A potent and selective 11β-hydroxysteroid dehydrogenase type 1 inhibitor, SKI2852, ameliorates metabolic syndrome in diabetic mice models

European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎

Contents lists available at ScienceDirect

European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar

Endocrine pharmacology

A potent and selective 11β-hydroxysteroid dehydrogenase type 1 inhibitor, SKI2852, ameliorates metabolic syndrome in diabetic mice models Hyunhee Oh a,1, Kyeong-Hoon Jeong a,b,c,1, Hye Young Han d, Hyun Joo Son d, Su Sung Kim b, Hyun Jung Lee d, Shinae Kim d, Joon Ho Sa d, Hee-Sook Jun e, Je Ho Ryu d,n, Cheol Soo Choi a,b,f,nn a T2B Infrastructure Center for Metabolic Disease (National Efficacy Evaluation Center for Metabolic Disease Therapeutics), Lee Gil Ya Cancer and Diabetes Institute, Gachon University, Yeonsu-Gu, Songdo-Dong 7-45, Incheon 406-840, Republic of Korea b Korea Mouse Metabolic Phenotyping Center, Lee Gil Ya Cancer and Diabetes Institute, Gachon University, Yeonsu-Gu, Songdo-Dong 7-45, Incheon 406-840, Republic of Korea c Medical Research Institute, Gachon University Gil Medical Center, Namdong-Gu, Guwol-Dong 1198, Incheon 405-760, Republic of Korea d Life Science R&D Center, SK Chemicals, Seongnam, Bundang-Gu, Sampyeong-Dong 686, Gyeonggi 463-400, Republic of Korea e College of Pharmacy and Gachon Institute of Pharmaceutical Science; Lee Gil Ya Cancer and Diabetes Institute, Gachon University, Yeonsu-Gu, Songdo-Dong 7-45, Incheon 406-840, Republic of Korea f Endocrinology, Internal Medicine, Gachon University Gil Medical Center, Namdong-Gu, Guwol-Dong 1198, Incheon 405-760, Republic of Korea

art ic l e i nf o Article history: Received 22 May 2015 Received in revised form 22 October 2015 Accepted 26 October 2015 Keywords: 11β-hydroxysteroid dehydrogenase type 1 Inhibitor Type 2 diabetes Glucocorticoid Gluconeogenesis Insulin resistance

a b s t r a c t 11β-Hydroxysteroid dehydrogenase type 1 (11βHSD1) has been targeted for new drugs to treat type 2 diabetes and metabolic syndrome. In this study, we determined whether the inhibition of 11βHSD1 with a new selective inhibitor, SKI2852, could improve lipid profiles, glucose levels, and insulin sensitivity in type 2 diabetic and obese conditions. SKI2852 showed a potent inhibition of cortisone to cortisol conversion for over 80% in both liver and adipose tissue ex vivo from orally administered C57BL/6 mice, and in vivo analysis results were consistent with this. Repeated oral administrations of SKI2852 in dietinduced obesity (DIO) and ob/ob mice revealed a partially beneficial effect of SKI2852 in improving levels of cholesterols, triglycerides, free fatty acids, postprandial glucose, and/or blood hemoglobinA1c. SKI2852 significantly reduced body weight increase in ob/ob mice, and efficiently suppressed hepatic mRNA levels of gluconeogenic enzymes in DIO mice. Moreover, SKI2852 enhanced hepatic and whole body insulin sensitivities in hyperinsulinemic-euglycemic clamp experiment in DIO mice. In conclusion, these results indicate that selective and potent inhibition of 11βHSD1 by SKI2852, thus blockade of active glucocorticoid conversion, may improve many aspects of metabolic parameters in type 2 diabetes and metabolic diseases, mainly by inhibitions of hepatic gluconeogenesis and partial improvements of lipid profiles. Our study strongly support that SKI2852 may have a great potential as a novel candidate drug for the treatment of diabetes and metabolic diseases. & 2015 Elsevier B.V. All rights reserved.

1. Introduction Type 2 diabetes mellitus is a disease with combined pathologies of metabolic abnormalities, such as dyslipidemia, hyperglycemia, and insulin resistance (Day, 2007), and despite of current

pharmaceutical advances, there are still immediate un-met needs for improved therapies. Previous studies have implicated prolonged exposure to glucocorticoids as causes of the development of metabolic syndrome (Walker and Seckl, 2003). Active glucocorticoids up-regulate gluconeogenesis in the liver via

n

Corresponding author. Corresponding author at: Endocrinology, Internal Medicine, Gachon University Gil Medical Center, Namdong-Gu, Guwol-Dong 1198, Incheon 405-760, Republic of Korea. E-mail addresses: [email protected] (H. Oh), [email protected] (K.-H. Jeong), [email protected] (H.Y. Han), [email protected] (H.J. Son), [email protected] (S.S. Kim), [email protected] (H.J. Lee), [email protected] (S. Kim), [email protected] (J.H. Sa), [email protected] (H.-S. Jun), [email protected] (J.H. Ryu), [email protected] (C.S. Choi). 1 These authors contributed equally to this work. nn

http://dx.doi.org/10.1016/j.ejphar.2015.10.042 0014-2999/& 2015 Elsevier B.V. All rights reserved.

Please cite this article as: Oh, H., et al., A potent and selective 11β-hydroxysteroid dehydrogenase type 1 inhibitor, SKI2852, ameliorates metabolic syndrome in diabetic mice models. Eur J Pharmacol (2015), http://dx.doi.org/10.1016/j.ejphar.2015.10.042i

H. Oh et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎

2

glucocorticoid receptor-mediated regulation of downstream target gene expressions or activities (Drake et al., 2005). In this respect, an attractive biological target is 11β-hydroxysteroid dehydrogenase type 1 (11βHSD1) (Joharapurkar et al., 2012). Although active glucocorticoids are produced from adrenal cortex (Jeong et al., 2004b), they can also be generated locally by the actions of 11βHSD1 in other tissues (Pereira et al., 2012). The 11βHSD1 converts inactive glucocorticoids (cortisone in human and 11-dehydrocorticosterone in rodent) into active glucocorticoids (cortisol in human and corticosterone in rodent), and is highly expressed in metabolically active tissues including liver (Baudrand et al., 2010). The hepatic 11βHSD1 gene expression is also correlated positively with fasting insulin levels and insulin resistance in obese human (Baudrand et al., 2011). The connection between type 2 diabetes and 11βHSD1 has been suggested in mouse genetic models. Transgenic mice overexpressing 11βHSD1 in adipose tissue showed features of metabolic syndrome including obesity, dyslipidemia, glucose intolerance, and hypertension (Masuzaki et al., 2001, 2003). Conversely, 11βHSD1-deficient mice demonstrated reduction in body weight and triglyceride levels, and induction in insulin sensitivity, when maintained on a high-fat diet (HFD) (Morton et al., 2004). In addition, liver-specific overexpression of 11βHSD1 in transgenic mice caused insulin resistance without obesity (Paterson et al., 2004), while liver-specific deletion of 11βHSD1 prevented 11-dehydrocorticosterone-induced obesity and insulin resistance (Harno et al., 2013a). Moreover, 11βHSD1 deficiency in apoE-deficient mice reduced and delayed atherosclerosis symptoms (García et al., 2013). Altogether, these combined findings suggest that 11βHSD1 could be a promising target for the treatment of metabolic syndrome as well as type 2 diabetes. Recently, a number of small molecule 11βHSD1 inhibitors have been reported (Anagnostis et al., 2013). Among them, AMG-221 (BVT-83370, Amgen-Biovitrum) has been proven its efficacy in a phase I study (Gibbs et al., 2011). Similarly, BVT.2733 (Biovitrum) has been shown to enhance hepatic insulin sensitivity in diabetic mice models (Alberts et al., 2003). More recently, a clinical candidate BI-135585 (Boehringer Ingelheim & Vitae) has been demonstrated to potently inhibit 11βHSD1 in primate models (Hamilton et al., 2015). Several other 11βHSD1 inhibitors, such as PF915275 (Pfizer) (Bhat et al., 2008), are among promising candidates for metabolic syndrome and type 2 diabetes, some of them currently being tested in clinical trials. We have developed 11βHSD1 inhibitors over the past several years. In particular, SKI2852 is a promising novel candidate for anti-metabolic syndrome and anti-diabetes drug. In the present study, we evaluated SKI2852 for 11βHSD1 inhibition potency, for metabolic efficacy in several metabolic disease mice models, and for enhancement of hepatic and whole body insulin sensitivities.

2. Materials and methods 2.1. Materials SKI2852(2-((R)-4-(2-fluoro-4-(methylsulfonyl)phenyl)-2-methylpiperazin-1-yl)-N-((1R,2s,3S,5S,7S)-5-hydroxyadamantan-2-yl) pyrimidine-4-carboxamide) and AMG-221 (Supplemental Fig. 1A) were synthesized by us at SK Chemicals. All other materials were purchased from Sigma-Aldrich (St. Louis, MO). 2.2. Animal husbandry Eight-week old male C57BL/6 and C57BL/6-Lepob (ob/ob) mice (Charles River Laboratories Japan, Yokohama, Japan) were used in this study. In addition, eight-week old male KK-Ay/J (KK-Ay;

Jackson Laboratory, Bar Harbor, ME) mice were used in some of the supplemental experiments (Supplemental Table 3 and Supplemental Fig. 2). All the mice were housed in a controlled environment with 22 72 °C temperature, 507 10% humidity, and lights on 07:00–19:00 h. Food and drinking water were available ad libitum. All the animal experiment protocols were approved beforehand and all experiments were conducted in accordance with the Guides for Care and Use of Laboratory Animals provided by the Institutional Animal Care and Use Committee of SK Chemicals and by the Center of Animal Care and Use Committee of Lee Gil Ya Cancer and Diabetes Institute, Gachon University. 2.3. Ex vivo and in vivo pharmacodynamic analyses Ex vivo analysis was performed using a procedure described previously (Hale et al., 2008; Johansson et al., 2008). Briefly, C57BL/6 mice were orally administered once with 0 (vehicle only), 1, 3, or 10 mg/kg of SKI2852. Sterile water containing 0.5% methylcellulose and 1% Tween-80 was used as vehicle. The animals were killed at 2 or 6 h after administration, and liver and epididymal fat pads were collected. The inhibitions of 11βHSD1 activity in liver and epididymal fat tissue were accessed by measurement of cortisone to cortisol conversion in tissue culture media containing cortisone using a commercially available cortisol enzymelinked immunosorbent assay (ELISA) kit (Assay Designs, Ann Arbor, MI). The sensitivity of this assay was 56.72 pg/ml, and the intra- and inter-assay coefficients of variance were 10.5 and 13.4%, respectively. Crossreactivities with cortisone and corticosterone were less than 0.1% and 27.68%, respectively. For in vivo analysis, C57BL/6 mice were orally administered with 0 (vehicle only, Vehicle group), 0.1, 0.3, 1, 3, or 10 mg/kg of SKI2852, 2 h before oral administration with 30 mg/kg of cortisone. Normal group received vehicles only, and did not receive either SKI2852 or cortisone. After 1 h of cortisone administration, trunk blood samples were collected by cardiac puncture and plasma levels of cortisol and SKI2852 were determined. 2.4. Determination of plasma SKI2852 levels Plasma levels of SKI2852 were determined from the blood samples by a liquid chromatography (Acquity UPLC system; Waters, Milford, MA) coupled with tandem mass spectrometry (LC/MS/MS). Briefly, mixtures containing 20 μl of plasma, 20 μl of acetonitrile (to compensate working solution volume), and 200 μl of 250 nM warfarin (dissolved in acetonitrile) as an internal standard were vortexed for 5 min, followed by centrifugation for 5 min to precipitate plasma protein. Supernatants were transferred to 0.22 μm 96-well filter plate (Captiva™; Agilent Technologies, Santa Clara, CA) and eluted, and 5 μl of elutes were injected onto Capcell Pak MGIII C18 column (50
2 mm, particle diameter 3 μm; Shiseido, Tokyo, Japan). Chromatographic separation was achieved at a flow rate of 0.4 ml/min with mobile phase composed of 10 mM ammonium acetate buffer pH 4.0 (Mobile Phase A) and acetonitrile (Mobile Phase B), using the following gradient program: 5% of B maintained for 0.5 min, gradient to 95% of B from 0.5 to 2 min, hold at 95% of B from 2 to 2.4 min. The gradient was followed by recondition with 5% of B from 2.5 to 3.5 min. The retention times for SKI2852 and warfarin were 2.35 and 2.07 min, respectively. Detection was performed on a hybrid Q-trap mass spectrometer (API4000 Qtrap; SCIEX, Framingham, MA), operated with an ESI interface in positive ionization mode. Quantification was achieved using multiple reaction monitoring (MRM) of the transition, m/z 544.3 to 91.1 (SKI2852) and m/z 309.2 to 251.2 (warfarin). Ionization conditions were set as following: curtain gas (CUR) 20, ionspray voltage (IS) 5500, temperature (TEM) 400, nebulizing gas (GS1) 50, auxiliary gas (GS2) 50. Dwell time for each ion was 150 msec.

Please cite this article as: Oh, H., et al., A potent and selective 11β-hydroxysteroid dehydrogenase type 1 inhibitor, SKI2852, ameliorates metabolic syndrome in diabetic mice models. Eur J Pharmacol (2015), http://dx.doi.org/10.1016/j.ejphar.2015.10.042i

H. Oh et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎

2.5. In vivo efficacy analyses in mice models All the animal model studies were performed as described previously (Hermanowski-Vosatka et al., 2005). C57BL/6 mice were fed a HFD containing 60% of calories from fat (D12492; Research diets, New Brunswick, NJ) ad libitum for 4 weeks to induce diet-induced obesity (DIO) with insulin resistance. While maintaining on HFD, the animals were then orally administrated with 0 (vehicle only), 10, or 20 mg/kg of SKI2852 once a day for 8.5 weeks, between 09:30 h and 10:30 h when circadian changes of corticosterone were still at nadir. The body compositions of these mice were measured by a 1H-minispec system (LF90II rodent body composition analyzer; Bruker BioSpin, Billerica, MA). Ob/ob mice were subjected to oral administrations with vehicle or 12.5 mg/kg of SKI2852 twice a day, approximately at 09:00 and 17:00 h, for 18 days. The initial postprandial glucose (GM9 glucose analyzer; Analox Instruments, London, UK) and blood hemoglobinA1c (HbA1c) (DCA Vantage Analyzer; Siemens Healthcare, Erlangen, Germany) levels for each study were measured from blood samples collected by tail venesection prior to the start of compound administration, to verify that their levels were not different among mice. The body weights, postprandial glucose, HbA1c, and insulin (RI-13 K kit; EMD Millipore, Billerica, MA) levels were measured once a week at 09:00 h, and food intake amounts were measured once every 3–4 days during the drug treatment. At the end of the study, the mice were subjected to an overnight fasting, anesthetized with isoflurane, and blood and tissue samples were collected. Circulating levels of lipids (total cholesterols, LDL and HDL cholesterols, and/or triglycerides) were analyzed by a biochemical analyzer (AU480; Beckman Coulter, Brea, CA) using trunk blood samples collected from vena cava or cardiac puncture. Free fatty acids (FFA) levels were analyzed using a commercial kit (NEFA C; Wako Pure Chemical, Osaka, Japan). Liver samples were collected from DIO mice for quantitative reverse transcription polymerase chain reaction (RT-PCR) analysis. Epididymal, retroperitoneal, and intraperitoneal fat pads were collected from DIO mice, subcutaneous, epididymal, and mesenteric fats from ob/ob mice, and their weights were measured. 2.6. Quantitative RT-PCR Total RNAs were purified from the liver tissues of DIO mice using RNeasy Mini QIAcube Kit (Qiagen, Valencia, CA). Quantitative RT-PCR for hepatic glucocorticoid receptor (Nr3c1), hexose-6-phosphate dehydrogenase (H6PDH, H6pd), phosphoenolpyruvate carboxykinase (PEPCK, Pck1), and glucose-6-phosphatase (G6Pase, G6pc) expressions was performed by SYBR Green method using CFX96 Real-Time PCR System (Bio-Rad Laboratories, Hercules, CA). The results of each gene were normalized to those of β-actin (Actb) mRNA using the ΔΔ comparative threshold cycle (2  Ct) method. The primer sequences used were: Nr3c1, sense 5′-TGCTATGCTTTGCTCCTGATCTG, antisense 5′-TGTCAGTTGATAAAACCGCTGC; H6pd, sense 5′-AGCCCACTCTCTCATCCAAGG, antisense 5′-ATGTGGAGCGGGTGGAGATCA; Pck1, sense 5′-AAGACAAGGAAGGCAAGTTC, antisense 5′-ATCTCACCTAGGCCTTTCAG; G6pc, sense 5′-AAGACTCCCAGGACTGGTTCATCC, antisense 5′TAGCAGGTAGAATCCAAGCGCG; and Actb, sense 5′-GAAGGTGACAGCATTGCTTCTGTG, antisense 5′-CTCAGACCTGGGCCATTCAGAAAT. 2.7. Hyperinsulinemic-euglycemic clamp in DIO mice After DIO induction as described above, mice were administered with 0 (vehicle only), 10, or 20 mg/kg of SKI2852 once a day for 4 weeks while maintaining on HFD, followed by a hyperinsulinemic-euglycemic clamp experiment as previously described (Choi et al., 2007). Briefly, catheters were placed into the jugular

3

vein of mice, and animals were allowed to fully recover for a week. After 16 h of fasting, the [3-3H]-glucose (PerkinElmer, Boston, MA) was infused at a rate of 0.05 μCi/min for 2 h to measure a basal glucose turnover rate. Following this period, hyperinsulinemiceuglycemic clamp was conducted by infusion of [3-3H]-glucose (0.1 μCi/min) and insulin (3 mU/kg/min), which were maintained at a constant rate. Plasma glucose levels were monitored at every 10–20 min to maintain the clamped levels to 120 mg/dl. To measure insulin-stimulated whole body glucose flux and glucose uptake, 10 μCi of 2-deoxy-D-[1-14C]-glucose (PerkinElmer) was injected as a bolus at 85 min after the initiation of clamp. Wholebody glucose uptake, glycolysis, and glycogen synthesis were estimated by a previously reported method (Youn and Buchanan, 1993). The glucose infusion rate (GIR), an index of whole body insulin sensitivity, was measured at 140 min of steady-state during the clamp. 2.8. Statistical analyses Results were analyzed by unpaired t-test. When appropriate, results were analyzed by one-way analysis of variance (ANOVA) followed by post hoc comparisons with Fisher’s protected least significant difference (PLSD) test for multiple comparisons. A Pvalue less than 0.05 was considered statistically significant. All data are presented as mean 7 S.E.M.

3. Results 3.1. Characterization of SKI2852 as an 11βHSD1 inhibitor To determine pharmacological characterization, we first analyzed inhibitory potency of SKI2852 for 11βHSD1 enzyme activity in vitro and compared with AMG-221 (Supplemental Fig. 1B). SKI2852 showed an inhibition in low nanomolar concentrations for human (h11βHSD1) and mouse 11βHSD1 (m11βHSD1) enzyme activities in HEK293 microsomal fractions or in HEK293 cells stably transfected with h11βHSD1 (HEK293-h11βHSD1), judged by calculated IC50 values (2.9 nM for h11βHSD1, 1.6 nM for m11βHSD1, and 4.4 nM for HEK293-h11βHSD1), which were 3–12 times more potent than those of AMG-221 (9.5 nM for h11βHSD1, 19.3 nM for m11βHSD1, and 19.6 nM for HEK293-h11βHSD1). On the other hand, SKI2852 showed only negligible inhibitory activity for h11βHSD2, with 6% inhibition at 1 and 17% at 10 μM concentration, the latter of which was over 3000-fold higher concentration than IC50 for h11βHSD1, suggesting a high degree of selectivity and specificity for 11βHSD1 over 11βHSD2. Besides this selective inhibition of 11βHSD1 activity, we tested possibility that SKI2852 may have a direct non-specific effect on glucocorticoid receptor or related mineralocorticoid receptor activity (Supplemental Table 1). In all three different concentrations we used, SKI2852 had only residual actions on glucocorticoid receptor or mineralocorticoid receptor activation without any dosedependency, with negligible values compared with those of positive controls. These data indicate that SKI2852 may have a potent and highly specific inhibitory effect on human and mouse 11βHSD1 in vitro, without interfering endogenous 11βHSD2, glucocorticoid receptor, or mineralocorticoid receptor activities. To next examine whether SKI2852 can inhibit 11βHSD1 activity in target tissues, such as liver and adipose tissue, we administered SKI2852 to C57BL/6 mice for an ex vivo analysis (Fig. 1A). 2 h after administration, both the liver and epididymal fat tissue from SKI2852-treated mice showed significantly and dose-dependently lower levels of cortisol than those from vehicle-treated mice in the culture media containing cortisone, and 1 mg/kg of SKI2852 was sufficient enough to inhibit 11βHSD1 activity in both tissues (55%

Please cite this article as: Oh, H., et al., A potent and selective 11β-hydroxysteroid dehydrogenase type 1 inhibitor, SKI2852, ameliorates metabolic syndrome in diabetic mice models. Eur J Pharmacol (2015), http://dx.doi.org/10.1016/j.ejphar.2015.10.042i

4

H. Oh et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎

Fig. 1. The inhibitory effect of SKI2852 on 11βHSD1 activity. (A) The inhibition of 11βHSD1 activity by SKI2852 in an ex vivo measurement in liver and epididymal fat (Epididymal). Relative cortisol levels in the tissue culture media of SKI2852-administered tissues were plotted as the percent 11βHSD1 activity of those of vehicle-administered tissues. *, Po 0.05 vs. Vehicle. (B) The inhibition of systemic 11βHSD1 activity by SKI2852 in vivo (left) and plasma concentration of SKI2852 (right) in C57BL/6 mice. Mice were orally administered with indicated doses of SKI2852, and again with 0 (vehicle only, Normal group) or 30 mg/kg of cortisone. Normal group received 0 mg/ kg of cortisone administration, and Normal and Vehicle groups received 0 mg/kg of SKI2852 administration. *, P o0.05 vs. Normal; **, P o0.05 vs. Vehicle. Data are expressed as mean 7 S.E.M. (n¼ 4/group). Statistical analysis was done by one-way ANOVA followed by post hoc comparisons with Fisher’s PLSD test for multiple comparisons.

and 82% reductions in liver and epididymal fat, respectively). This effect was maintained up to 6 h after SKI2852 administration (data not shown). The inhibitory effect of 1 mg/kg SKI2852 on 11βHSD1 activity at 2 h was greater than that of 10 mg/kg of AMG-221 (19% and 64% inhibitions in liver and epididymal fat, respectively). These data suggest an effective and prolonged inhibition of target tissue 11βHSD1 enzyme activity by SKI2852 ex vivo, in conversion of cortisone to cortisol. We also determined the inhibitory effect of SKI2852 on the systemic 11βHSD1 activity in C57BL/6 mice in vivo (Fig. 1B). SKI2852 administration inhibited whole body 11βHSD1 activity in a dose-dependent manner, and reached to a plateau with maximum 100% inhibition at 3 mg/kg of SKI2852 dose, to the level of normal control (Normal), in which there was no cortisone administration. Consistent with this observation, there was a dosedependent increase in SKI2852 compound concentrations in the plasma. These data strongly suggest that SKI2852 may efficiently and sufficiently inhibit 11βHSD1 activity in vivo in conversion of cortisone to cortisol, with most likely liver and adipose tissue as its target tissues. 3.2. Effect of SKI2852 on body weight and fat mass changes in mice models Glucocorticoids have important roles in adipocyte differentiation (Campbell et al., 2011), and excessive exposure to glucocorticoids

increases fat mass, preferentially within omental depots, a consistent adiposity as in Cushing's syndrome (Stewart, 2003; Sutinen et al., 2004). Therefore, administration of 11βHSD1 inhibitor may prevent adipogenesis. To test this and to evaluate the effect of SKI2852 on body weight and fat mass changes, we administered 20 mg/kg of SKI2852 to DIO mice, as a mild obese model. During the course of 8.5 weeks of treatment, however, the SKI2852 administration did not have any effect on body weight gains (Fig. 2A). There were no significant differences in daily food intake during treatment (data not shown). Overall liver functions appeared to be normal in SKI2852 group, judging by final liver weights (Vehicle, 942.5730.0 mg; SKI2852, 951.9718.7 mg) and levels of lactate dehydrogenase (Vehicle, 131.8710.2 U/l; SKI2852, 135.4716.4 U/l), alanine transaminase (Vehicle, 34.673.1 U/l; SKI2852, 26.772.5 U/ l), and aspartate transaminase (Vehicle, 66.971.6 U/l; SKI2852, 58.273.5 U/l). Interestingly enough, these mice showed a significant reduction in whole body fat mass gain by SKI2852 administration (Fig. 2B). These data may suggest a possible anti-adipogenesis effect of SKI2852. However, when we measured the weights of several adipose tissues, there was a marginal, though significant, reduction only in retroperitoneal fat pad weights by SKI2852 treatment (Fig. 2C), indicating that 11βHSD1 inhibition by SKI2852 has only a partial anti-adipogenesis effect. To examine the effect of SKI2852 on body weight in a more severe obese model than DIO mice, we next administered 12.5 mg/ kg of SKI2852 twice a day to ob/ob mice, which is well

Please cite this article as: Oh, H., et al., A potent and selective 11β-hydroxysteroid dehydrogenase type 1 inhibitor, SKI2852, ameliorates metabolic syndrome in diabetic mice models. Eur J Pharmacol (2015), http://dx.doi.org/10.1016/j.ejphar.2015.10.042i

H. Oh et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎

5

Fig. 2. The effect of SKI2852 on body weight and fat weights in DIO and ob/ob mice. (A to C) Vehicle or 20 mg/kg of SKI2852 was orally administrated to DIO mice once a day for 8.5 weeks, and (A) body weight changes, (B) body composition changes, and (C) several adipose tissue weights were determined. Data are expressed as mean 7S.E.M. (n ¼8/group). (D to E) Vehicle or 12.5 mg/kg of SKI2852 was orally administrated to ob/ob mice twice a day for 18 days, and (D) body weight changes and (E) several adipose tissue weights were determined. Data are expressed as mean 7S.E.M. (n¼ 7-8/group). *, Po 0.05 vs. Vehicle.

characterized by symptoms of type 2 diabetes such as obesity, hyperglycemia, and insulin resistance. Oral treatment of SKI2852 significantly and efficiently reduced body weight gain compared

with vehicle administration in ob/ob mice, starting from day 3 (Fig. 2D). However, after 18 days of SKI2852 treatment, only the weights of subcutaneous fat pad were significantly reduced among

Please cite this article as: Oh, H., et al., A potent and selective 11β-hydroxysteroid dehydrogenase type 1 inhibitor, SKI2852, ameliorates metabolic syndrome in diabetic mice models. Eur J Pharmacol (2015), http://dx.doi.org/10.1016/j.ejphar.2015.10.042i

H. Oh et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎

6

Table 1 The effect of SKI2852 on lipid profiles in DIO and ob/ob mice. DIO

Cholesterol (mg/dl) LDL (mg/dl) HDL (mg/dl) Triglyceride (mg/dl)

ob/ob

Vehicle (n ¼7)

SKI2852 (n¼ 8)

Vehicle (n ¼8)

SKI2852 (n¼ 7)

165.17 6.0 20.0 7 2.3 146.2 7 4.3 84.6 7 6.7

175.3 7 4.9 25.17 2.3 151.6 7 3.1 65.5 7 2.9a

340.3 7 6.3 74.8 7 4.1 210.4 7 4.3 130.3 7 18.7

282.7 7 11.1a 48.37 2.2a 196.2 7 5.9 100.17 6.9

Vehicle or 20 mg/kg of SKI2852 was orally administrated to DIO mice once a day for 8.5 weeks. Vehicle or 12.5 mg/kg of SKI2852 was orally administrated to ob/ob mice twice a day for 18 days. Data are expressed as mean7 S.E.M. a

, P o 0.05 vs. Vehicle; LDL, low-density lipoprotein cholesterol; HDL, high-density lipoprotein cholesterol.

Table 2 The effect of SKI2852 on postprandial glucose and HbA1c levels in DIO and ob/ob mice.

Glucose (mg/dl) HbA1c (%)

DIO

ob/ob

Vehicle (n¼ 8) SKI2852 (n¼ 7-8)

Vehicle (n¼ 8) SKI2852 (n ¼7)

186.8 7 4.6

283.9 7 24.9

188.3 7 18.0a

7.79 7 0.17

6.147 0.24a

4.03 7 0.13

194.4 77.9 3.53 70.15a

Vehicle or 20 mg/kg of SKI2852 was orally administrated to DIO mice once a day for 8.5 weeks. Vehicle or 12.5 mg/kg of SKI2852 was orally administrated to ob/ob mice twice a day for 18 days. Data are expressed as mean7 S.E.M. a

, P o 0.05 vs. Vehicle; HbA1c, hemoglobinA1c.

several fat tissues that we measured in this experiment (Fig. 2E). These data demonstrate that inhibition of 11βHSD1 by SKI2852 may efficiently improve obesity only in severely obese models, such as ob/ob mice, at least in part by a partial inhibition of adipogenesis. 3.3. Effect of SKI2852 on lipid profiles in mice models To determine the effect of SKI2852 on lipid profiles in disease models, we analyzed circulating cholesterols and triglycerides in SKI2852-treated DIO mice (Table 1). There were no changes in levels of total, LDL, and HDL cholesterols, while triglyceride levels were significantly reduced by SKI2852 treatment. Circulating FFA levels were not changed (data not shown). These data suggest that inhibition of 11βHSD1 by SKI2852 may partially improve lipid profiles in DIO mice model. In comparison, 12.5 mg/kg of SKI2852-treated ob/ob mice twice a day had significantly reduced plasma levels of total and LDL cholesterols, and there were no changes in HDL cholesterols and triglyceride levels by SKI2852 treatment (Table 1). These data demonstrate that inhibition of 11βHSD1 by SKI2852 may partially improve dyslipidemia in ob/ob mice model, and imply that SKI2852 may have a differential effect on different disease models. To determine the dose-dependent efficacy of SKI2852 in lower doses, we then orally administered 3 different doses (1, 3, or 10 mg/kg) of SKI2852 to ob/ob mice once a day for 21 days (Supplemental Table 2). Similar to the previous data (Table 1), we observed improved lipid profiles in SKI2852-treated mice. The 10 mg/kg dose of SKI2852 resulted in significantly reduced cholesterol levels without noticeable changes in triglyceride. In addition, FFA levels were significantly reduced by all doses of SKI2852. We also evaluated these effects of SKI2852 in KK-Ay/J (KK-Ay) mice, a more severe type 2 diabetic disease model than ob/ob mice (Supplemental Table 3). After 18 days of administration, there was an overall improvement in lipid profiles in SKI2852-treated KK-Ay

mice as well. SKI2852 treatment significantly reduced the levels of both total and LDL cholesterols and triglycerides compared with those in vehicle treatment. These data are consistent with those of DIO and ob/ob mice, and implies that inhibition of 11βHSD1 by SKI2852 may efficiently improve dyslipidemia in KK-Ay mice model with type 2 diabetes. 3.4. Effect of SKI2852 on postprandial glucose and HbA1c levels in mice models We next asked whether SKI2852 can also improve hyperglycemia in diabetes condition and analyzed blood samples of SKI2852-administered DIO mice to determine the efficacy of SKI2852 in blood glucose and HbA1c levels. The postprandial (Table 2) and fasting (Vehicle, 156.57 7.8 mg/dl; SKI2852, 159.2 76.0 mg/dl) glucose levels in SKI2852-treated DIO mice were not different from those in vehicle-treated mice. The postprandial (Vehicle, 3.417 0.70 ng/ml; SKI2852, 3.49 70.30 ng/ml) and fasting (Vehicle, 0.747 0.08 ng/ml; SKI2852, 0.59 70.05 ng/ ml) plasma insulin levels did not show any changes by SKI2852 treatment either. However, the blood HbA1c levels were significantly reduced in SKI2852-administered DIO mice compared with vehicle treatment (Table 2). These data suggest that inhibition of 11βHSD1 by SKI2852 may also efficiently improve HbA1c levels in DIO mice model. We also measured these parameters in ob/ob mice treated with 12.5 mg/kg of SKI2852 twice a day. SKI2852-treated group showed significantly reduced postprandial glucose levels by 34% compared with vehicle group (Table 2). Vehicle-treated mice showed a markedly high HbA1c value, underlining the severe progression of diabetes (Table 2). However, SKI2852 treatment showed an excellent effect on lowering HbA1c levels compared with vehicle group. These data strongly suggest that SKI2852 may have a glucose lowering effect by inhibition of 11βHSD1 in ob/ob mice model. Likewise, we determined the efficacy of SKI2852 on HbA1c levels in KK-Ay mice. Ten and 20 mg/kg doses of SKI2852 for 18 days resulted in small, though significant, reductions in blood HbA1c levels compared with vehicle group (Supplemental Fig. 2A). This may due to a short duration of treatment, and longer than 18 days of administration may be required for better outcome. On the other hand, plasma insulin levels were significantly decreased in SKI2852-treated mice in a dose-dependent manner (Supplemental Fig. 2B). Altogether, these data are again consistent with those of DIO and ob/ob mice, and suggest that inhibition of 11βHSD1 by SKI2852 may also improve insulin resistance in KK-Ay mice model. 3.5. Effect of SKI2852 on insulin sensitivity in DIO mice To examine and quantify the effect of SKI2852 on whole body and peripheral insulin sensitivities, we next performed hyperinsulinemic-euglycemic clamp experiment in DIO male mice. This

Please cite this article as: Oh, H., et al., A potent and selective 11β-hydroxysteroid dehydrogenase type 1 inhibitor, SKI2852, ameliorates metabolic syndrome in diabetic mice models. Eur J Pharmacol (2015), http://dx.doi.org/10.1016/j.ejphar.2015.10.042i

H. Oh et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎

7

Fig. 3. The effect of SKI2852 on insulin sensitivity in DIO mice. (A to C) The whole body and hepatic insulin sensitivity in situ assessed by a hyperinsulinemic-euglycemic clamp experiment. Vehicle or indicated doses of SKI2852 were orally administrated to DIO mice once a day for 4 weeks. (A) Glucose infusion rate (GIR), (B) hepatic glucose output (HGO), and (C) peripheral insulin sensitivity indices were calculated from the clamp results. Data are expressed as mean7 S.E.M. (n ¼9-10/group). (D) Hepatic mRNA levels of glucocorticoid receptor (Nr3c1), H6PDH (H6pd), PEPCK (Pck1), and G6Pase (G6pc) in DIO mice after SKI2852 administration. Vehicle or indicated doses of SKI2852 were orally administrated to the mice once a day for 8.5 weeks. Data are expressed as mean 7S.E.M. (n¼ 8-9/group). *, Po 0.05 vs. Vehicle.

method is known as a gold standard for quantifying insulin sensitivity in vivo, since it measures flux rate of glucose necessary to compensate for an increased insulin level without causing hypoglycemia. The GIR in SKI2852-treated mice showed a dose-dependency and was higher than that in vehicle-treated mice (Fig. 3A), an indication of increased whole body insulin sensitivity. GIR was significantly increased by approximately 50% in 20 mg/kg of SKI2852-treated group compared with vehicle-treated group. Likewise, the hepatic glucose output (HGO) was significantly suppressed in 20 mg/kg of SKI2852-treated mice (Fig. 3B), an indication of increased hepatic insulin sensitivity. There were no changes in peripheral glucose fluxes, such as glucose uptake,

glycolysis, or glycogen synthesis (Fig. 3C), suggesting that liver may be one of the primary target tissues for SKI2852. These data strongly support that SKI2852 administration improves whole body insulin sensitivity, which is likely to be influenced by improved hepatic insulin sensitivity in DIO mice, and that SKI2852mediated inhibition of 11βHSD1 may block hepatic glucose output as a mode of action. Finally, to determine the underlying molecular mechanism of SKI2852-mediated inhibition of hepatic glucose production, we explored the influence of SKI2852 on hepatic glucocorticoid receptor (Nr3c1), H6PDH (H6pd), PEPCK (Pck1), and G6Pase (G6pc) gene expressions in DIO mice. It is well known that increased

Please cite this article as: Oh, H., et al., A potent and selective 11β-hydroxysteroid dehydrogenase type 1 inhibitor, SKI2852, ameliorates metabolic syndrome in diabetic mice models. Eur J Pharmacol (2015), http://dx.doi.org/10.1016/j.ejphar.2015.10.042i

H. Oh et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎

8

hepatic glucocorticoid receptor induces the activities and expressions of the key hepatic gluconeogenic enzymes, PEPCK and G6Pase, leading to hyperglycemia and insulin resistance (Holmes et al., 2001; Hughes et al., 2008; Yabaluri and Bashyam, 2010). Quantitative RT-PCR analysis revealed that SKI2852 treatment markedly reduced hepatic glucocorticoid receptor mRNA levels, accompanied by the suppression of hepatic H6PDH gene expression (Fig. 3D), which supplies cofactor NADPH for 11βHSD1 (Lavery et al., 2006; Marcolongo et al., 2007). Similarly, SKI2852 treatment led to a dose-dependent suppression of both PEPCK and G6Pase mRNA expression levels, compared with vehicle treatment. These data suggest that inhibition of 11βHSD1 by SKI2852 may improve whole body and hepatic insulin sensitivities, and reverse diabetic symptoms by, at least in part, suppression of these gluconeogenic enzyme expression levels in DIO mice. Altogether, our results support that SKI2852 may have an ability to treat metabolic syndrome patients, having a positive efficacy in obesity, dyslipidemia, hyperglycemia, and insulin resistance.

4. Discussion In this study, we evaluated SKI2852 for 11βHSD1 inhibition activity, for metabolic efficacy in several disease mice models, and for enhancement of whole body and hepatic insulin sensitivities. We showed that SKI2852 is a selective 11βHSD1 inhibitor which potently inhibits cortisone to cortisol conversion. SKI2852 has significantly lowered body weight gains in ob/ob mice and partially improved lipid profiles in DIO, ob/ob, and KK-Ay mice models. It also has efficiently reduced postprandial glucose or blood HbA1c levels in these mice. Moreover, SKI2852 has clearly enhanced whole body and hepatic insulin sensitivities in DIO mice by, at least in part, suppression of hepatic gluconeogenic enzyme gene expressions. All together, these results strongly indicate that selective and potent inhibition of 11βHSD1 by SKI2852 may efficiently improve many aspects of metabolic parameters in type 2 diabetes and metabolic syndrome. The efficacy of SKI2852 in 11βHSD1 inhibition is rather potent, with IC50 as low as 2.9 nM in vitro, which is superior to that of other 11βHSD1 inhibitors that we tested, such as AMG-221 (Supplemental Fig. 1B), PF-915275, Wyeth 20 (Wan et al., 2009), and Merck 11 (Gu et al., 2005) (data not shown). This result is consistent with our ex vivo and in vivo analyses. Despite this potent 11βHSD1 inhibition by SKI2852, we did not observe any clear metabolic effect in our pilot mice model studies with less than 1 mg/kg dose of SKI2852, which is 10-fold higher than the lowest effective in vivo 11βHSD1 inhibition study dose, 0.1 mg/kg. The reason for this discrepancy is not clear, but it is likely that the required dose of SKI2852 for treatment of metabolic disease in mice models is higher than that for inhibition of 11βHSD1 in normal, regular chow-fed mice as we used in our in vivo inhibition study. Related with this issue, a recent study showed that high doses of 11βHSD1 inhibitors could cause an off-target metabolic effect (mainly weight loss) in HFD-fed Hsd11b1 null mice, although they saw this effect only with 30 or 100 mg/kg of inhibitors and not with 10 mg/kg (Harno et al., 2013b). Therefore, we cannot rule out that the metabolic improvements we observed in our DIO study with up to 20 mg/kg of SKI2852 are from an off-target metabolic effect, unrelated with 11βHSD1 inhibition. However, we have not observed clear reduction in body weight gain by SKI2852 administration in DIO study, which makes an off-target effect less likely. Perhaps an evaluation of SKI2852 effect in HFD-fed Hsd11b1-deficient mice may provide answers for this issue. The liver and adipose tissue are most likely two major target tissues for SKI2852. These tissues express high levels of 11βHSD1, by which active glucocorticoid conversion occurs to induce ligand-

occupied active glucocorticoid receptor-mediated genetic events, such as hepatic gluconeogenesis and adipogenesis. It has been suggested that visceral adipose tissues are the major source of active glucocorticoids produced by 11βHSD1 under the control of splanchnic nerve, and provide these glucocorticoids to the liver via portal vein (Walker and Andrew, 2006). Moreover, the adipocyte 11βHSD1 levels have been reported to be elevated both in obesity and in type 2 diabetes, while hepatic 11βHSD1 levels are decreased in obesity and sustained in type 2 diabetes (Sandeep et al., 2005; Stimson et al., 2011), suggesting that 11βHSD1 inhibitors are likely to be most effective in obese type 2 diabetes. However, a recent report demonstrated that liver-specific deletion of 11βHSD1 was sufficient to prevent 11-dehydrocorticosterone-induced adverse metabolic effects despite circulating corticosterone levels were elevated (Harno et al., 2013a), suggesting an importance of hepatic 11βHSD1 in conversion to local active glucocorticoids. In any case, we have clearly demonstrated in our study that SKI2852 sufficiently suppresses hepatic gluconeogenesis, as a major mode of SKI2852 action, by efficient inhibition of 11βHSD1 activity and expression, thereby inhibition of local active glucocorticoid conversion. The administration of SKI2852 has reduced fat weights only marginally in this study. In the genetic mice models of 11βHSD1, the modifications of 11βHSD1 at whole body or at adipose tissue level have clearly changed fat weights either in regular chow diet or in HFD condition, accompanied with changes in food intake (Masuzaki et al., 2001; Morton et al., 2004), while liver-specific modifications have not caused any clear changes in fat weights or food intake despite of changes in lipid profiles or insulin sensitivity (Harno et al., 2013a; Paterson et al., 2004). Thus, based on these results and ours, the impact of 11βHSD1 inhibition by SKI2852 seems to be relatively minor in adipose tissue compared with that in liver, and the drug sensitivity for changes in lipid profiles or insulin sensitivity is likely to be higher than that for changes in fat weights or food intake. In addition, proposed roles of chronic glucocorticoids exposure in both adipogenesis and lipolysis (Campbell et al., 2011) may explain minor changes in fat weights in this study. Lipid profile changes by SKI2852 administration in different mice models show similar, but not same results. For example, only triglyceride levels have been reduced in DIO mice, cholesterols and FFA levels in ob/ob mice, and total and LDL cholesterols and triglyceride levels in KK-Ay mice. Likewise, changes in postprandial glucose, HbA1c, and/or insulin levels also show differential patterns. For example, our data in DIO study show a significant reduction in HbA1c levels by SKI2852 administration, while there are no differences in postprandial or fasting glucose or insulin levels during and after 8.5 weeks of SKI2852 treatment compared with vehicle group. The reason for this discrepancy is not clear at this point. Nevertheless, there is a clear improvement in insulin sensitivity by SKI2852 administration in our DIO clamp experiment, which may suggest that HbA1c levels and hyperinsulinemic-euglycemic clamp results can better reflect and reveal an obscure insulin resistance status than glucose or insulin levels. On the other hand, both of the postprandial glucose and HbA1c levels were significantly reduced by 18 days of SKI2852 administration in our ob/ob study. Although the underlying mechanism is not clear, these differential effects imply that a differential severity of dyslipidemic, hyperglycemic, and metabolic symptoms or differences in mouse strains may determine the beneficial effect of SKI2852 on lipid profiles and insulin sensitivity. One of the most important and novel on-demand actions for type 2 diabetes drugs is an improvement of insulin resistance. In our in vivo hyperinsulinemic-euglycemic clamp experiment, SKI2852 clearly has demonstrated to improve whole body and hepatic insulin resistances in DIO mice, having dose-dependent

Please cite this article as: Oh, H., et al., A potent and selective 11β-hydroxysteroid dehydrogenase type 1 inhibitor, SKI2852, ameliorates metabolic syndrome in diabetic mice models. Eur J Pharmacol (2015), http://dx.doi.org/10.1016/j.ejphar.2015.10.042i

H. Oh et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎

increase and decrease in GIR and HGO, respectively, consistent with the inhibitory effect of SKI2852 on hepatic gluconeogenesis. These results are in good agreement with a previous report using BVT.2733 (Alberts et al., 2003). On the other hand, the peripheral glucose uptake has not been changed. Considering that muscle is a major tissue for glucose uptake, it is likely that SKI2852 does not have visible effect on muscle tissue, supporting the hypothesis that liver is a major target for SKI2852. Without any direct interference in glucocorticoid receptor activity by SKI2852 in our reporter gene analysis, the hepatic glucocorticoid receptor gene expression levels have been reduced in SKI2852-treated DIO mice. It is likely that the reduction in local hepatic corticosterone in these mice may have caused reduction in active ligand-bound glucocorticoid receptor, which may in turn reduce the expression of glucocorticoid receptor gene. This type of ligand- or agonist-induced activation of its own receptor gene expression is not uncommon in other biological systems as well (Jeong et al., 2004a). Therefore, the inhibitory effect of SKI2852 may be potentiated further by this mechanism in the liver, along with reduction in H6PDH gene expression. Taken together, our study clearly demonstrates that SKI2852 is a highly potent and selective 11βHSD1 inhibitor with a prolonged inhibitory effect on active glucocorticoid conversion in target tissues, inhibiting active glucocorticoid-induced hepatic gluconeogenesis. Our data in this study suggest that SKI2852 is more potent than other 11βHSD1 inhibitors that we have tested and is efficient and sufficient in the inhibition of 11βHSD1 activity, and as a result, it has beneficial effects on improvement of symptoms of metabolic syndrome, such as obesity, dyslipidemia, hyperglycemia, and insulin resistance. These results may provide rich evidence for therapeutic potential of SKI2852 as a novel 11βHSD1 inhibitor for type 2 diabetes patients with metabolic syndrome. We believe that development of a novel and potent 11βHSD1 inhibitor would add up beneficial diversity in drug choice and in combination therapies for patients. In conclusion, our present study indicates that selective and potent inhibition of 11βHSD1 by SKI2852 may sufficiently improve many aspects of metabolic parameters in type 2 diabetes and metabolic diseases, and strongly support that SKI2852 may have a great potential as a better candidate drug than currently available 11βHSD1 inhibitors for the treatment of diabetes and metabolic diseases.

Declaration of interests H.Y.H., H.J.S., H.J.L., S.K., J.H.S., and J.H.R. are employees of SK Chemicals. The authors declare that they have no vested interest that could be construed to have inappropriately influenced this study.

Contributor statements H.Y.H., S.K., and J.H.R. planned the project, H.O., J.H.R., and C.S.C. designed the experimental studies, S.K. and J.H.R. performed medicinal chemistry, H.J.S. and H.J.L. performed biochemical and cell-based analyses, H.J.S., J.H.S., and H.Y.H. performed ex vivo and in vivo inhibition analyses, H.O., H.Y.H., H.J.S., and S.S.K. performed mouse model experiments, H.O., K.-H.J., J.H.R., and C.S.C. analyzed data, K.-H.J. wrote the manuscript, and K.-H.J., H.-S.J., J.H.R., and C. S.C. reviewed and edited the manuscript.

9

Acknowledgments We thank Dr. Gildon Choi for generating and providing HEK293 cells stably transfected with 11βHSD1 cDNAs. This study was supported in part by grants of the Korea Health Technology R&D Project through the Korea Health Industry Development Institute (KHIDI), funded by the Ministry of Health & Welfare, Korea (HI14C1135 and HI15C0987 to C.S.C.).

Appendix A. Supplementary material Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.ejphar.2015.10. 042.

References Alberts, P., Nilsson, C., Selén, G., Engblom, L.O.M., Edling, N.H.M., Norling, S., Klingström, G., Larsson, C., Forsgren, M., Ashkzari, M., Nilsson, C.E., Fiedler, M., Bergqvist, E., Öhman, B., Björkstrand, E., Abrahmsén, L.B., 2003. Selective inhibition of 11β-hydroxysteroid dehydrogenase type 1 improves hepatic insulin sensitivity in hyperglycemic mice strains. Endocrinology 144, 4755–4762. Anagnostis, P., Katsiki, N., Adamidou, F., Athyros, V.G., Karagiannis, A., Kita, M., Mikhailidis, D.P., 2013. 11beta-Hydroxysteroid dehydrogenase type 1 inhibitors: novel agents for the treatment of metabolic syndrome and obesity-related disorders? Metabolism 62, 21–33. Baudrand, R., Carvajal, C.A., Riquelme, A., Morales, M., Solis, N., Pizarro, M., Escalona, A., Boza, C., Pérez, G., Domínguez, A., Arrese, M., Fardella, C.E., 2010. Overexpression of 11β-hydroxysteroid dehydrogenase type 1 in hepatic and visceral adipose tissue is associated with metabolic disorders in morbidly obese patients. Obes. Surg. 20, 77–83. Baudrand, R., Domínguez, J.M., Carvajal, C.A., Riquelme, A., Campino, C., Macchiavello, S., Bozinovic, M., Morales, M., Pizarro, M., Solis, N., Escalona, A., Boza, C., Arrese, M., Fardella, C.E., 2011. Overexpression of hepatic 5α-reductase and 11β-hydroxysteroid dehydrogenase type 1 in visceral adipose tissue is associated with hyperinsulinemia in morbidly obese patients. Metabolism 60, 1775–1780. Bhat, B.G., Hosea, N., Fanjul, A., Herrera, J., Chapman, J., Thalacker, F., Stewart, P.M., Rejto, P.A., 2008. Demonstration of proof of mechanism and pharmacokinetics and pharmacodynamic relationship with 4′-cyano-biphenyl-4-sulfonic acid (6amino-pyridin-2-yl)-amide (PF-915275), an inhibitor of 11β-hydroxysteroid dehydrogenase type 1, in cynomolgus monkeys. J. Pharmacol. Exp. Ther. 324, 299–305. Campbell, J.E., Peckett, A.J., D’souza, A.M., Hawke, T.J., Riddell, M.C., 2011. Adipogenic and lipolytic effects of chronic glucocorticoid exposure. Am. J. Physiol. Cell. Physiol. 300, C198–C209. Choi, C.S., Savage, D.B., Abu-Elheiga, L., Liu, Z.-X., Kim, S., Kulkarni, A., Distefano, A., Hwang, Y.-J., Reznick, R.M., Codella, R., Zhang, D., Cline, G.W., Wakil, S.J., Shulman, G.I., 2007. Continuous fat oxidation in acetyl-CoA carboxylase 2 knockout mice increases total energy expenditure, reduces fat mass, and improves insulin sensitivity. Proc. Natl. Acad. Sci. USA 104, 16480–16485. Day, C., 2007. Metabolic syndrome, or what you will: definitions and epidemiology. Diabetes Vasc. Dis. Res. 4, 32–38. Drake, A.J., Walker, B.R., Seckl, J.R., 2005. Intergenerational consequences of fetal programming by in utero exposure to glucocorticoids in rats. Am. J. Physiol. Regul. integr. Comp. Physiol. 288, R34–R38. García, R.A., Search, D.J., Lupisella, J.A., Ostrowski, J., Guan, B., Chen, J., Yang, W.-P., Truong, A., He, A., Zhang, R., Yan, M., Hellings, S.E., Gargalovic, P.S., Ryan, C.S., Watson, L.M., Langish, R.A., Shipkova, P.A., Carson, N.L., Taylor, J.R., Yang, R., Psaltis, G.C., Harrity, T.W., Robl, J.A., Gordon, D.A., 2013. 11β-Hydroxysteroid dehydrogenase type 1 gene knockout attenuates atherosclerosis and in vivo foam cell formation in hyperlipidemic apoE  /  mice. PLoS One 8, e53192. Gibbs, J.P., Emery, M.G., McCaffery, I., Smith, B., Gibbs, M.A., Akrami, A., Rossi, J., Paweletz, K., Gastonguay, M.R., Bautista, E., Wang, M., Perfetti, R., Daniels, O., 2011. Population pharmacokinetic/pharmacodynamic model of subcutaneous adipose 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) activity after oral administration of AMG 221, a selective 11β-HSD1 inhibitor. J. Clin. Pharmacol. 51, 830–841. Gu, X., Dragovic, J., Koo, G.C., Koprak, S.L., LeGrand, C., Mundt, S.S., Shah, K., Springer, M.S., Tan, E.Y., Thieringer, R., Hermanowski-Vosatka, A., Zokian, H.J., Balkovec, J.M., Waddell, S.T., 2005. Discovery of 4-heteroarylbicyclo[2.2.2]octyltriazoles as potent and selective inhibitors of 11β-HSD1: novel therapeutic agents for the treatment of metabolic syndrome. Bioorg. Med. Chem. Lett. 15, 5266–5269. Hale, C., Véniant, M., Wang, Z., Chen, M., McCormick, J., Cupples, R., Hickman, D., Min, X., Sudom, A., Xu, H., Matsumoto, G., Fotsch St, C., Jean Jr, D.J., Wang, M., 2008. Structural characterization and pharmacodynamic effects of an orally active 11β-hydroxysteroid dehydrogenase type 1 inhibitor. Chem. Biol. Drug.

Please cite this article as: Oh, H., et al., A potent and selective 11β-hydroxysteroid dehydrogenase type 1 inhibitor, SKI2852, ameliorates metabolic syndrome in diabetic mice models. Eur J Pharmacol (2015), http://dx.doi.org/10.1016/j.ejphar.2015.10.042i

10

H. Oh et al. / European Journal of Pharmacology ∎ (∎∎∎∎) ∎∎∎–∎∎∎

Des. 71, 36–44. Hamilton, B.S., Himmelsbach, F., Nar, H., Schuler-Metz, A., Krosky, P., Guo, J., Guo, R., Meng, S., Zhao, Y., Lala, D.S., Zhuang, L., Claremon, D.A., McGeehan, G.M., 2015. Pharmacological characterization of the selective 11β-hydroxysteroid dehydrogenase 1 inhibitor, BI 135585, a clinical candidate for the treatment of type 2 diabetes. Eur. J. Pharmacol. 746, 50–55. Harno, E., Cottrell, E.C., Keevil, B.G., DeSchoolmeester, J., Bohlooly-Y, M., Andersén, H., Turnbull, A.V., Leighton, B., White, A., 2013a. 11-Dehydrocorticosterone causes metabolic syndrome, which is prevented when 11β-HSD1 is knockedout in livers of male mice. Endocrinology 154, 3599–3609. Harno, E., Cottrell, E.C., Yu, A., DeSchoolmeester, J., Gutierrez, P.M., Denn, M., Swales, J.G., Goldberg, F.W., Bohlooly-Y, M., Andersén, H., Wild, M.J., Turnbull, A.V., Leighton, B., White, A., 2013b. 11β-Hydroxysteroid dehydrogenase type 1 (11βHSD1) inhibitors still improve metabolic phenotype in male 11β-HSD1 knockout mice suggesting off-target mechanisms. Endocrinology 154, 4580–4593. Hermanowski-Vosatka, A., Balkovec, J.M., Cheng, K., Chen, H.Y., Hernandez, M., Koo, G.C., Le Grand, C.B., Li, Z., Metzger, J.M., Mundt, S.S., Noonan, H., Nunes, C.N., Olson, S.H., Pikounis, B., Ren, N., Robertson, N., Schaeffer, J.M., Shah, K., Springer, M.S., Strack, A.M., Strowski, M., Wu, K., Wu, T., Xiao, J., Zhang, B.B., Wright, S.D., Thieringer, R., 2005. 11β-HSD1 inhibition ameliorates metabolic syndrome and prevents progression of atherosclerosis in mice. J. Exp. Med. 202, 517–527. Holmes, M.C., Kotelevtsev, Y., Mullins, J.J., Seckl, J.R., 2001. Phenotypic analysis of mice bearing targeted deletions of 11β-hydroxysteroid dehydrogenases 1 and 2 genes. Mol. Cell. Endocrinol. 171, 15–20. Hughes, K.A., Webster, S.P., Walker, B.R., 2008. 11-Beta-hydroxysteroid dehydrogenase type 1 (11β-HSD1) inhibitors in Type 2 diabetes mellitus and obesity. Expert Opin. Investig. Drugs 17, 481–496. Jeong, K.-H., Chin, W.W., Kaiser, U.B., 2004a. Essential role of the homeodomain for pituitary homeobox 1 activation of mouse gonadotropin-releasing hormone receptor gene expression through interactions with c-Jun and DNA. Mol. Cell. Biol. 24, 6127–6139. Jeong, K.-H., Sakihara, S., Widmaier, E.P., Majzoub, J.A., 2004b. Impaired leptin expression and abnormal response to fasting in corticotropin-releasing hormonedeficient mice. Endocrinology 145, 3174–3181. Johansson, L., Fotsch, C., Bartberger, M.D., Castro, V.M., Chen, M., Emery, M., Gustafsson, S., Hale, C., Hickman, D., Homan, E., Jordan, S.R., Komorowski, R., Li, A., McRae, K., Moniz, G., Matsumoto, G., Orihuela, C., Palm, G., Veniant, M., Wang, M., Williams, M., Zhang, J., 2008. 2-Amino-1,3-thiazol-4(5H)-ones as potent and selective 11β-hydroxysteroid dehydrogenase type 1 inhibitors: enzyme-ligand co-crystal structure and demonstration of pharmacodynamic effects in C57Bl/6 mice. J. Med. Chem. 51, 2933–2943. Joharapurkar, A., Dhanesha, N., Shah, G., Kharul, R., Jain, M., 2012. 11β-Hydroxysteroid dehydrogenase type 1: potential therapeutic target for metabolic syndrome. Pharmacol. Rep. 64, 1055–1065. Lavery, G.G., Walker, E.A., Draper, N., Jeyasuria, P., Marcos, J., Shackleton, C.H.L., Parker, K.L., White, P.C., Stewart, P.M., 2006. Hexose-6-phosphate dehydrogenase knock-out mice lack 11β-hydroxysteroid dehydrogenase type 1-mediated glucocorticoid generation. J. Biol. Chem. 281, 6546–6551. Marcolongo, P., Piccirella, S., Senesi, S., Wunderlich, L., Gerin, I., Mandl, J., Fulceri, R., Bánhegyi, G., Benedetti, A., 2007. The glucose-6-phosphate transporter-hexose6-phosphate dehydrogenase-11β-hydroxysteroid dehydrogenase type 1 system

of the adipose tissue. Endocrinology 148, 2487–2495. Masuzaki, H., Paterson, J., Shinyama, H., Morton, N.M., Mullins, J.J., Seckl, J.R., Flier, J. S., 2001. A transgenic model of visceral obesity and the metabolic syndrome. Science 294, 2166–2170. Masuzaki, H., Yamamoto, H., Kenyon, C.J., Elmquist, J.K., Morton, N.M., Paterson, J. M., Shinyama, H., Sharp, M.G.F., Fleming, S., Mullins, J.J., Seckl, J.R., Flier, J.S., 2003. Transgenic amplification of glucocorticoid action in adipose tissue causes high blood pressure in mice. J. Clin. Investig. 112, 83–90. Morton, N.M., Paterson, J.M., Masuzaki, H., Holmes, M.C., Staels, B., Fievet, C., Walker, B.R., Flier, J.S., Mullins, J.J., Seckl, J.R., 2004. Novel adipose tissuemediated resistance to diet-induced visceral obesity in 11β-hydroxysteroid dehydrogenase type 1-deficient mice. Diabetes 53, 931–938. Paterson, J.M., Morton, N.M., Fievet, C., Kenyon, C.J., Holmes, M.C., Staels, B., Seckl, J. R., Mullins, J.J., 2004. Metabolic syndrome without obesity: hepatic overexpression of 11β-hydroxysteroid dehydrogenase type 1 in transgenic mice. Proc. Natl. Acad. Sci. USA 101, 7088–7093. Pereira, C.D., Azevedo, I., Monteiro, R., Martins, M.J., 2012. 11β-Hydroxysteroid dehydrogenase type 1: relevance of its modulation in the pathophysiology of obesity, the metabolic syndrome and type 2 diabetes mellitus. Diabetes Obes. Metab. 14, 869–881. Sandeep, T.C., Andrew, R., Homer, N.Z.M., Andrews, R.C., Smith, K., Walker, B.R., 2005. Increased in vivo regeneration of cortisol in adipose tissue in human obesity and effects of the 11β-hydroxysteroid dehydrogenase type 1 inhibitor carbenoxolone. Diabetes 54, 872–879. Stewart, P.M., 2003. Tissue-specific Cushing's syndrome, 11β-hydroxysteroid dehydrogenases and the redefinition of corticosteroid hormone action. Eur. J. Endocrinol. 149, 163–168. Stimson, R.H., Andrew, R., McAvoy, N.C., Tripathi, D., Hayes, P.C., Walker, B.R., 2011. Increased whole-body and sustained liver cortisol regeneration by 11β-hydroxysteroid dehydrogenase type 1 in obese men with type 2 diabetes provides a target for enzyme inhibition. Diabetes 60, 720–725. Sutinen, J., Kannisto, K., Korsheninnikova, E., Nyman, T., Ehrenborg, E., Andrew, R., Wake, D.J., Hamsten, A., Walker, B.R., Yki-Järvinen, H., 2004. In the lipodystrophy associated with highly active antiretroviral therapy, pseudo-Cushing's syndrome is associated with increased regeneration of cortisol by 11β-hydroxysteroid dehydrogenase type 1 in adipose tissue. Diabetologia 47, 1668–1671. Walker, B.R., Andrew, R., 2006. Tissue production of cortisol by 11β-hydroxysteroid dehydrogenase type 1 and metabolic disease. Ann. N. Y. Acad. Sci. 1083, 165–184. Walker, B.R., Seckl, J.R., 2003. 11β-Hydroxysteroid dehydrogenase Type 1 as a novel therapeutic target in metabolic and neurodegenerative disease. Expert. Opin. Ther. Targets 7, 771–783. Wan, Z.-K., Chenail, E., Xiang, J., Li, H.-Q., Ipek, M., Bard, J., Svenson, K., Mansour, T.S., Xu, X., Tian, X., Suri, V., Hahm, S., Xing, Y., Johnson, C.E., Li, X., Qadri, A., Panza, D., Perreault, M., Tobin, J.F., Saiah, E., 2009. Efficacious 11β-hydroxysteroid dehydrogenase type I inhibitors in the diet-induced obesity mouse model. J. Med. Chem. 52, 5449–5461. Yabaluri, N., Bashyam, M.D., 2010. Hormonal regulation of gluconeogenic gene transcription in the liver. J. Biosci. 35, 473–484. Youn, J.H., Buchanan, T.A., 1993. Fasting does not impair insulin-stimulated glucose uptake but alters intracellular glucose metabolism in conscious rats. Diabetes 42, 757–763.

Please cite this article as: Oh, H., et al., A potent and selective 11β-hydroxysteroid dehydrogenase type 1 inhibitor, SKI2852, ameliorates metabolic syndrome in diabetic mice models. Eur J Pharmacol (2015), http://dx.doi.org/10.1016/j.ejphar.2015.10.042i