- Email: [email protected]
A process for supercoiled plasmid DNA purification based on multimodal chromatography
Accepted Manuscript A process for supercoiled plasmid DNA purification based on multimodal chromatography A. Rita Silva-Santos, Cláudia P.A. Alves, Duarte Miguel F. Prazeres, Ana M. Azevedo PII: DOI: Reference:
S1383-5866(16)32242-0 http://dx.doi.org/10.1016/j.seppur.2017.03.042 SEPPUR 13628
To appear in:
Separation and Purification Technology
Received Date: Revised Date: Accepted Date:
3 November 2016 14 March 2017 22 March 2017
Please cite this article as: A.R. Silva-Santos, C.P.A. Alves, D.M.F. Prazeres, A.M. Azevedo, A process for supercoiled plasmid DNA purification based on multimodal chromatography, Separation and Purification Technology (2017), doi: http://dx.doi.org/10.1016/j.seppur.2017.03.042
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
A process for supercoiled plasmid DNA purification based on multimodal chromatography
A. Rita Silva-Santos, Cláudia P. A. Alves, Duarte Miguel F. Prazeres* and Ana M. Azevedo*
iBB
–
Institute
for
Bioengineering
and
Biosciences,
Department
of
Bioengineering, Instituto Superior Técnico, Universidade de Lisboa, Av. Rovisco Pais, 1049-001 Lisboa, Portugal
* Corresponding authors. E-mail address: [email protected] (D.M.F. Prazeres) E-mail address: [email protected] (A.M. Azevedo)
Abstract Non-viral gene therapy and DNA vaccination currently hold great potential for treatment and prevention of genetic and acquired diseases. The large-scale manufacturing of plasmid DNA (pDNA) vectors, and the downstream processing in particular, is one of the key aspects of process development required to move non-viral gene therapy to the clinic. To address the problematic isolation and purification of pDNA molecules, an alternative and cost effective process based on multimodal chromatography was developed. In particular, the possibility of using a cationic multimodal ligand (CaptoTM adhere) to remove RNA impurities from E. coli pre-purified lysates and to isolate supercoiled (sc) pDNA isoforms from open circular (oc) pDNA was explored. The process involves E. coli
1
culture, cell harvesting and alkaline lysis followed by isopropanol, ammonium acetate and PEG-8000 precipitation. Finally, sc pDNA is isolated by multimodal chromatography using a step-wise NaCl elution method that includes washing of unbound oc pDNA at 830 mM NaCl, sc pDNA elution at 920 mM and removal of RNA at 2 M. The method provided baseline separation of isoforms and yielded sc-rich fractions (> 90%) that are virtually free from RNA and have levels of gDNA (1.30.3 % µg gDNA/µg sc pDNA) and protein (4.971.34 µg/mL) impurities within specifications. Approximately 376 g of sc pDNA were obtained from 200 mL of bacterial cell culture (OD 600nm 19). The process was reproducible and performed similarly with differently sized plasmids (2,686 bp, 3,696 bp and 10,410 bp).
Keywords: multimodal chromatography; plasmid DNA; supercoiling: plasmid isoforms; separation.
1. Introduction Gene therapy is defined as the in vivo or ex vivo delivery of new genetic material into the somatic cells of a patient, through the administration of gene delivery vectors, in order to promote a therapeutic effect either by gene addition, correction or knockout [1, 2]. These delivery vectors have to be able to shuttle genes into the nucleus of target cells, protect the genetic material from degradation and ensure the transcription of the gene of interest in the cell. They have also to guarantee a safe and efficient gene transfer and stable and sufficient gene expression [3].
2
The delivery vectors used in this context can be divided into two groups – viral and non-viral. Although viral vectors are still the most used on clinical trials worldwide [4], concerns regarding their safety gave rise to the use of vectors of non-viral origin, namely plasmid DNA (pDNA) [3, 5]. Despite presenting lower transfection efficiency, the interest in pDNA vectors has been increasing due to their low toxicity and immunogenicity in transfected hosts, almost unlimited capacity for the gene of interest and easy production [3]. A key aspect in the production of pDNA vectors is related with the structural conformation – linear, open circular (oc) and supercoiled (sc) – of the final plasmid product. Several studies have established the sc isoform as the most physiologically active conformation [6, 7]. As a consequence, guidelines issued by regulatory agencies, including the Food and Drug Administration (FDA), recommend that therapeutic pDNA products used in clinical trials should present a minimum homogeneity of 80% in sc isoform [8]. Several improvements have been made over the years on the large scale manufacturing of pDNA vectors, with a special focus on the downstream processing [9, 10] . The initial stages of the downstream are designed to isolate pDNA from producer Escherichia coli cells, remove large amounts of RNA and proteins and reduce volume. Although streams entering the final purification stage are substantially purified and enriched in pDNA, small amounts of E. coliderived impurities and oc pDNA variants must be removed to obtain a final product with adequate quality. Chromatography has been used extensively at this stage to purify pDNA and/or to isolate the therapeutically valuable sc isoform from the oc counterpart [11]. Examples of the chromatographic modalities used include size exclusion [12], anion-exchange [13, 14],
3
hydrophobic interaction [15, 16, 17, 18], and affinity [19]. Multimodal chromatography has also been used for pDNA purification. The key goal here is to explore at least two different types of interactions between solutes and the stationary phase in the same chromatographic step [20, 21]. For example, phenyl-boronate ligands were used to adsorb cis-diol-bearing species (RNA, lipopolysaccharides-LPS) via the establishment of covalent bonds, and cis-diolfree proteins and genomic DNA (gDNA) fragments via charge transfer interactions, while leaving most pDNA in solution [22]. Černigoj et al. [23] were able to separate pDNA isoforms using a histamine ligand in a monolith chromatographic support, but this requires the use of a very high concentration (3.0 M) of ammonium sulfate in the mobile phase. Matos et al. [24] used an NaCl
elution
scheme
with
the
multimodal
ligand
N-benzyl-N-methyl
ethanolamine (CaptoTM adhere) ligand (Fig. 1) to purify pDNA from RNA in crude E. coli DH5 extracts, but failed to separate isoforms. Notwithstanding, Silva-Santos et al. [25] reported that a CaptoTM adhere column is indeed able to separate pDNA isoforms in pre-purified pDNA containing samples, provided that an appropriate NaCl elution scheme is used. More specifically, oc and sc isoforms were eluted sequentially with NaCl steps of 844 mM (72 mS/cm) and 892 mM (75 mS/cm).
4
Fig. 1. The CaptoTM adhere ligand, N-benzyl-N-methyl ethanolamine, allows the establishment of three different types of interactions: anion- exchange (charged nitrogen), hydrogen bonding (hydroxyls) and hydrophobic (phenyl ring).
In this work, an innovative, efficient and reproducible process was developed where the CaptoTM adhere multimodal ligand is now used to isolate sc isoforms from pre-purified E. coli lysates. The total plasmid recovered after each step was determined through quantification by HIC-HPLC. The quality of the final product was also evaluated, in terms of homogeneity and presence of host impurities, namely genomic DNA (gDNA) and proteins. The reproducibility and robustness of the method was demonstrated by purifying three plasmids with different sizes, pUC18 (2,687 bp), pVAX1-GFP (3,697 bp) and pCEP4 (10,410 bp).
2. Materials and Methods 2.1. Materials CaptoTM adhere bulk was obtained from GE Healthcare (Uppsala, Sweden). All salts used were of analytical grade. 2.2. Bacterial cell growth and plasmid production 2.2.1. pVAX1-GFP An inoculum was prepared from frozen GALG20 cells [26] harbouring pVAX1GFP (3,696 bp) [27] in 15 mL conical centrifuge tubes containing 5 mL of LB medium (NZYTech, Lisbon, Portugal) supplemented with 30 g/mL kanamycin 5
(Amresco, Solon, OH). After overnight incubation at 37 ºC and 250 rpm, cells were used to inoculate 250 mL baffled shake flasks containing 50 mL of rich cultivation medium (10 g/L bacto peptone, 10 g/L yeast extract, 3 g/L ammonium sulphate, 3.5 g/L potassium hydrogen phosphate, 3.5 g/L potassium dihydrogen phosphate, 2 g/L magnesium sulphate, 200 mg/L thiamine, 20 g/L glucose, and 1 mL/L of a trace element solution [28]) supplemented with 30 g/mL kanamycin, pH 7.1, at an optical density at 600 nm (OD600nm) of approximately 0.1. Cells were incubated at 37 ºC, 250 rpm and harvested after 8 hours by centrifugation (15 min at 6,000 g, 4ºC). 2.2.2. pUC18 and pCEP4 E. coli DH5 transformed with either pUC18 (2,687 bp) or pCEP4 (10,410 bp) was grown overnight in 100 mL shake flasks containing 30 mL LB medium (NZYTech, Lisbon, Portugal) supplemented with 100 g/mL ampicillin (SigmaAldrich, St. Louis, MO) at 37 ºC and 250 rpm. The appropriate volume to inoculate 250 mL of LB medium supplemented with 100 g/mL ampicillin at pH 7.3, at an OD600nm of 0.1, was centrifuged and cells were used to inoculate 2 L shake flasks. Cells were incubated at 37 ºC, 250 rpm and harvested after 8 hours by centrifugation (15 min at 6,000 g, 4ºC). 2.3. Primary purification and intermediate recovery The alkaline lysis method used was based on the protocol described by Birnboim et al. [29] and the intermediate recovery process was performed based on Horn et al. [12]. Cells harvested at the end of cell culture were resuspended in a 50 mM glucose, 25 mM Tris-HCl, 10 mM EDTA, pH 8, buffer up to an OD600nm of 60 and mixed with a buffer composed of 0.2 M NaOH, 1% (w/v) SDS at a 1:1 volume ratio. The mixture was gently homogenized and
6
left to rest at room temperature for 10 minutes, after which a volume of 5 M acetate buffer with 3 M potassium (pH 5) equal to half of the mixture volume was added. After gentle homogenization, the neutralized lysate was placed on ice and left to rest for 10 minutes. A clarified lysate was then obtained by centrifugation (2 times at 18,250 g and 4 ºC for 30 min) and nucleic acids were precipitated with 0.7% (v/v) isopropanol at -20 ºC for 2 h. After centrifugation (30 min at 18,250 g, 4 ºC), the supernatant was discarded and the pellet was left to dry overnight at room temperature. Following pellet resuspension in TE (10 mM Tris-HCl, 1 mM EDTA, pH 8), the pDNA rich solution was conditioned to 2.5 M of ammonium acetate by dissolution of the appropriate amount of salt. Following homogenization, the solution was left to rest for 15 min on ice and then centrifuged (30 min at 15,000 g, 4ºC). The supernatant was recovered and 30% PEG-8000 in 1.6 M NaCl was added to achieve a final concentration of 10% PEG-8000. In order to complete precipitation of pDNA, the mixture was left to rest overnight at 4ºC and centrifuged (30 min at 15,000 g, 4ºC). After discarding the supernatant, the pellet containing the nucleic acids was resuspended in 1 mL TE buffer. 2.4. Multimodal chromatography The plasmid-containing solution obtained in the previous section was conditioned by dilution (1:12) with a buffer containing 830 mM sodium chloride in 10 mM TE, prior to column loading. The sc pDNA was then purified by multimodal chromatography using a Tricorn 10/50 column (GE Healthcare) packed with 5 mL of CaptoTM adhere resin connected to an ÄKTApurifier100 system (GE Healthcare). The mobile phase consisted of mixtures of buffer A (10 mM Tris-HCl, 1 mM EDTA, pH 8) and buffer B (2 M NaCl in 10 mM Tris-
7
HCl, 1 mM EDTA, pH 8). The absorbance of the eluate was continuously measured at 254 nm by a UV detector positioned after the column outlet and the system was operated at 1 mL/min. The column was equilibrated with 3 column volumes (CV) of 41.5% buffer B ( 69 mS/cm). Then, 1 mL of the conditioned sample was injected into the column by washing the loop with 3 mL of 41.5% buffer B. All unbound material was washed out of the column with 2 CV of 41.5% buffer B. Elution steps were then performed with 3 CV of 46% B ( 75 mS/cm) and 3 CV of 100% B ( 140 mS/cm). The eluate was collected (fractions of 1.5 mL) during the course of the chromatographic run in 2 mL eppendorf tubes with a fraction collector. 2.5. Micro-dialysis For desalting, 200 L of peak fractions were collected into 0.5 mL eppendorf tubes. The tube caps were removed and the top of each tube was covered with a OrDial D14 dialysis membrane with a thickness of 23 m and 12-14 kDa molecular weight cut-off (Orange Scientific, Braine-l’Alleud, Belgium) that was kept in place with a rubber band. The tubes were inverted, assuring that all the solution was in contact with the membrane, and placed floating on a beaker with 1 L of 10 mM Tris-HCl, 1 mM EDTA, pH 8. The dialysis was performed overnight at 4ºC with agitation, after which desalted samples were analysed by gel electrophoresis. 2.6. Analytical Techniques 2.6.1. Gel electrophoresis Agarose gels were prepared with 1% (w/v) agarose (Fisher Scientific, Waltham, MA) in TAE buffer (40 mM Tris base, 20 mM acetic acid and 1 mM EDTA, pH 8) and loaded with samples mixed with 6x loading buffer (40%(w/v) sucrose,
8
0.25% (w/v) bromophenol blue), using NZYDNA ladder III (NZYTech, Lisbon, Portugal) as molecular weight marker. Gel electrophoresis was performed in TAE buffer at 100 V for 60 minutes and 120 V for 90 minutes for small and larger gels, respectively. Gels were stained in an ethidium bromide solution (0.4 g/mL) and images were obtained with an Eagle Eye II gel documentation system (Stratagene). The percentage of sc pDNA on the purified fractions (eluted at 46% B; 75 mS/cm) was determined by densitometry analysis of the band intensities on the agarose gel, using the ImageJ software [30].
2.6.2. Plasmid quantification Samples collected during the course of the downstream process (see Fig. 2) were analysed by analytical hydrophobic interaction chromatography (HIC)HPLC to quantify pDNA, following the protocol described in [31]. Briefly, a 1.7 mL bed volume (SOURCE 15PHE 4.6/100 PE, GE Healthcare) connected to an ÄKTApurifier10 system (GE Healthcare), was equilibrated at 1 mL/ min with 1.5 M ammonium sulfate in 10 mM Tris-HCl, pH 8. Following column loading with 50 l of sample under analysis (e.g. collected fractions), elution was performed in a step mode with 10 mM Tris-HCl, pH 8. Plasmid quantification was performed using a calibration curve prepared in a concentration range from 0 to 100 g/mL.
9
Fig. 2. Process used for the production and purification of pDNA. HIC-HPLC analysis was performed on samples taken at the indicated points.
2.6.3. Real-time PCR The presence of gDNA on purified sc pDNA samples was evaluated by performing a “hot-start” SYBR Green I-based quantitative real-time PCR using the Roche LightCycler, as described by Carapuça et al. [32]. Reactions were prepared with 4 L of relevant fractions and using a final concentration of 0.5 M
of
sense
(ACACGGTCCAGAACTCCTACG)
and
antisense
(GCCGGTGCTTCTTCTGCGGGTAACGTCA) primers targeting a 182-bp region of 16S rRNA gene located in the bacterial genome. The PCR program used consisted of 10 min at 95 °C followed by 40 cycles of amplification (10 s at 95°C, 5 s at 55 °C, 7 s at 72 °C). Values of the threshold cycle (CT) were calculated, using the second derivative method, by the LightCycler software version 4.1 (Roche Diagnostics). 2.6.4. Protein Quantification The amount of proteins present on purified sc pDNA samples was determined using the bicinchoninic acid (BCA) protein assay reagent kit from Thermo Scientific (Waltham, MA) following the manufacturer’s test tube procedure. Bovine serum albumin (BSA) standards were prepared by serial dilution of a
10
2 mg/mL albumin standard in a concentration range from 0 to 250 g/mL. 100 L of each standard and sample replicate were added to 2 mL eppendorfs, followed by the addition and mixing of 2 mL of working reagent (50 parts of reagent A to 1 part of reagent B). Then, the tubes were incubated for 30 min at 60 ºC, after which they were cooled down at room temperature and the absorbance at 562 nm of all samples in analysis was measured within 10 min.
3. Results and Discussion A pDNA manufacturing process was devised that involves E. coli culture, cell harvesting and alkaline lysis followed by isopropanol, ammonium acetate and PEG-8000 precipitation, and finally, multimodal chromatography (Fig. 2).
3.1. Primary purification and intermediate recovery GALG20 E. coli cells were transformed with plasmid pVAX1-GFP and grow in a rich cultivation medium for 8 h until reaching an OD600nm 19. Cells are then harvested and disrupted by alkaline lysis to release the intracellular contents, namely pDNA and RNA and to denature gDNA and cell host proteins (lane 1, Fig. 3). The nucleic acids present in the clarified lysate were then concentrated by isopropanol precipitation and resuspension in TE buffer (lane 2, Fig. 3). With this step, the total volume of the pDNA-containing solution was reduced 20-fold. RNA and protein impurities in this solution were precipitated with ammonium acetate and the pDNA-rich supernatant was recovered (lane 3, Fig. 3). Finally, a precipitation with 10% (w/v) PEG-8000/0.53 M NaCl was performed in order to (i) concentrate pDNA, (ii) reduce the RNA load and (iii) remove the ammonium acetate salt added in the previous step. After centrifugation, the pDNA-rich
11
pellet was resuspended in TE buffer (lane 4, Fig. 3) resulting in an 8-fold solution volume reduction on the last step of intermediate recovery.
Fig. 3. Primary purification and intermediate recovery of pDNA. Agarose gel electrophoresis was used to analyse pDNA-containing samples obtained after alkaline lysis (lane 1, 20 L of sample), isopropanol precipitation (lane 2, 2 L of sample), ammonium acetate precipitation (lane 3, 2 L of sample) and PEG-8000 precipitation (lane 4, 0.5 L of sample). Lane L corresponds to the molecular weight marker.
3.2. Multimodal chromatography The process stream obtained after primary purification and intermediate recovery contains mainly pDNA (oc, sc and multimers) and RNA (lane 4, Fig. 3). In order to isolate sc pDNA from the remaining nucleic acids, multimodal chromatography was tested using a 5 mL chromatographic column packed with CaptoTM adhere (Fig. 1) resin. This matrix contains an immobilised ligand that can mediate anion-exchange (with the charged nitrogen), hydrophobic (with the 12
phenyl ring) and hydrogen bonding (with the hydroxyl groups) interactions with the solutes in the feed stream. The concentrated pDNA solution obtained after PEG-8000 precipitation (lane 4, Fig. 4) was pre-conditioned with a 2 M NaCl in TE buffer solution to set NaCl concentration at 830 mM (diluted 12x). One mL of this solution, which contains 75 µg of total plasmid DNA, was fed to the CaptoTM adhere column, equilibrated to the same NaCl concentration (41.5% buffer B, 69 mS/cm). Runs were performed at 1 mL/min, unbound material was washed with 2 CV of 41.5% B (830 mM, 69 mS/cm) and elution was accomplished using two steps with increasing salt concentration, the first at 46% B (920 mM, 75 mS/cm) and the second at 100% B (2 M, 140 mS/cm). The chromatogram obtained is characterized by three, baseline-separated peaks, one for each elution step (Fig. 4 A). An agarose gel electrophoresis analysis of the corresponding fractions (Fig. 4 B) confirms that: i) the first peak, at 41.5 %B, with a retention volume of 3.2 mL, contains oc pDNA and pDNA multimers (lanes 2-4), ii) the second peak, at 46 %B, with a retention volume of 18.6 mL, contains mainly sc pDNA (lanes 13-15) and that iii) RNA is the major constituent of the last peak at 100 %B, with a retention volume of 35.5 mL (lane 25).
13
Fig. 4. Multimodal chromatography purification of sc pDNA from a feed stream containing oc pDNA, sc pDNA and RNA. A) Chromatogram illustrative of sc pDNA purification. 1 mL of concentrated pDNA solution (lane 4, Fig. 3), diluted 12x (75 g pDNA) and pre-conditioned to set NaCl at 830 mM, was injected into a CaptoTM adhere column, pre-equilibrated with 830 mM NaCl buffer (41.5% buffer B, 69 mS/cm). Unbound material was washed with 2 CV of 41.5% B, and stepwise elution was performed with 3 CV of 46% B ( 75 mS/cm) and 3 CV of 100% B
14
( 140 mS/cm). Numbers over peaks correspond to collected fractions. Continuous line: absorbance at 254 nm; dashed line: conductivity (mS/cm); dotted line: percentage of buffer B (%B). B) Agarose gel electrophoresis analysis of fractions collected during the chromatographic run. Lane L corresponds to the molecular weight marker and lanes F (2 L) and F’ (3 L) to the column feed. Numbered lanes correspond to the fractions collected during the chromatographic run (10 L of sample for lanes 2 to 15; 30 L of sample for lane 25).
The difference between the retention time of the three nucleic acid species (oc, sc and RNA) can be explained based on their charge density and hydrophobic character. At the working pH of 8, all nucleic acids are negatively charged and, thus, will bind to the strong anion-exchanger CaptoTM adhere ligand if the appropriate amount of salt is used in the washing step. Since sc pDNA is more compact as a result of supercoiling, it possesses a higher charge density than oc pDNA [33]. This favours stronger interactions with the charged nitrogen atom of the ligand, allowing sc pDNA to remain bound at the NaCl concentration used to equilibrate the column, while the oc isoform is eluted. Furthermore, the deformations induced by the torsional strain inherent to sc pDNA molecules lead to a higher exposure of bases relative to oc isoform [33]. Therefore, stronger hydrophobic interactions of sc pDNA molecules with the phenyl group of the ligand could also favour the retention of this isoform. The single-stranded nature of RNA and, consequently, the higher exposure of its base groups, turns its hydrophobic interaction with the resin even stronger than the one that sc pDNA can establish, which explains why this specie is the last to elute [33, 15].
The reproducibility of the multimodal chromatographic step was evaluated by running feed streams from three different plasmid batches. An analysis of the
15
chromatograms obtained and of the agarose gel electrophoresis of the fractions collected confirms that the method is robust and able to consistently deliver purified sc pDNA that is free from oc pDNA and RNA (see supplementary figure S1).
Attempts to purify the plasmid by moving directly from isopropanol precipitation to multimodal chromatography were made, to check whether the ammonium acetate and PEG precipitation steps (Fig. 1) could be by-passed. A BCA analysis reveals that the protein content in the column feed is significantly higher if the ammonium acetate and PEG precipitation steps are omitted from the process (198 g/mL versus 22 g/mL). A chromatography run performed with this feed shows that while a significant degree of separation is still achieved, sc plasmid fractions isolated from the column contain traces of impurities, in particular RNA (see supplementary figure S2). Furthermore, the protein content in the sc pDNA pooled fractions increased from 4 g/mL to 41 g/mL. Additionally, the higher RNA and protein load in the feed produced with the shorter process is expected to compromise some of the capacity of the resin to bind sc plasmid DNA and have an impact resin lifetime. Thus, the tandem precipitation operations in the process are crucial to guarantee an adequate purification.
3.3. Analysis of sc pDNA-rich fractions HIC-HPLC analysis (see section 2.6.2) of all fractions collected during the chromatographic run showed that ~70% of the total sc pDNA loaded in the column is recovered in fractions 13 and 14. These fractions were further
16
analysed by electrophoresis, real-time PCR and BCA in order to quantitatively evaluate the quality of the product. The results presented next correspond to average values obtained for samples collected during replica chromatographic runs. Densitometry analysis of the bands in an agarose gel electrophoresis (lanes 13 and 14 in Fig.4B) reveals that, from a feed with an isoform distribution of 49.65.0% sc pDNA to 50.45.0% of oc pDNA, it is possible to recover fractions with 92.02.3% (fraction 13) and 93.05.5% (fraction 14) of sc pDNA. The remaining material in these fractions corresponds to remnants of oc pDNA that were not eluted in the first step. To evaluate the presence of impurities, the sc pDNA-rich fractions 13 and 14 were pooled together and analysed by real time PCR (gDNA quantitation) and BCA assay (protein quantitation). The average results for two runs show the presence of 1.30.3% gDNA (µg gDNA/µg sc pDNA) and 4.971.34 g of host cell proteins per mL of pooled fraction. These levels of impurities are within specifications required for phase I clinical trials [33]; nevertheless, a final step could still be used to reduce even more gDNA and protein content.
3.4. Loading studies In order to evaluate the effect of the loaded amount of plasmid on the purification and recovery of sc pDNA, chromatographic runs with feeds containing between 45 and 265 g of total plasmid DNA (sc + oc) were performed,
keeping
the
same
elution
scheme.
The
corresponding
chromatograms (Fig. 5A) were essentially identical to the one obtained for the case of the 75 µg loading described above (Fig. 4). Furthermore, an agarose gel electrophoresis analysis confirmed that the multimodal column was still able
17
to separate the plasmid isoforms at these higher loadings, yielding fractions with more than 80% of sc plasmid DNA (check lanes marked 13 in Fig. 5B). BCA and real time PCR analysis of the sc-rich fractions collected for all loadings revealed that protein content is below the limit of detection and gDNA content below 0.5% (µg gDNA/µg sc pDNA). However, in the chromatograms obtained at the two higher loadings (130 and 225 µg total pDNA) it is possible to observe a slight inflection on the flowthrough peak. Gel electrophoresis analysis of the corresponding fraction confirms that at these loadings there is a loss of sc pDNA on the flowthrough (check lanes 3 in Fig. 5B), which had not been previously observed for loadings lower than 90 µg total pDNA.
18
Fig. 5 Loading effect on the purification of sc pDNA by multimodal chromatography. A) Chromatogram illustrative of sc pDNA purification. 1 mL of concentrated pDNA solution (lanes F), diluted according to the required load of total pDNA (45 g in blue, 90 g in orange, 130 g in grey and 265 g in yellow) and pre-conditioned to set NaCl to 830 mM, was injected into a CaptoTM adhere column, pre-equilibrated with 830 mM NaCl buffer (41.5% buffer B, 69 mS/cm). Unbound material was washed with 2 CV of 41.5% B, and stepwise elution was performed with 3 CV of 46% B ( 75 mS/cm) and 3 CV of 100% B ( 140 mS/cm). Numbers over peaks correspond to collected fractions. Continuous line: absorbance at 254 nm; dashed line: conductivity (mS/cm); dotted line: percentage of buffer B (%B). B) Agarose gel electrophoresis analysis of fractions collected during the chromatographic runs. Lane L corresponds to the molecular weight marker and lanes F (2 L) to the column feed. Numbered lanes correspond to the fractions collected during the chromatographic run (10 L of sample for lanes 2 to 15; 30 L of sample for lane 25). Gels are colour-numbered according to the corresponding chromatographic run.
HIC-HPLC analysis was performed to determine the amount of sc pDNA recovered as a function of loading. The results indicate that the column capacity for sc pDNA under operational conditions is approximately 40 g (Fig. 6). Although it is possible to recover a higher mass of ~55 g sc pDNA at a loading
19
of 225 g total pDNA (sc+oc), the decrease in yield from 100% to ~60% shows that there is no advantage in increasing column loadings past 40 g sc pDNA.
Fig. 6 Effect of the loaded amount of plasmid on the recovery of sc pDNA purified by multimodal chromatography. Sc plasmid fractions recovered from chromatographic runs performed with feeds containing between 45 and 265 g of total plasmid DNA (sc + oc) were analysed by HICHPLC. Black line: mass of sc pDNA recovered (g). Grey line: sc pDNA yield (%). Experimental conditions as described in the legend of figure 5.
3.5. Downstream process evaluation In order to determine the overall downstream process yield, HIC-HPLC analysis was performed on samples collected during the different phases of the downstream process (see Fig. 2). For the chromatographic step, all fractions recovered from two runs performed with feeds from the same batch were quantified and used to estimate average recovery yields of total pDNA (oc + sc). The results in Table 1 show that almost half of the 1686 µg of total pDNA 20
recovered after alkaline lysis of 200 mL of E. coli cells (OD600nm 19) is lost during primary purification and intermediate recovery and that the feed stream prior to chromatography contains 951.6 µg of pDNA. Moreover, densitometry analysis of lane F in Fig. 4 indicates that before the chromatographic step, approximately half of the total plasmid is in its relaxed, oc form. This is a strong indication that further improvements on the primary purification and intermediate recovery steps are necessary to maximize the amount of sc pDNA just prior to chromatography. After multimodal chromatography, 790.2 g of pDNA were recovered, of which 376.2 g correspond to oc pDNA and 414 g to sc pDNA. HIC-HPLC of all the collected fractions reveals that 90% of oc was recovered on fraction 3 and 70% of sc on fractions 13 and 14. This translates into an 83% yield of total (oc + sc) pDNA recovered during the last purification stage. Overall, and considering all the losses throughout the process, a global yield of 47% was obtained.
Table 1. Step and overall pDNA downstream processing yields. The process started with 0.20 L of E. coli broth (OD600nm ≈ 19). Samples were collected throughout and analysed by HIC-HPLC to determine total pDNA (oc + sc) amounts. Process step
pDNAtotal (g)
Step yield (%)
Global yield (%)
Alkaline lysis
1686
Isopropanol precipitation
1420
84
84
Ammonium acetate precipitation
1146
81
68
PEG-8000 precipitation
951.6
83
56
790.2 (414 sc* +376.2 oc)
83
47
Multimodal chromatography * 70% in fractions 13 and 14
21
3.6. Process versatility The ability of the process to handle other plasmids was tested by resorting to a smaller (pUC18, 2,686 bp) and a larger (pCEP4, 10,410 bp) plasmid. After cell harvesting, the same steps of primary purification and intermediate recovery were performed (Fig. 2). Following PEG-8000 precipitation, the pellet obtained was resuspended in 2 mL TE buffer and diluted 12 times with a 2 M NaCl in TE buffer solution to set NaCl concentration at 830 mM. One mL of sample was fed into the chromatographic column and elution was performed using the same stepwise scheme as before (Fig. 7). The chromatographic profiles obtained for pUC18 (Fig. 7A) and pCEP4 (Fig. 7B) were similar and almost identical to the ones obtained with pVAX1-GFP (Fig. 4A, 5A and Fig. S1). The separation of the isoforms and RNA was confirmed by agarose gel electrophoresis (Fig. 7), with oc pDNA eluting upon washing at 830 mM NaCl, sc pDNA at 920 mM NaCl and RNA during the last gradient step (2 M NaCl).
22
23
Fig. 7. Effect of plasmid size on multimodal chromatography purification. Chromatograms are shown for the purification of A) a 2.7 kb (pUC18) plasmid and B) a 10.4 kb plasmid (pCEP4) from a feed stream containing oc pDNA, sc pDNA and RNA. 1 mL of PEG-8000 precipitated sample, diluted 12x in 830 mM NaCl in 10 mM TE solution were injected into a Capto
TM
adhere
column, pre-equilibrated with 830 mM NaCl buffer (41.5% buffer B, 69 mS/cm). Unbound material was washed with 2 CV of 41.5% B, and stepwise elution was performed with 3 CV of 46% B ( 75 mS/cm) and 3 CV of 100% B ( 140 mS/cm). Numbers over peaks correspond to collected fractions. Continuous line: absorbance at 254 nm; dashed line: conductivity (mS/cm); dotted line: percentage of buffer B (%B). Agarose gel electrophoresis analysis of fractions collected during the chromatographic purification are shown for the C) 2.7 kb and D) 10.4 kb plasmids.
4. Conclusion A new process was established based on multimodal chromatography that purifies sc pDNA vectors from key impurities such as RNA, gDNA and host cell proteins. The process starts with the bacterial cell culture of a pDNA-producing E. coli strain transformed with the target pDNA vector. Following harvest, cells are subjected to alkaline lysis, isopropanol precipitation, ammonium acetate precipitation and PEG-8000 precipitation. Precipitation steps concentrate pDNA, while reducing impurities such as RNA and host cell proteins. Isolation and purification of sc pDNA from oc pDNA and RNA is finally performed via multimodal chromatography with a N-benzyl-N-methyl ethanolamine ligand by modulating charge and hydrophobic interactions with a series of elution steps with increasing NaCl concentration. Primary isolation and intermediate recovery account
for
44%
of
pDNA
losses.
Final
purification
by
multimodal
chromatography provides baseline separation of isoforms and yields sc-rich fractions (> 90%) that are virtually free from RNA and have levels of gDNA
24
(1.30.3 % µg gDNA/µg sc pDNA) and protein (4.971.34 g/mL) impurities within specifications. The process is reproducible and performs similarly with differently sized plasmids (2,686 bp, 3,696 bp and 10,410 bp). Multimodal chromatography step offers advantages over HIC, one of the preferred chromatographic modalities used to separate plasmid isoforms. Not only smaller amounts of salt are used for elution, but most notably, NaCl has a lower environmental impact than the ammonium sulphate typically used in HIC [14, 15, 17].
Acknowledgements Funding received by iBB-Institute for Bioengineering and Biosciences from FCT-Portuguese
Foundation
for
Science
and
Technology
(grant
UID/BIO/04565/2013) and from Programa Operacional Regional de Lisboa 2020 (Project N. 007317) is acknowledged.
25
References [1]
Meyer, F., M. Miner (2001). Gene Therapy: Progress and Challenges. Cell. Mol. Biol., 47(8), 1277-1294.
[2]
Kay, M. A. (2011). State-of-the-art gene-based therapies: the road ahead. Nat. Rev. Genet., 12, 316-328.
[3]
Gardlík, R., Pálffy, R., Hodosy, J., Lukács, J., Turňa, J., Celec, P. (2005). Vectors and delivery systems in gene therapy. Med. Sci. Monit., 11(4), 110-121.
[4]
Ginn, S. L., Alexander, I. E., Edelstein, M. L., Abedi, M. R., Wixon, J. (2013). Gene therapy clinical trials worldwide to 2012 - an update. J. Gene Med., 15, 65-77.
[5]
Niidome, T., Huang, L. (2002). Gene Therapy Progress and Prospects: Nonviral vectors. Gene Ther., 9(24), 1647-1652.
[6]
Remaut, K., Sanders, N. N., Fayazpour, F., Demeester, J., De Smedt, S. C. (2006). Influence of plasmid DNA topology on the transfection properties of DOTAP/DOPE lipoplexes. J. Control. Release, 15, 335-343.
[7]
Mairhofer, J., Grabherr, R. (2008). Rational vector design for efficient nonviral gene delivery: challenges facing the use of plasmid DNA. Mol. Biotechnol., 39, 97-104.
[8]
U. S. Food and Drug Administration. (2007). Guidance for Industry: Considerations for Plasmid DNA Vaccines for Infectious Disease Indications.
[9]
Cai, Y., Rodriguez, S., Hebel H. (2009). "DNA vaccine manufacture: scale and quality." Expert Rev Vaccines, 8(9), 1277-1291.
26
[10] Ghanem, A., Healey, R., Adly, F. G. (2013). Current trends in separation of plasmid DNA vaccines: a review. Anal. Chim. Acta, 760, 1-15. [11] Diogo, M. M., Queiroz, J. A., Prazeres, D. M. F. (2005). Chromatography of plasmid DNA. J. Chromatogr. A, 1069, 3-22. [12] Horn, N. A., Meek, J. A., Budahazi, G., Marquet, M. (1995). Cancer gene therapy using plasmid DNA: purification of DNA for human clinical trials. Hum. Gene Ther., 6, 565-573. [13] Zhang, S., Krivosheyeva, A., Nochumson, S. (2003). Large-scale capture and partial purification of plasmid DNA using anion-exchange membrane capsules. Biotechnol. Appl. Biochem., 37, 245-249. [14] Eon-Duval, A., Burke, G. (2004) Purification of pharmaceutical-grade plasmid DNA by anion-exchange chromatography in an RNase-free process. J. Chromatogr. B., 804, 327-335. [15] Diogo, M.M., Queiroz, J.A., Monteiro, G.A., Martins, S.A.M., Ferreira, G.N.M., Prazeres, D.M.F. (2000). Purification of a cystic fibrosis plasmid vector for gene therapy using hydrophobic interaction chromatography. Biotechnology and Bioengineering. 68:576-583. [16] Urthaler, J., Buchinger, W., Necina, R. (2005) Industrial scale cGMP purification of pharmaceutical-grade plasmid DNA. Chem. Eng. Technol., 28, 1408-1420. [17] Bo, H., Wang, J., Chen, Q., Shen, H., Wu, F., Shao, H., Huang, S. (2013). Using
a
single
hydrophobic-interaction
chromatography
to
purify
pharmaceutical-grade supercoiled plasmid DNA from other isoforms. Pharm. Biol., 51(1), 42-49.
27
[18] Freitas, S. S., Santos, J. A. L., Prazeres, D. M. F. (2009). Plasmid purification by hydrophobic interaction chromatography using sodium citrate in the mobile phase. Sep. Purif. Technol., 65, pp. 95-104. [19] Schluep, T., Cooney, C. L. (1998). Purification of plasmid DNA by triplex affinity interactions. Nucleic Acids Res. 26, 4524-4528. [20] Yang, Y., Geng, X. (2011). Mixed-mode chromatography and its application to biopolymers. J. Chromatogr. A, 1218, 8813-8825. [21] Pinto, I. F., Aires-Barros, M. R., Azevedo, A. M. chromatography:
debottlenecking
the
(2015). Multimodal
downstream
processing
of
monoclonal antibodies. Pharm. Bioprocess., 3, 249-261. [22] Gomes, A. G., Azevedo, A. M., Aires-Barros, M. R., Prazeres, D. M. F. (2010) Clearance of host cell impurities from plasmid-containing lysates by boronate adsorption. J. Chromatogr. A., 1217, 2262-2266. [23] Černigoj, U., Vidic, U., Barut, M., Podgornik, A., Peterka, M., & Štrancar, A. (2013). A multimodal histamine ligand for chromatographic purification of plasmid DNA. J. Chromatogr. A, 1281, 87-93 [24] Matos, T.,
ueiro , J. A., & B lo , L. (2014). Plasmid DNA purification
using a multimodal chromatography resin. J. Mol. Recognit., 27, 184-189. [25] Silva-Santos, A. R., Alves, C. P. A., Prazeres, D. M. F., Azevedo, A. M. (2016).
Separation
of
plasmid
DNA
topoisomers
by
multimodal
chromatography. Anal. Biochem, 503, 68-70. [26] Gonçalves, G. A., Prazeres, D. M., Monteiro, G. A., Prather, K. L. (2013). De novo creation of MG1655-derived E. coli strains specifically designed for plasmid DNA production. Appl Microbiol Biotechnol, 97(2), 611-620.
28
[27] Azzoni, A. R., Ribeiro, S. C., Monteiro, G. A., Prazeres, D. M. F. (2007). The impact of polyadenylation signals on plasmid nuclease-resistance and transgene expression. J. Gene Med., 9, 392-402. [28] Listner, K., Bentley, L. K., Chartrain, M. (2006). A simple method for the production of plasmid DNA in bioreactors. Methods Mol. Med., 127, 295309. [29] Birnboim, H. C., Doly, J. (1979). A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res., 7, 1513-1523. [30] Schneider, C. A., Rasband, W. S., Eliceiri, K. W. (2012). NIH Image to ImageJ: 25 years ofimage analysis. Nat. Methods, 9, 671–675. [31] Alves, P. A., Duarte, S. O. D., Monteiro, G. A., Prazeres, D. M. F. (2016). Use of an E. coli pgi Knockout Strain as a Plasmid Producer. BioPharm International, 28(2), 38-42. [32] Carapuça, E., Azzoni, A., Prazeres, D.M.F., Monteiro, G.A., Mergulhão, F. (2007). Time-course determination of plasmid content in eukaryotic and prokaryotic cells using real-time PCR. Mol. Biotechnol., 37, 120–126. [33] Prazeres, D. M. F. (2011). Plasmid Biopharmaceuticals: Basics, Applications, and Manufacturing. John Wiley and Sons, Inc. [34] Quaak, S. G. L., van den Berg, J. H., Toebes, M., et al. (2008). GMP production of pDERMATT for vaccination against melanoma in a phase I clinical trial. Eur. J. Pharm. Biopharm., 70(2), 429-438.
29
Graphical abstract
30
A process for supercoiled plasmid DNA purification based on multimodal chromatography
A. Rita Silva-Santos, Cláudia P. A. Alves, Duarte Miguel F. Prazeres* and Ana M. Azevedo*
iBB
–
Institute
for
Bioengineering
and
Biosciences,
Department
of
Bioengineering, Instituto Superior Técnico, Universidade de Lisboa, Av. Rovisco Pais, 1049-001 Lisboa, Portugal
* Corresponding authors. E-mail address: [email protected] (D.M.F. Prazeres) E-mail address: [email protected] (A.M. Azevedo)
Highlights
Plasmid DNA is isolated from E. coli by alkaline lysis and tandem precipitation
Supercoiled pDNA is purified by multimodal chromatography with CaptoTM adhere resin
2-step elution with NaCl is used to remove open circular pDNA and RNA from sc pDNA
Sc pDNA with homogeneity higher than 90% and virtually free from RNA is obtained
31
S1383-5866(16)32242-0 http://dx.doi.org/10.1016/j.seppur.2017.03.042 SEPPUR 13628
To appear in:
Separation and Purification Technology
Received Date: Revised Date: Accepted Date:
3 November 2016 14 March 2017 22 March 2017
Please cite this article as: A.R. Silva-Santos, C.P.A. Alves, D.M.F. Prazeres, A.M. Azevedo, A process for supercoiled plasmid DNA purification based on multimodal chromatography, Separation and Purification Technology (2017), doi: http://dx.doi.org/10.1016/j.seppur.2017.03.042
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
A process for supercoiled plasmid DNA purification based on multimodal chromatography
A. Rita Silva-Santos, Cláudia P. A. Alves, Duarte Miguel F. Prazeres* and Ana M. Azevedo*
iBB
–
Institute
for
Bioengineering
and
Biosciences,
Department
of
Bioengineering, Instituto Superior Técnico, Universidade de Lisboa, Av. Rovisco Pais, 1049-001 Lisboa, Portugal
* Corresponding authors. E-mail address: [email protected] (D.M.F. Prazeres) E-mail address: [email protected] (A.M. Azevedo)
Abstract Non-viral gene therapy and DNA vaccination currently hold great potential for treatment and prevention of genetic and acquired diseases. The large-scale manufacturing of plasmid DNA (pDNA) vectors, and the downstream processing in particular, is one of the key aspects of process development required to move non-viral gene therapy to the clinic. To address the problematic isolation and purification of pDNA molecules, an alternative and cost effective process based on multimodal chromatography was developed. In particular, the possibility of using a cationic multimodal ligand (CaptoTM adhere) to remove RNA impurities from E. coli pre-purified lysates and to isolate supercoiled (sc) pDNA isoforms from open circular (oc) pDNA was explored. The process involves E. coli
1
culture, cell harvesting and alkaline lysis followed by isopropanol, ammonium acetate and PEG-8000 precipitation. Finally, sc pDNA is isolated by multimodal chromatography using a step-wise NaCl elution method that includes washing of unbound oc pDNA at 830 mM NaCl, sc pDNA elution at 920 mM and removal of RNA at 2 M. The method provided baseline separation of isoforms and yielded sc-rich fractions (> 90%) that are virtually free from RNA and have levels of gDNA (1.30.3 % µg gDNA/µg sc pDNA) and protein (4.971.34 µg/mL) impurities within specifications. Approximately 376 g of sc pDNA were obtained from 200 mL of bacterial cell culture (OD 600nm 19). The process was reproducible and performed similarly with differently sized plasmids (2,686 bp, 3,696 bp and 10,410 bp).
Keywords: multimodal chromatography; plasmid DNA; supercoiling: plasmid isoforms; separation.
1. Introduction Gene therapy is defined as the in vivo or ex vivo delivery of new genetic material into the somatic cells of a patient, through the administration of gene delivery vectors, in order to promote a therapeutic effect either by gene addition, correction or knockout [1, 2]. These delivery vectors have to be able to shuttle genes into the nucleus of target cells, protect the genetic material from degradation and ensure the transcription of the gene of interest in the cell. They have also to guarantee a safe and efficient gene transfer and stable and sufficient gene expression [3].
2
The delivery vectors used in this context can be divided into two groups – viral and non-viral. Although viral vectors are still the most used on clinical trials worldwide [4], concerns regarding their safety gave rise to the use of vectors of non-viral origin, namely plasmid DNA (pDNA) [3, 5]. Despite presenting lower transfection efficiency, the interest in pDNA vectors has been increasing due to their low toxicity and immunogenicity in transfected hosts, almost unlimited capacity for the gene of interest and easy production [3]. A key aspect in the production of pDNA vectors is related with the structural conformation – linear, open circular (oc) and supercoiled (sc) – of the final plasmid product. Several studies have established the sc isoform as the most physiologically active conformation [6, 7]. As a consequence, guidelines issued by regulatory agencies, including the Food and Drug Administration (FDA), recommend that therapeutic pDNA products used in clinical trials should present a minimum homogeneity of 80% in sc isoform [8]. Several improvements have been made over the years on the large scale manufacturing of pDNA vectors, with a special focus on the downstream processing [9, 10] . The initial stages of the downstream are designed to isolate pDNA from producer Escherichia coli cells, remove large amounts of RNA and proteins and reduce volume. Although streams entering the final purification stage are substantially purified and enriched in pDNA, small amounts of E. coliderived impurities and oc pDNA variants must be removed to obtain a final product with adequate quality. Chromatography has been used extensively at this stage to purify pDNA and/or to isolate the therapeutically valuable sc isoform from the oc counterpart [11]. Examples of the chromatographic modalities used include size exclusion [12], anion-exchange [13, 14],
3
hydrophobic interaction [15, 16, 17, 18], and affinity [19]. Multimodal chromatography has also been used for pDNA purification. The key goal here is to explore at least two different types of interactions between solutes and the stationary phase in the same chromatographic step [20, 21]. For example, phenyl-boronate ligands were used to adsorb cis-diol-bearing species (RNA, lipopolysaccharides-LPS) via the establishment of covalent bonds, and cis-diolfree proteins and genomic DNA (gDNA) fragments via charge transfer interactions, while leaving most pDNA in solution [22]. Černigoj et al. [23] were able to separate pDNA isoforms using a histamine ligand in a monolith chromatographic support, but this requires the use of a very high concentration (3.0 M) of ammonium sulfate in the mobile phase. Matos et al. [24] used an NaCl
elution
scheme
with
the
multimodal
ligand
N-benzyl-N-methyl
ethanolamine (CaptoTM adhere) ligand (Fig. 1) to purify pDNA from RNA in crude E. coli DH5 extracts, but failed to separate isoforms. Notwithstanding, Silva-Santos et al. [25] reported that a CaptoTM adhere column is indeed able to separate pDNA isoforms in pre-purified pDNA containing samples, provided that an appropriate NaCl elution scheme is used. More specifically, oc and sc isoforms were eluted sequentially with NaCl steps of 844 mM (72 mS/cm) and 892 mM (75 mS/cm).
4
Fig. 1. The CaptoTM adhere ligand, N-benzyl-N-methyl ethanolamine, allows the establishment of three different types of interactions: anion- exchange (charged nitrogen), hydrogen bonding (hydroxyls) and hydrophobic (phenyl ring).
In this work, an innovative, efficient and reproducible process was developed where the CaptoTM adhere multimodal ligand is now used to isolate sc isoforms from pre-purified E. coli lysates. The total plasmid recovered after each step was determined through quantification by HIC-HPLC. The quality of the final product was also evaluated, in terms of homogeneity and presence of host impurities, namely genomic DNA (gDNA) and proteins. The reproducibility and robustness of the method was demonstrated by purifying three plasmids with different sizes, pUC18 (2,687 bp), pVAX1-GFP (3,697 bp) and pCEP4 (10,410 bp).
2. Materials and Methods 2.1. Materials CaptoTM adhere bulk was obtained from GE Healthcare (Uppsala, Sweden). All salts used were of analytical grade. 2.2. Bacterial cell growth and plasmid production 2.2.1. pVAX1-GFP An inoculum was prepared from frozen GALG20 cells [26] harbouring pVAX1GFP (3,696 bp) [27] in 15 mL conical centrifuge tubes containing 5 mL of LB medium (NZYTech, Lisbon, Portugal) supplemented with 30 g/mL kanamycin 5
(Amresco, Solon, OH). After overnight incubation at 37 ºC and 250 rpm, cells were used to inoculate 250 mL baffled shake flasks containing 50 mL of rich cultivation medium (10 g/L bacto peptone, 10 g/L yeast extract, 3 g/L ammonium sulphate, 3.5 g/L potassium hydrogen phosphate, 3.5 g/L potassium dihydrogen phosphate, 2 g/L magnesium sulphate, 200 mg/L thiamine, 20 g/L glucose, and 1 mL/L of a trace element solution [28]) supplemented with 30 g/mL kanamycin, pH 7.1, at an optical density at 600 nm (OD600nm) of approximately 0.1. Cells were incubated at 37 ºC, 250 rpm and harvested after 8 hours by centrifugation (15 min at 6,000 g, 4ºC). 2.2.2. pUC18 and pCEP4 E. coli DH5 transformed with either pUC18 (2,687 bp) or pCEP4 (10,410 bp) was grown overnight in 100 mL shake flasks containing 30 mL LB medium (NZYTech, Lisbon, Portugal) supplemented with 100 g/mL ampicillin (SigmaAldrich, St. Louis, MO) at 37 ºC and 250 rpm. The appropriate volume to inoculate 250 mL of LB medium supplemented with 100 g/mL ampicillin at pH 7.3, at an OD600nm of 0.1, was centrifuged and cells were used to inoculate 2 L shake flasks. Cells were incubated at 37 ºC, 250 rpm and harvested after 8 hours by centrifugation (15 min at 6,000 g, 4ºC). 2.3. Primary purification and intermediate recovery The alkaline lysis method used was based on the protocol described by Birnboim et al. [29] and the intermediate recovery process was performed based on Horn et al. [12]. Cells harvested at the end of cell culture were resuspended in a 50 mM glucose, 25 mM Tris-HCl, 10 mM EDTA, pH 8, buffer up to an OD600nm of 60 and mixed with a buffer composed of 0.2 M NaOH, 1% (w/v) SDS at a 1:1 volume ratio. The mixture was gently homogenized and
6
left to rest at room temperature for 10 minutes, after which a volume of 5 M acetate buffer with 3 M potassium (pH 5) equal to half of the mixture volume was added. After gentle homogenization, the neutralized lysate was placed on ice and left to rest for 10 minutes. A clarified lysate was then obtained by centrifugation (2 times at 18,250 g and 4 ºC for 30 min) and nucleic acids were precipitated with 0.7% (v/v) isopropanol at -20 ºC for 2 h. After centrifugation (30 min at 18,250 g, 4 ºC), the supernatant was discarded and the pellet was left to dry overnight at room temperature. Following pellet resuspension in TE (10 mM Tris-HCl, 1 mM EDTA, pH 8), the pDNA rich solution was conditioned to 2.5 M of ammonium acetate by dissolution of the appropriate amount of salt. Following homogenization, the solution was left to rest for 15 min on ice and then centrifuged (30 min at 15,000 g, 4ºC). The supernatant was recovered and 30% PEG-8000 in 1.6 M NaCl was added to achieve a final concentration of 10% PEG-8000. In order to complete precipitation of pDNA, the mixture was left to rest overnight at 4ºC and centrifuged (30 min at 15,000 g, 4ºC). After discarding the supernatant, the pellet containing the nucleic acids was resuspended in 1 mL TE buffer. 2.4. Multimodal chromatography The plasmid-containing solution obtained in the previous section was conditioned by dilution (1:12) with a buffer containing 830 mM sodium chloride in 10 mM TE, prior to column loading. The sc pDNA was then purified by multimodal chromatography using a Tricorn 10/50 column (GE Healthcare) packed with 5 mL of CaptoTM adhere resin connected to an ÄKTApurifier100 system (GE Healthcare). The mobile phase consisted of mixtures of buffer A (10 mM Tris-HCl, 1 mM EDTA, pH 8) and buffer B (2 M NaCl in 10 mM Tris-
7
HCl, 1 mM EDTA, pH 8). The absorbance of the eluate was continuously measured at 254 nm by a UV detector positioned after the column outlet and the system was operated at 1 mL/min. The column was equilibrated with 3 column volumes (CV) of 41.5% buffer B ( 69 mS/cm). Then, 1 mL of the conditioned sample was injected into the column by washing the loop with 3 mL of 41.5% buffer B. All unbound material was washed out of the column with 2 CV of 41.5% buffer B. Elution steps were then performed with 3 CV of 46% B ( 75 mS/cm) and 3 CV of 100% B ( 140 mS/cm). The eluate was collected (fractions of 1.5 mL) during the course of the chromatographic run in 2 mL eppendorf tubes with a fraction collector. 2.5. Micro-dialysis For desalting, 200 L of peak fractions were collected into 0.5 mL eppendorf tubes. The tube caps were removed and the top of each tube was covered with a OrDial D14 dialysis membrane with a thickness of 23 m and 12-14 kDa molecular weight cut-off (Orange Scientific, Braine-l’Alleud, Belgium) that was kept in place with a rubber band. The tubes were inverted, assuring that all the solution was in contact with the membrane, and placed floating on a beaker with 1 L of 10 mM Tris-HCl, 1 mM EDTA, pH 8. The dialysis was performed overnight at 4ºC with agitation, after which desalted samples were analysed by gel electrophoresis. 2.6. Analytical Techniques 2.6.1. Gel electrophoresis Agarose gels were prepared with 1% (w/v) agarose (Fisher Scientific, Waltham, MA) in TAE buffer (40 mM Tris base, 20 mM acetic acid and 1 mM EDTA, pH 8) and loaded with samples mixed with 6x loading buffer (40%(w/v) sucrose,
8
0.25% (w/v) bromophenol blue), using NZYDNA ladder III (NZYTech, Lisbon, Portugal) as molecular weight marker. Gel electrophoresis was performed in TAE buffer at 100 V for 60 minutes and 120 V for 90 minutes for small and larger gels, respectively. Gels were stained in an ethidium bromide solution (0.4 g/mL) and images were obtained with an Eagle Eye II gel documentation system (Stratagene). The percentage of sc pDNA on the purified fractions (eluted at 46% B; 75 mS/cm) was determined by densitometry analysis of the band intensities on the agarose gel, using the ImageJ software [30].
2.6.2. Plasmid quantification Samples collected during the course of the downstream process (see Fig. 2) were analysed by analytical hydrophobic interaction chromatography (HIC)HPLC to quantify pDNA, following the protocol described in [31]. Briefly, a 1.7 mL bed volume (SOURCE 15PHE 4.6/100 PE, GE Healthcare) connected to an ÄKTApurifier10 system (GE Healthcare), was equilibrated at 1 mL/ min with 1.5 M ammonium sulfate in 10 mM Tris-HCl, pH 8. Following column loading with 50 l of sample under analysis (e.g. collected fractions), elution was performed in a step mode with 10 mM Tris-HCl, pH 8. Plasmid quantification was performed using a calibration curve prepared in a concentration range from 0 to 100 g/mL.
9
Fig. 2. Process used for the production and purification of pDNA. HIC-HPLC analysis was performed on samples taken at the indicated points.
2.6.3. Real-time PCR The presence of gDNA on purified sc pDNA samples was evaluated by performing a “hot-start” SYBR Green I-based quantitative real-time PCR using the Roche LightCycler, as described by Carapuça et al. [32]. Reactions were prepared with 4 L of relevant fractions and using a final concentration of 0.5 M
of
sense
(ACACGGTCCAGAACTCCTACG)
and
antisense
(GCCGGTGCTTCTTCTGCGGGTAACGTCA) primers targeting a 182-bp region of 16S rRNA gene located in the bacterial genome. The PCR program used consisted of 10 min at 95 °C followed by 40 cycles of amplification (10 s at 95°C, 5 s at 55 °C, 7 s at 72 °C). Values of the threshold cycle (CT) were calculated, using the second derivative method, by the LightCycler software version 4.1 (Roche Diagnostics). 2.6.4. Protein Quantification The amount of proteins present on purified sc pDNA samples was determined using the bicinchoninic acid (BCA) protein assay reagent kit from Thermo Scientific (Waltham, MA) following the manufacturer’s test tube procedure. Bovine serum albumin (BSA) standards were prepared by serial dilution of a
10
2 mg/mL albumin standard in a concentration range from 0 to 250 g/mL. 100 L of each standard and sample replicate were added to 2 mL eppendorfs, followed by the addition and mixing of 2 mL of working reagent (50 parts of reagent A to 1 part of reagent B). Then, the tubes were incubated for 30 min at 60 ºC, after which they were cooled down at room temperature and the absorbance at 562 nm of all samples in analysis was measured within 10 min.
3. Results and Discussion A pDNA manufacturing process was devised that involves E. coli culture, cell harvesting and alkaline lysis followed by isopropanol, ammonium acetate and PEG-8000 precipitation, and finally, multimodal chromatography (Fig. 2).
3.1. Primary purification and intermediate recovery GALG20 E. coli cells were transformed with plasmid pVAX1-GFP and grow in a rich cultivation medium for 8 h until reaching an OD600nm 19. Cells are then harvested and disrupted by alkaline lysis to release the intracellular contents, namely pDNA and RNA and to denature gDNA and cell host proteins (lane 1, Fig. 3). The nucleic acids present in the clarified lysate were then concentrated by isopropanol precipitation and resuspension in TE buffer (lane 2, Fig. 3). With this step, the total volume of the pDNA-containing solution was reduced 20-fold. RNA and protein impurities in this solution were precipitated with ammonium acetate and the pDNA-rich supernatant was recovered (lane 3, Fig. 3). Finally, a precipitation with 10% (w/v) PEG-8000/0.53 M NaCl was performed in order to (i) concentrate pDNA, (ii) reduce the RNA load and (iii) remove the ammonium acetate salt added in the previous step. After centrifugation, the pDNA-rich
11
pellet was resuspended in TE buffer (lane 4, Fig. 3) resulting in an 8-fold solution volume reduction on the last step of intermediate recovery.
Fig. 3. Primary purification and intermediate recovery of pDNA. Agarose gel electrophoresis was used to analyse pDNA-containing samples obtained after alkaline lysis (lane 1, 20 L of sample), isopropanol precipitation (lane 2, 2 L of sample), ammonium acetate precipitation (lane 3, 2 L of sample) and PEG-8000 precipitation (lane 4, 0.5 L of sample). Lane L corresponds to the molecular weight marker.
3.2. Multimodal chromatography The process stream obtained after primary purification and intermediate recovery contains mainly pDNA (oc, sc and multimers) and RNA (lane 4, Fig. 3). In order to isolate sc pDNA from the remaining nucleic acids, multimodal chromatography was tested using a 5 mL chromatographic column packed with CaptoTM adhere (Fig. 1) resin. This matrix contains an immobilised ligand that can mediate anion-exchange (with the charged nitrogen), hydrophobic (with the 12
phenyl ring) and hydrogen bonding (with the hydroxyl groups) interactions with the solutes in the feed stream. The concentrated pDNA solution obtained after PEG-8000 precipitation (lane 4, Fig. 4) was pre-conditioned with a 2 M NaCl in TE buffer solution to set NaCl concentration at 830 mM (diluted 12x). One mL of this solution, which contains 75 µg of total plasmid DNA, was fed to the CaptoTM adhere column, equilibrated to the same NaCl concentration (41.5% buffer B, 69 mS/cm). Runs were performed at 1 mL/min, unbound material was washed with 2 CV of 41.5% B (830 mM, 69 mS/cm) and elution was accomplished using two steps with increasing salt concentration, the first at 46% B (920 mM, 75 mS/cm) and the second at 100% B (2 M, 140 mS/cm). The chromatogram obtained is characterized by three, baseline-separated peaks, one for each elution step (Fig. 4 A). An agarose gel electrophoresis analysis of the corresponding fractions (Fig. 4 B) confirms that: i) the first peak, at 41.5 %B, with a retention volume of 3.2 mL, contains oc pDNA and pDNA multimers (lanes 2-4), ii) the second peak, at 46 %B, with a retention volume of 18.6 mL, contains mainly sc pDNA (lanes 13-15) and that iii) RNA is the major constituent of the last peak at 100 %B, with a retention volume of 35.5 mL (lane 25).
13
Fig. 4. Multimodal chromatography purification of sc pDNA from a feed stream containing oc pDNA, sc pDNA and RNA. A) Chromatogram illustrative of sc pDNA purification. 1 mL of concentrated pDNA solution (lane 4, Fig. 3), diluted 12x (75 g pDNA) and pre-conditioned to set NaCl at 830 mM, was injected into a CaptoTM adhere column, pre-equilibrated with 830 mM NaCl buffer (41.5% buffer B, 69 mS/cm). Unbound material was washed with 2 CV of 41.5% B, and stepwise elution was performed with 3 CV of 46% B ( 75 mS/cm) and 3 CV of 100% B
14
( 140 mS/cm). Numbers over peaks correspond to collected fractions. Continuous line: absorbance at 254 nm; dashed line: conductivity (mS/cm); dotted line: percentage of buffer B (%B). B) Agarose gel electrophoresis analysis of fractions collected during the chromatographic run. Lane L corresponds to the molecular weight marker and lanes F (2 L) and F’ (3 L) to the column feed. Numbered lanes correspond to the fractions collected during the chromatographic run (10 L of sample for lanes 2 to 15; 30 L of sample for lane 25).
The difference between the retention time of the three nucleic acid species (oc, sc and RNA) can be explained based on their charge density and hydrophobic character. At the working pH of 8, all nucleic acids are negatively charged and, thus, will bind to the strong anion-exchanger CaptoTM adhere ligand if the appropriate amount of salt is used in the washing step. Since sc pDNA is more compact as a result of supercoiling, it possesses a higher charge density than oc pDNA [33]. This favours stronger interactions with the charged nitrogen atom of the ligand, allowing sc pDNA to remain bound at the NaCl concentration used to equilibrate the column, while the oc isoform is eluted. Furthermore, the deformations induced by the torsional strain inherent to sc pDNA molecules lead to a higher exposure of bases relative to oc isoform [33]. Therefore, stronger hydrophobic interactions of sc pDNA molecules with the phenyl group of the ligand could also favour the retention of this isoform. The single-stranded nature of RNA and, consequently, the higher exposure of its base groups, turns its hydrophobic interaction with the resin even stronger than the one that sc pDNA can establish, which explains why this specie is the last to elute [33, 15].
The reproducibility of the multimodal chromatographic step was evaluated by running feed streams from three different plasmid batches. An analysis of the
15
chromatograms obtained and of the agarose gel electrophoresis of the fractions collected confirms that the method is robust and able to consistently deliver purified sc pDNA that is free from oc pDNA and RNA (see supplementary figure S1).
Attempts to purify the plasmid by moving directly from isopropanol precipitation to multimodal chromatography were made, to check whether the ammonium acetate and PEG precipitation steps (Fig. 1) could be by-passed. A BCA analysis reveals that the protein content in the column feed is significantly higher if the ammonium acetate and PEG precipitation steps are omitted from the process (198 g/mL versus 22 g/mL). A chromatography run performed with this feed shows that while a significant degree of separation is still achieved, sc plasmid fractions isolated from the column contain traces of impurities, in particular RNA (see supplementary figure S2). Furthermore, the protein content in the sc pDNA pooled fractions increased from 4 g/mL to 41 g/mL. Additionally, the higher RNA and protein load in the feed produced with the shorter process is expected to compromise some of the capacity of the resin to bind sc plasmid DNA and have an impact resin lifetime. Thus, the tandem precipitation operations in the process are crucial to guarantee an adequate purification.
3.3. Analysis of sc pDNA-rich fractions HIC-HPLC analysis (see section 2.6.2) of all fractions collected during the chromatographic run showed that ~70% of the total sc pDNA loaded in the column is recovered in fractions 13 and 14. These fractions were further
16
analysed by electrophoresis, real-time PCR and BCA in order to quantitatively evaluate the quality of the product. The results presented next correspond to average values obtained for samples collected during replica chromatographic runs. Densitometry analysis of the bands in an agarose gel electrophoresis (lanes 13 and 14 in Fig.4B) reveals that, from a feed with an isoform distribution of 49.65.0% sc pDNA to 50.45.0% of oc pDNA, it is possible to recover fractions with 92.02.3% (fraction 13) and 93.05.5% (fraction 14) of sc pDNA. The remaining material in these fractions corresponds to remnants of oc pDNA that were not eluted in the first step. To evaluate the presence of impurities, the sc pDNA-rich fractions 13 and 14 were pooled together and analysed by real time PCR (gDNA quantitation) and BCA assay (protein quantitation). The average results for two runs show the presence of 1.30.3% gDNA (µg gDNA/µg sc pDNA) and 4.971.34 g of host cell proteins per mL of pooled fraction. These levels of impurities are within specifications required for phase I clinical trials [33]; nevertheless, a final step could still be used to reduce even more gDNA and protein content.
3.4. Loading studies In order to evaluate the effect of the loaded amount of plasmid on the purification and recovery of sc pDNA, chromatographic runs with feeds containing between 45 and 265 g of total plasmid DNA (sc + oc) were performed,
keeping
the
same
elution
scheme.
The
corresponding
chromatograms (Fig. 5A) were essentially identical to the one obtained for the case of the 75 µg loading described above (Fig. 4). Furthermore, an agarose gel electrophoresis analysis confirmed that the multimodal column was still able
17
to separate the plasmid isoforms at these higher loadings, yielding fractions with more than 80% of sc plasmid DNA (check lanes marked 13 in Fig. 5B). BCA and real time PCR analysis of the sc-rich fractions collected for all loadings revealed that protein content is below the limit of detection and gDNA content below 0.5% (µg gDNA/µg sc pDNA). However, in the chromatograms obtained at the two higher loadings (130 and 225 µg total pDNA) it is possible to observe a slight inflection on the flowthrough peak. Gel electrophoresis analysis of the corresponding fraction confirms that at these loadings there is a loss of sc pDNA on the flowthrough (check lanes 3 in Fig. 5B), which had not been previously observed for loadings lower than 90 µg total pDNA.
18
Fig. 5 Loading effect on the purification of sc pDNA by multimodal chromatography. A) Chromatogram illustrative of sc pDNA purification. 1 mL of concentrated pDNA solution (lanes F), diluted according to the required load of total pDNA (45 g in blue, 90 g in orange, 130 g in grey and 265 g in yellow) and pre-conditioned to set NaCl to 830 mM, was injected into a CaptoTM adhere column, pre-equilibrated with 830 mM NaCl buffer (41.5% buffer B, 69 mS/cm). Unbound material was washed with 2 CV of 41.5% B, and stepwise elution was performed with 3 CV of 46% B ( 75 mS/cm) and 3 CV of 100% B ( 140 mS/cm). Numbers over peaks correspond to collected fractions. Continuous line: absorbance at 254 nm; dashed line: conductivity (mS/cm); dotted line: percentage of buffer B (%B). B) Agarose gel electrophoresis analysis of fractions collected during the chromatographic runs. Lane L corresponds to the molecular weight marker and lanes F (2 L) to the column feed. Numbered lanes correspond to the fractions collected during the chromatographic run (10 L of sample for lanes 2 to 15; 30 L of sample for lane 25). Gels are colour-numbered according to the corresponding chromatographic run.
HIC-HPLC analysis was performed to determine the amount of sc pDNA recovered as a function of loading. The results indicate that the column capacity for sc pDNA under operational conditions is approximately 40 g (Fig. 6). Although it is possible to recover a higher mass of ~55 g sc pDNA at a loading
19
of 225 g total pDNA (sc+oc), the decrease in yield from 100% to ~60% shows that there is no advantage in increasing column loadings past 40 g sc pDNA.
Fig. 6 Effect of the loaded amount of plasmid on the recovery of sc pDNA purified by multimodal chromatography. Sc plasmid fractions recovered from chromatographic runs performed with feeds containing between 45 and 265 g of total plasmid DNA (sc + oc) were analysed by HICHPLC. Black line: mass of sc pDNA recovered (g). Grey line: sc pDNA yield (%). Experimental conditions as described in the legend of figure 5.
3.5. Downstream process evaluation In order to determine the overall downstream process yield, HIC-HPLC analysis was performed on samples collected during the different phases of the downstream process (see Fig. 2). For the chromatographic step, all fractions recovered from two runs performed with feeds from the same batch were quantified and used to estimate average recovery yields of total pDNA (oc + sc). The results in Table 1 show that almost half of the 1686 µg of total pDNA 20
recovered after alkaline lysis of 200 mL of E. coli cells (OD600nm 19) is lost during primary purification and intermediate recovery and that the feed stream prior to chromatography contains 951.6 µg of pDNA. Moreover, densitometry analysis of lane F in Fig. 4 indicates that before the chromatographic step, approximately half of the total plasmid is in its relaxed, oc form. This is a strong indication that further improvements on the primary purification and intermediate recovery steps are necessary to maximize the amount of sc pDNA just prior to chromatography. After multimodal chromatography, 790.2 g of pDNA were recovered, of which 376.2 g correspond to oc pDNA and 414 g to sc pDNA. HIC-HPLC of all the collected fractions reveals that 90% of oc was recovered on fraction 3 and 70% of sc on fractions 13 and 14. This translates into an 83% yield of total (oc + sc) pDNA recovered during the last purification stage. Overall, and considering all the losses throughout the process, a global yield of 47% was obtained.
Table 1. Step and overall pDNA downstream processing yields. The process started with 0.20 L of E. coli broth (OD600nm ≈ 19). Samples were collected throughout and analysed by HIC-HPLC to determine total pDNA (oc + sc) amounts. Process step
pDNAtotal (g)
Step yield (%)
Global yield (%)
Alkaline lysis
1686
Isopropanol precipitation
1420
84
84
Ammonium acetate precipitation
1146
81
68
PEG-8000 precipitation
951.6
83
56
790.2 (414 sc* +376.2 oc)
83
47
Multimodal chromatography * 70% in fractions 13 and 14
21
3.6. Process versatility The ability of the process to handle other plasmids was tested by resorting to a smaller (pUC18, 2,686 bp) and a larger (pCEP4, 10,410 bp) plasmid. After cell harvesting, the same steps of primary purification and intermediate recovery were performed (Fig. 2). Following PEG-8000 precipitation, the pellet obtained was resuspended in 2 mL TE buffer and diluted 12 times with a 2 M NaCl in TE buffer solution to set NaCl concentration at 830 mM. One mL of sample was fed into the chromatographic column and elution was performed using the same stepwise scheme as before (Fig. 7). The chromatographic profiles obtained for pUC18 (Fig. 7A) and pCEP4 (Fig. 7B) were similar and almost identical to the ones obtained with pVAX1-GFP (Fig. 4A, 5A and Fig. S1). The separation of the isoforms and RNA was confirmed by agarose gel electrophoresis (Fig. 7), with oc pDNA eluting upon washing at 830 mM NaCl, sc pDNA at 920 mM NaCl and RNA during the last gradient step (2 M NaCl).
22
23
Fig. 7. Effect of plasmid size on multimodal chromatography purification. Chromatograms are shown for the purification of A) a 2.7 kb (pUC18) plasmid and B) a 10.4 kb plasmid (pCEP4) from a feed stream containing oc pDNA, sc pDNA and RNA. 1 mL of PEG-8000 precipitated sample, diluted 12x in 830 mM NaCl in 10 mM TE solution were injected into a Capto
TM
adhere
column, pre-equilibrated with 830 mM NaCl buffer (41.5% buffer B, 69 mS/cm). Unbound material was washed with 2 CV of 41.5% B, and stepwise elution was performed with 3 CV of 46% B ( 75 mS/cm) and 3 CV of 100% B ( 140 mS/cm). Numbers over peaks correspond to collected fractions. Continuous line: absorbance at 254 nm; dashed line: conductivity (mS/cm); dotted line: percentage of buffer B (%B). Agarose gel electrophoresis analysis of fractions collected during the chromatographic purification are shown for the C) 2.7 kb and D) 10.4 kb plasmids.
4. Conclusion A new process was established based on multimodal chromatography that purifies sc pDNA vectors from key impurities such as RNA, gDNA and host cell proteins. The process starts with the bacterial cell culture of a pDNA-producing E. coli strain transformed with the target pDNA vector. Following harvest, cells are subjected to alkaline lysis, isopropanol precipitation, ammonium acetate precipitation and PEG-8000 precipitation. Precipitation steps concentrate pDNA, while reducing impurities such as RNA and host cell proteins. Isolation and purification of sc pDNA from oc pDNA and RNA is finally performed via multimodal chromatography with a N-benzyl-N-methyl ethanolamine ligand by modulating charge and hydrophobic interactions with a series of elution steps with increasing NaCl concentration. Primary isolation and intermediate recovery account
for
44%
of
pDNA
losses.
Final
purification
by
multimodal
chromatography provides baseline separation of isoforms and yields sc-rich fractions (> 90%) that are virtually free from RNA and have levels of gDNA
24
(1.30.3 % µg gDNA/µg sc pDNA) and protein (4.971.34 g/mL) impurities within specifications. The process is reproducible and performs similarly with differently sized plasmids (2,686 bp, 3,696 bp and 10,410 bp). Multimodal chromatography step offers advantages over HIC, one of the preferred chromatographic modalities used to separate plasmid isoforms. Not only smaller amounts of salt are used for elution, but most notably, NaCl has a lower environmental impact than the ammonium sulphate typically used in HIC [14, 15, 17].
Acknowledgements Funding received by iBB-Institute for Bioengineering and Biosciences from FCT-Portuguese
Foundation
for
Science
and
Technology
(grant
UID/BIO/04565/2013) and from Programa Operacional Regional de Lisboa 2020 (Project N. 007317) is acknowledged.
25
References [1]
Meyer, F., M. Miner (2001). Gene Therapy: Progress and Challenges. Cell. Mol. Biol., 47(8), 1277-1294.
[2]
Kay, M. A. (2011). State-of-the-art gene-based therapies: the road ahead. Nat. Rev. Genet., 12, 316-328.
[3]
Gardlík, R., Pálffy, R., Hodosy, J., Lukács, J., Turňa, J., Celec, P. (2005). Vectors and delivery systems in gene therapy. Med. Sci. Monit., 11(4), 110-121.
[4]
Ginn, S. L., Alexander, I. E., Edelstein, M. L., Abedi, M. R., Wixon, J. (2013). Gene therapy clinical trials worldwide to 2012 - an update. J. Gene Med., 15, 65-77.
[5]
Niidome, T., Huang, L. (2002). Gene Therapy Progress and Prospects: Nonviral vectors. Gene Ther., 9(24), 1647-1652.
[6]
Remaut, K., Sanders, N. N., Fayazpour, F., Demeester, J., De Smedt, S. C. (2006). Influence of plasmid DNA topology on the transfection properties of DOTAP/DOPE lipoplexes. J. Control. Release, 15, 335-343.
[7]
Mairhofer, J., Grabherr, R. (2008). Rational vector design for efficient nonviral gene delivery: challenges facing the use of plasmid DNA. Mol. Biotechnol., 39, 97-104.
[8]
U. S. Food and Drug Administration. (2007). Guidance for Industry: Considerations for Plasmid DNA Vaccines for Infectious Disease Indications.
[9]
Cai, Y., Rodriguez, S., Hebel H. (2009). "DNA vaccine manufacture: scale and quality." Expert Rev Vaccines, 8(9), 1277-1291.
26
[10] Ghanem, A., Healey, R., Adly, F. G. (2013). Current trends in separation of plasmid DNA vaccines: a review. Anal. Chim. Acta, 760, 1-15. [11] Diogo, M. M., Queiroz, J. A., Prazeres, D. M. F. (2005). Chromatography of plasmid DNA. J. Chromatogr. A, 1069, 3-22. [12] Horn, N. A., Meek, J. A., Budahazi, G., Marquet, M. (1995). Cancer gene therapy using plasmid DNA: purification of DNA for human clinical trials. Hum. Gene Ther., 6, 565-573. [13] Zhang, S., Krivosheyeva, A., Nochumson, S. (2003). Large-scale capture and partial purification of plasmid DNA using anion-exchange membrane capsules. Biotechnol. Appl. Biochem., 37, 245-249. [14] Eon-Duval, A., Burke, G. (2004) Purification of pharmaceutical-grade plasmid DNA by anion-exchange chromatography in an RNase-free process. J. Chromatogr. B., 804, 327-335. [15] Diogo, M.M., Queiroz, J.A., Monteiro, G.A., Martins, S.A.M., Ferreira, G.N.M., Prazeres, D.M.F. (2000). Purification of a cystic fibrosis plasmid vector for gene therapy using hydrophobic interaction chromatography. Biotechnology and Bioengineering. 68:576-583. [16] Urthaler, J., Buchinger, W., Necina, R. (2005) Industrial scale cGMP purification of pharmaceutical-grade plasmid DNA. Chem. Eng. Technol., 28, 1408-1420. [17] Bo, H., Wang, J., Chen, Q., Shen, H., Wu, F., Shao, H., Huang, S. (2013). Using
a
single
hydrophobic-interaction
chromatography
to
purify
pharmaceutical-grade supercoiled plasmid DNA from other isoforms. Pharm. Biol., 51(1), 42-49.
27
[18] Freitas, S. S., Santos, J. A. L., Prazeres, D. M. F. (2009). Plasmid purification by hydrophobic interaction chromatography using sodium citrate in the mobile phase. Sep. Purif. Technol., 65, pp. 95-104. [19] Schluep, T., Cooney, C. L. (1998). Purification of plasmid DNA by triplex affinity interactions. Nucleic Acids Res. 26, 4524-4528. [20] Yang, Y., Geng, X. (2011). Mixed-mode chromatography and its application to biopolymers. J. Chromatogr. A, 1218, 8813-8825. [21] Pinto, I. F., Aires-Barros, M. R., Azevedo, A. M. chromatography:
debottlenecking
the
(2015). Multimodal
downstream
processing
of
monoclonal antibodies. Pharm. Bioprocess., 3, 249-261. [22] Gomes, A. G., Azevedo, A. M., Aires-Barros, M. R., Prazeres, D. M. F. (2010) Clearance of host cell impurities from plasmid-containing lysates by boronate adsorption. J. Chromatogr. A., 1217, 2262-2266. [23] Černigoj, U., Vidic, U., Barut, M., Podgornik, A., Peterka, M., & Štrancar, A. (2013). A multimodal histamine ligand for chromatographic purification of plasmid DNA. J. Chromatogr. A, 1281, 87-93 [24] Matos, T.,
ueiro , J. A., & B lo , L. (2014). Plasmid DNA purification
using a multimodal chromatography resin. J. Mol. Recognit., 27, 184-189. [25] Silva-Santos, A. R., Alves, C. P. A., Prazeres, D. M. F., Azevedo, A. M. (2016).
Separation
of
plasmid
DNA
topoisomers
by
multimodal
chromatography. Anal. Biochem, 503, 68-70. [26] Gonçalves, G. A., Prazeres, D. M., Monteiro, G. A., Prather, K. L. (2013). De novo creation of MG1655-derived E. coli strains specifically designed for plasmid DNA production. Appl Microbiol Biotechnol, 97(2), 611-620.
28
[27] Azzoni, A. R., Ribeiro, S. C., Monteiro, G. A., Prazeres, D. M. F. (2007). The impact of polyadenylation signals on plasmid nuclease-resistance and transgene expression. J. Gene Med., 9, 392-402. [28] Listner, K., Bentley, L. K., Chartrain, M. (2006). A simple method for the production of plasmid DNA in bioreactors. Methods Mol. Med., 127, 295309. [29] Birnboim, H. C., Doly, J. (1979). A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res., 7, 1513-1523. [30] Schneider, C. A., Rasband, W. S., Eliceiri, K. W. (2012). NIH Image to ImageJ: 25 years ofimage analysis. Nat. Methods, 9, 671–675. [31] Alves, P. A., Duarte, S. O. D., Monteiro, G. A., Prazeres, D. M. F. (2016). Use of an E. coli pgi Knockout Strain as a Plasmid Producer. BioPharm International, 28(2), 38-42. [32] Carapuça, E., Azzoni, A., Prazeres, D.M.F., Monteiro, G.A., Mergulhão, F. (2007). Time-course determination of plasmid content in eukaryotic and prokaryotic cells using real-time PCR. Mol. Biotechnol., 37, 120–126. [33] Prazeres, D. M. F. (2011). Plasmid Biopharmaceuticals: Basics, Applications, and Manufacturing. John Wiley and Sons, Inc. [34] Quaak, S. G. L., van den Berg, J. H., Toebes, M., et al. (2008). GMP production of pDERMATT for vaccination against melanoma in a phase I clinical trial. Eur. J. Pharm. Biopharm., 70(2), 429-438.
29
Graphical abstract
30
A process for supercoiled plasmid DNA purification based on multimodal chromatography
A. Rita Silva-Santos, Cláudia P. A. Alves, Duarte Miguel F. Prazeres* and Ana M. Azevedo*
iBB
–
Institute
for
Bioengineering
and
Biosciences,
Department
of
Bioengineering, Instituto Superior Técnico, Universidade de Lisboa, Av. Rovisco Pais, 1049-001 Lisboa, Portugal
* Corresponding authors. E-mail address: [email protected] (D.M.F. Prazeres) E-mail address: [email protected] (A.M. Azevedo)
Highlights
Plasmid DNA is isolated from E. coli by alkaline lysis and tandem precipitation
Supercoiled pDNA is purified by multimodal chromatography with CaptoTM adhere resin
2-step elution with NaCl is used to remove open circular pDNA and RNA from sc pDNA
Sc pDNA with homogeneity higher than 90% and virtually free from RNA is obtained
31