DNA vaccine cocktail. As controls, BCG-immunized mice were injected with the vector alone (using the same schedule) or were revaccinated with BCG at 12 months. The mice were then aerogenically challenged at either 15 or 18 months and the organ bacterial burdens were determined 4 weeks later. The results of the BCG boosting studies are shown in Table 3. At both 15 and 18 months time points, boosting with the pE6/85 plasmid sub-

stantially augmented protection in the lung with significant decreases in bacterial CFUs (−1.30 and −1.21 log10 reductions, respectively, relative to naives) relative to the 15 and 18 months BCG responses. In fact, the levels of protection seen in the pE6/85-boosted animals were similar to the protective responses detected at three months post BCG immunization (−1.15 log10 ). In contrast, BCG revaccination and boosting with the DNA cocktail only moderately decreased the lung bacterial burden relative to the primary BCG immunization controls; these differences did not reach statistical significance. Administration of the vector alone had no impact on the anti-tuberculosis protective response in the lung at 15 months. The splenic CFU boosting results showed a different pattern of protection. As shown in Table 3, a dramatic decrease in the splenic CFUs was detected in the BCG revaccinated group (−2.08 log10 , p < 0.05 relative to BCG at 15 months) at the 15 month time point; however, for all the other experimental groups, no significant increases in the splenic protective response were seen.

Table 3 Boosting BCG-induced immune responses with a multi-gene DNA vaccine construct Vaccine groupa

15 months Lung

Na¨ıve BCG BCG + BCG BCG + DNA cocktail BCG + vector BCG + pE6/85

5.82 5.20 4.96 5.01 5.20 4.52

18 months Spleen

± ± ± ± ± ±

0.07 0.09b (−0.62) 0.13 (−0.86) 0.07 (−0.81) 0.10 (−0.62) 0.10*** (−1.30)

4.95 4.04 2.87 3.58 4.06 3.75

± ± ± ± ± ±

Lung 0.09 0.18 (−0.91) 0.28* (−2.08) 0.42 (−1.37) 0.25 (−0.89) 0.15 (−1.20)

5.69 5.04 4.68 4.68 nd 4.48

Spleen ± ± ± ±

0.10 0.03 (−0.65) 0.06 (−1.01) 0.04 (−1.01)

± 0.10* (−1.21)

4.69 3.55 3.21 3.41 nd 3.11

± ± ± ±

0.13 0.19 (−1.14) 0.46 (−1.48) 0.17 (−1.28)

± 0.13 (−1.58)

nd: not done. a C57BL/6 mice were immunized with BCG and then vaccinated with either BCG, a DNA vaccine cocktail, the vector alone, or the pE6/85 construct as described in Section 2. At 15 or 18 months after the initial BCG vaccination, the mice were challenged aerogenically with about 100 CFUs of M. tuberculosis Erdman per mouse. b The mean ± S.E.M. number of bacteria (log ) isolated from the organs of mice at 28 days following the aerogenic challenge. The values in the parenthesis 10 represent the reduction in bacterial burden relative to the na¨ıve controls. ∗ Statistical significance relative to the BCG control group, p < 0.05. ∗∗∗ Statistical significance relative to the BCG control group, p < 0.001.

S.C. Derrick et al. / Vaccine 23 (2004) 780–788

4. Discussion The development of highly effective vaccines to combat the global TB epidemic remains a significant challenge because of the complexity of the epidemiology of tuberculosis. While immunizing preparations should be generated that will provide lifelong protection to infants, vaccines are also needed to protect individuals that have been previously infected with M. tuberculosis, exposed to environmental mycobacteria, and/or vaccinated with BCG. Our data strongly suggests that a novel DNA construct expressing an ESAT6–Ag85B polyprotein can protect against a primary infection and can boost waning BCG immunity. Post-challenge lung and spleen bacterial burden assessments, cytokine assays and survival studies indicate that immunization with the pE6/85 gene fusion induces significant protective immunity against a primary aerogenic tuberculous infection in the mouse. Moreover, boosting experiments in mice that had been previously vaccinated with BCG demonstrated that the pE6/85 plasmid can amplify anti-tuberculous protective immune responses to the high levels detected 3 months after the initial BCG administration. This pE6/85-induced response seen in the aging BCG-vaccinated animals was similar to the BCG booster response detected by Brooks et al. following immunization with Ag85 protein formulated in monophosphoryl lipid A-based adjuvant [21]. These studies with the pE6/85 gene fusion further support the promise of the TB multi-gene fusion protein vaccine approach. In an earlier report, Olsen et al. demonstrated that an Ag85-ESAT6 fusion protein (administered in a DDAMPL adjuvant) induced high-level protective responses and long-term memory immunity in mice [22]. Additionally, Reed and colleagues have recently shown that the recombinant 72f polyprotein (a fusion of the MTB39 and MTB32 antigens), when formulated in an appropriate adjuvant, evokes substantial protective immunity in mice, guinea pigs, and monkeys [23]. Besides their immunogenicity, there are important advantages in developing polyprotein vaccines or multi-gene DNA constructs relative to preparations containing cocktails of several antigens or DNA plasmids. Different antigens fused into a large recombinant molecule should contain a range of protein epitopes and, therefore, would be less likely to suffer MHC-related restriction in heterologous populations. Immunization with single fusion proteins should also encourage equivalent uptake of the vaccine components by antigen-presenting cells leading to the production of a broad specific immunity and the reduced likelihood of immunodominant responses. Importantly, a vaccine consisting of a single polyprotein or a single multi-gene construct should be easier to standardize and less expensive to manufacture and formulate than a multiple component protein or DNA cocktail preparation. The ease and cost of manufacturing is particularly relevant for new TB vaccines because of their projected use in developing countries. The results of this study also illustrate that vaccines which are effective against a primary infection may not amplify de-

787

clining BCG immunity. For instance, our DNA vaccine cocktail, which has been shown to be highly effective in a primary aerosol challenge model, did not significantly increase waning BCG responses. Furthermore, revaccination with BCG did not substantially elevate declining BCG immunity in the lung, although protective responses in the spleen were seen. These BCG data are consistent with results from clinical trials which have shown that re-immunization with BCG does not impact pulmonary tuberculosis but may have a modest impact on reducing disseminated disease forms [8,24,25]. Consistent with our observations, Orme and co-workers have shown that a highly immunogenic culture filtrate protein mixture, which is protective in primary infection models, does not boost BCG responses in mice [21]. Overall, these data suggest that the host immune responses needed to protect against a primary TB infection may differ from those required to boost declining BCG protective immunity. Therefore, in addition to being tested in primary infection models for a prophylactic indication, investigators should consider testing new vaccine preparations that will be evaluated clinically for BCG boosting activity in pre-clinical BCG post-exposure models. Although BCG immunization and DNA vaccination clearly stimulate cell-mediated immunity, the precise details regarding the cellular anti-tuberculosis protective responses have not been resolved. It is clear that the cellular immune responses to M. tuberculosis infections are complicated and may involve a number of T cell subsets including CD4, CD8 and double-negative T cells in addition to ␥␦ cells [26]. Our post-challenge intracellular cytokine staining experiments showed that both CD4+ and CD8+ IFN␥-producing cells were stimulated by vaccination with the pE6/85 construct and immunization with BCG. Partially due to this complexity, the mechanisms which contribute to declining BCG immunity during early adulthood have also not been defined. In our experiments, the BCG boosting effect seen after pE6/85 vaccination indicates that declining memory immunity can be amplified by injecting a vaccine expressing a specific fusion antigen that is recognized by the immune system at post-vaccination time points (<12 months) when the anti-tuberculosis immune responses were still vigorous. It is not surprising that a DNA vaccine expressing an Ag85B fusion protein generated a booster effect because this antigen is a major mycobacterial immunogen. In fact, Cooper et al. previously demonstrated that a large proportion of CD4 T cells accumulating in the lung after a tuberculous challenge recognize antigen 85 [27]. However, because the gene encoding ESAT6 is deleted in M. bovis BCG, the role of ESAT6 in producing the booster effect of the recombinant protein is less clear. Since ESAT6 is a potent T cell immunogen [28,29], it may amplify overall anti-tuberculosis immunity in BCGimmune animals by activating additional anti-mycobacterial T cells. Alternatively, ESAT6 epitopes on the fusion protein may stimulate cross-reactive memory responses that were initially induced by other members of the ESAT6 protein family that are present in M. bovis [30]. Clearly, to facilitate rational vaccine development, the immune mechanisms

788

S.C. Derrick et al. / Vaccine 23 (2004) 780–788

mediating this booster effect and the specific T cell subsets involved in the recovery of anti-tuberculosis memory immunity need to be established. The availability of a mouse model in which the temporal decline of BCG-induced immunity has been verified will permit us to investigate the mechanisms associated with the waning BCG protective response and the DNA vaccination booster effect. An improved understanding of these immune processes should allow the refinement of vaccines designed to prevent tuberculosis in na¨ıve and BCG-immunized individuals.

[14]

[15]

[16]

[17]

Acknowledgments We acknowledge Colorado State University and the NIH, NIAID Contract NO1 AI-75320 entitled “Tuberculosis Research Materials and Vaccine Testing” for providing recombinant antigen 85. We thank Thames Pickett and Carol Goter-Robinson for their thoughtful review of the manuscript.

References [1] Dye C, Espinal MA, Watt CJ, Mbianga C, Williams BG. Worldwide incidence of multidrug-resistant tuberculosis. J Infect Dis 2002;185:1197–202. [2] World Health Organization. Tuberculosis—Fact Sheet No. 104, 2002. http://www.who.int/mediacentre/factsheets. [3] Zumla A, Malon P, Henderson J, Grange J. Impact of HIV on tuberculosis. Postgrad Med J 2000;76:259–68. [4] Dye C, Watt CJ, Bleed D. Low access to a highly effective therapy: a challenge for international tuberculosis control. Bull World Health Organ 2002;80:437–44. [5] Colditz GA, Brewer TF, Berkey CS, Wilson ME, Burdick V, Fineberg HV, et al. Efficacy of BCG vaccine in the prevention of tuberculosis: meta-analysis of the published literature. JAMA 1994;271:698–702. [6] Fine PEM. BCG: the challenge continues. Scand J Infect Dis 2001;33:243–5. [7] Sterne JAC, Rodrigues LC, Guedes IN. Does the efficacy of BCG decline with time since vaccination? Int J Tuberc Lung Dis 1998;2:200–7. [8] Karonga Prevention Trial Group. Randomised controlled trial of single BCG, repeated BCG, or combined BCG and killed Mycobacterium leprae vaccine for the prevention of leprosy and tuberculosis in Malawi. Lancet 1996;348:17–24. [9] Tuberculosis Research Center (ICMR), Chennai. Fifteen year followup of trial of BCG vaccine in south India for tuberculosis prevention. Indian J Med Res 1999;110:56–69. [10] Olsen AW, Andersen P. A novel TB vaccine; strategies to combat a complex pathogen. Immunol Lett 2003;85:207–11. [11] Britton WJ, Palendra U. Improving vaccines against tuberculosis. Immunol Cell Biol 2003;81:34–45. [12] Baldwin SL, D’Souza C, Roberts A, Kelly B, Frank A, Lui M, et al. Evaluation of new vaccines in the mouse and guinea pig model of tuberculosis. Infect Immun 1998;66:2951–9. [13] Feng CG, Palendira U, Demangel C, Spratt J, Malin AS, Britton WJ. Priming by DNA immunization augments the protective efficacy of

[18]

[19]

[20]

[21] [22]

[23]

[24]

[25]

[26] [27]

[28]

[29]

[30]

Mycobacterium bovis Bacille Calmette-Guerin against tuberculosis. Infect Immun 2001;69:4174–6. Kamath AT, Feng CG, Macdonald M, Briscoe H, Britton WJ. Differential protective efficacy of DNA vaccines expressing secreted proteins of Mycobacterium tuberculosis. Infect Immun 1999;67:1702–7. Morris S, Kelley C, Howard A, Li Z, Collins F. The immunogenicity of single and combination vaccines against tuberculosis. Vaccine 2000;18:2155–63. Delogu G, Li A, Repique C, Collins F, Morris S. DNA vaccine combinations expressing either tissue plasminogen activator signal sequences or ubiquitin-conjugated antigens induce sustained protective immunity in a mouse model of pulmonary tuberculosis. Infect Immun 2002;70:292–302. Campus-Neto C, Webb JR, Greeson K, Goler RN, Skeiky YAW, Reed SG. Vaccination with plasmid DNA encoding TSA/LmST11 Leishmanial fusion proteins confers protection against Leishmania major infection in susceptible BALB/c mice. Infect Immun 2002;70:2836–8. Sette AB, Livingston B, McKinney D, Appella E, Fikes J, Sidney J, et al. The development of multi-epitope vaccines: epitope identification, vaccine design, and clinical evaluation. Biologicals 2001;29:271–6. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989. Li Z, Howard A, Kelley C, Delogu G, Collins F, Morris S. Immunogenicity of DNA vaccines expressing tuberculosis proteins fused to tissue plasminogen actiavtor signal sequences. Infect Immun 1999;67:4780–6. Brooks JV, Frank AA, Keen MA, Belisle JT, Orme IM. Boosting vaccine for tuberculosis. Infect Immun 2001;69:2714–7. Olsen AW, van Pinxteren LAH, Okkels LM, Rasmussen PB, Andersen P. Protection of mice with a tuberculosis subunit vaccine based on a fusion protein of Antigen 85B and ESAT-6. Infect Immun 2001;69:2773–8. Reed SG, Aldersen MR, Dalemans W, Lobet Y, Skeily YAW. Prospects for a better vaccine against tuberculosis. Tuberculosis (Edinb) 2003;83:213–9. Leung CC, Tam CM, Chan SL, Chang-Yeung M, Chan CK, Chang KC. Efficacy of the BCG revaccination programme in a cohort given BCG vaccination at birth in Hong Kong. Int J Tuberc Lung Dis 2001;5:717–23. Tala-Heikkila MM, Tuominen JE, Talo EO. Bacillus Calmette-Guerin revaccination questionable with low tuberculosis incidence. Am J Respir Crit Care Med 1998;157:1324–7. Flynn JL, Chan J. Immunology of tuberculosis. Annual Rev Immunol 2001;19:93–129. Cooper AM, Callahan JE, Keen M, Belisle JT, Orme IM. Expression of memory immunity in the lung following re-exposure to Mycobacterium tuberculosis. Tuberc Lung Dis 1997;78:67–73. Brandt L, Ottenger T, Holm A, Andersen AB, Andersen P. Key epitopes on the ESAT-6 antigen recognized in mice during the recall of protective immunity to Mycobacterium tuberculosis. J Immunol 1996;157:3527–33. Cardoso FL, Antas PR, Milagres AS, Geluk A, Franken KL, Olivera EB, et al. T-cell responses to the Mycobacterium tuberculosisspecific antigen ESAT-6 in Brazilian tuberculosis patients. Infect Immun 2002;70:6707–14. van Pittius NCG, Gamildien J, Hide W, Brown GD, Siezen RJ, Beyers AD. The ESAT-6 gene cluster of Mycobacterium tuberculosis and other high G + C Gram-positive bacteria. Genome Biol 2001;2:1– 18.