A protein secreted in vivo by Echinococcus granulosus inhibits elastase activity and neutrophil chemotaxis

Molecular and Biochemical Parasitology, 44 ( 1991 ) 81-90 Elsevier

81

MOLBIO 01433

A protein secreted in vivo by Echinococcus granulosus inhibits elastase activity and neutrophil chemotaxis J a m e s C. Shepherd 1., Alastair Aitken 2, and D o n a l d P. M c M a n u s 1 1Department of Pure and Applied Biology, Imperial College, London, and 2National Institute for Medical Research, The Ridgeway, Mill Hill, London, U.K. (Received 11 May 1990; accepted 26 July 1990)

A cDNA encoding the carboxy-terminal of the 12-kDa subunit of antigen B of Echinococcus granulosus has been cloned and sequenced. In addition, an amino acid sequence has been generated for the amino-terminal which is tentatively contiguous with the open reading frame of the DNA-derived sequence. Comparison of the inferred sequence of the 12-kDa antigen with other known sequences indicated a limited similarity to c~-I antitrypsin. In functional assays, gel-purified native 12-kDa antigen from natural infections inhibited elastase but not trypsin or chymotrypsin, providing further evidence that this antigen is a parasite protease inhibitor. Possibly unrelated to its anti-protease activity but a potentially important function of the 12-kDa antigen was its ability to inhibit recruitment of neutrophils. These functions may be important to the viability of the parasite in the face of the host immune response. In addition, the match between the DNA-derived sequence and the protein sequence was imperfect, with some residues having, according to the amino acid sequencing, two alternatives in approximately equal concentrations, and four DNA-derived residues failing to match with the protein sequence at all. The 12-kDa antigen may be expressed as isoforms from a polymorphic gene and, as far as we are aware, this observed sequence polymorphism has not, to date, been described for any other flatworm antigen. Key words: Echinococcus; Antigen B; Protease inhibitor; Antigen polymorphism; Evasion of host immune response

Introduction

Helminth parasite antigens that are excreted or secreted, termed ES antigens, may interact with the host immune system to increase parasite infectivity and survival. They have therefore received

Correspondence address: Don McManus, Tropical Health Program, Queensland Institute of Medical Research, Bramston Terrace, Herston, Brisbane, Queensland 4006, Australia. *Present address: Department of Biology, Princeton University, Princeton, NJ 08544, U.S.A. Note: Nucleotide sequence data reported in this paper have been submitted to the GenBank TM data base with the accession number M36674. Abbreviations: PBS, phosphate-buffered saline; SDS-PAGE, sodium dodecyl sulphate-polyacrylamide gel electrophoresis; IPTG, isopropyl /~-o-thiogalactopyranoside; X-Gal, 5-bromo4-chloro-3-indolyl /3- o-galactoside; PAF, platelet activating factor.

attention as possible targets for vaccination and therapy. Infection of the mammalian host with the larval stage of the dog tapeworm, Echinococcus granuIosus, the causative agent of hydatid disease, generates a host immune response that is often classified into 'early' or 'pre-encystment' immunity and 'late' or 'post-encystment' immunity [1]. These two classifications are a product of the two phases of parasite invasion; first, when the oncosphere penetrates the intestine and, second, at the final encystment site where the cyst begins to develop and grow. The 'early' immune response is thought to be more effective in promoting the high degree of acquired resistance to infection common in cestode zoonoses [2,3]. However, despite the apparent immunity of the intermediate host (domestic animals and humans) to reinfection, the mature cyst is able to survive for many years, and is not eliminated by the host [4,5]. The larval parasite is bathed in hydatid cyst fluid contained within

0166-6851/91/$03.50 © 1991 Elsevier Science Publishers B.V. (Biomedical Division)

82 a cyst of fibrous tissue and germinal cells, usually in the host liver or lungs [2]. The cyst fluid contains proteins derived from both the parasite and the host, including host immunoglobulins [6]. These parasite-derived cyst fluid ES antigens are thought to play a role in protecting the parasite from host immune mechanisms [2]. The parasite proteins have been characterised with respect to size and immunoreactivity, but no functions have been ascribed to them [7]. However, Taenia taeniaeformis, a rat tapeworm, which is a laboratory model for important taeniid infections including hydatidosis, has been shown to secrete peptides capable of interfering with various facets of the host response such as recruitment of effector cells and complement activation [8]. We have examined hydatid cyst fluid collected from natural infections for similar secreted 'interference antigens'. This paper describes the cloning, sequencing and subsequent functional characterisation of one of the major hydatid cyst fluid antigens produced by E. granulosus, the 12-kDa antigen, the smallest subunit of antigen B [7]. In many respects this antigen resembles taeniaestatin [9], a protein secreted by T. taeniaeformis, in its ability to inhibit host protease activity and neutrophil chemotaxis. The presence of this 'interference antigen' in a natural infection suggests that this host response avoidance mechanism may be widespread amongst cestode infections and contributes to the longevity of these parasites in vivo. Materials and Methods

Parasite material. Cysts of E. granulosus were obtained from the lungs and livers of sheep killed at abattoirs in the United Kingdom. Cyst fluid was aseptically aspirated from the cysts and pooled. The fluid was clarified by centrifugation at 10 000 x g for 15 rain at 4°C and concentrated in an Amicon ultra filtration cell using a YM2 membrane (Amicon Corp., U.S.A.). The fluid was aliquotted and stored at - 2 0 ° C [7]. Protoscoleces were aseptically removed from the cysts and pooled. They were then rinsed in 0.2% (w/v) pepsin/Hanks' Balanced Salts Solution (HBSS), pH 2.0, for 30 min at 37°C. Then the parasites were rinsed four times in HBSS, pH 7.4, snap-frozen and stored in liquid nitrogen.

SDS-PAGE gel purification of the 12-kDa antigen. Pooled sheep cyst fluid was centrifuged at 10000 x g for 10 min, and then 3 mg of supernatant protein was boiled for 5 min in gel sample buffer [10]. After a further 10-min centrifugation, the protein was loaded across the top of a single well of a 1.5-mm-thick 7.5-20% gradient SDS-PAGE gel [I1] and 10 /tl of BRL high-molecular-weight prestained markers were dripped into the center of the well and the voltage rapidly applied. Gels were run at 50 V overnight at 4°C in 25 mM Tris/192 mM glycine buffer, pH 8.3. After runnirig, a band the width of the gel was removed from 0.5-1.5 cm below the 14.3 kDa marker. For functional assays a control band (containing 70-90-kDa proteins) of the same size was removed from between the 68-kDa and 97kDa markers. The polyacrylamide strips were then macerated using a spatula and incubated for 48 h at 4°C in a volume of PBS, pH 7.2, just sufficient to cover the macerated gel. The PBS was then removed, centrifuged, and the supernatant spun 5 times in a 10-kDa cut-off Centricon microconcentrater according to the manufacturer's instructions (Amicon Corp., U.S.A.), each time returning the volume of sample to 2 ml with PBS or 0.1 M ammonium carbonate if the sample was prepared for sequencing. Antibodies. A rabbit was immunised subcutaneously with sheep hydatid cyst fluid as previously described [7]. The antiserum was preabsorbed before being used to screen a library by incubation with nitrocellulose filters that had been overlaid on non-recombinant Agtll/Y1090 plaques [12]. In this way, antibody to Escherichia coli components was removed. 10/tg of gel-purified 12-kDa antigen was emulsified in Freund's complete adjuvant and injected subcutaneously into a mouse. Five subsequent boosts (using 10 #g of antigen each boost), without emulsification, were administered at two-week intervals, and the mouse was exsanguinated one week after the last boost. Messenger RNA extraction, cDNA synthesis and cloning. 500 #g of total RNA was isolated from 1 ml of packed protoscoleces according to the method of Chirgwin et al. [13]. 26 #g of poly(A) +

83 RNA was isolated from this RNA using Hybond Message Activated Paper (Amersham, U.K.) according to the manufacturer's instructions. Complementary DNA was synthesised with a kit supplied by Amersham. Approximately 200 ng of of double-stranded cDNA was synthesised from 2 #g of poly(A) ÷ RNA with a size range of about 125 bp to about 3 kb. 100 ng of linkered cDNA was ligated into an equimolar concentration of EcoRI-digested and alkaline phosphatase-treated Agtl 1 arms (Vector Cloning Systems, U.S.A.) using an Amersham cloning kit. After in vitro packaging (Amersham extracts), a fraction of the library was titred in E. coli strain Y1088 on XGal/IPTG plates, showing the total library to contain 1.2 x 106 recombinant plaque-forming units (pfu). 1.4 x 105 pfu were screened without amplification of the library, by briefly incubating phage with Y1088 cells for methylation of cDNA inserts, and immediately plating with Y1090 cells [ 12]. Rabbit anti-sheep cyst fluid antibody diluted 1/50 in 5% skimmed milk/PBS pH 7.2 (Blotto) detected 23 antigen-producing pfu which were plaque-purified by subsequent dilutions and rescreens. Thus, approximately 0.1% of all unamplifled clones expressed parasite ES antigen bound by this antiserum.

Selection of antibody on plaques and Western blotting. A variation on the antibody select method of Ozaki et al. [14] was used. IPTG-soaked nitrocellulose filters lifted from plates of confluent plaques of antigen-expressing clones were incubated with 5 ml of preabsorbed rabbit anti-sheep cyst fluid antiserum diluted 1/20 in Blotto/PBS for 2 h at room temperature. After extensive washing of filters in Blotto, each filter was transferred to a separate, Blotto-soaked petri dish. Bound antibodies were eluted with 5 ml per filter of 0.1 M Glycine/0.15 M NaC1, pH 2.0 for 2-3 min and the eluate immediately neutralised with 2 M Tris-HC1, pH 8.0. The antibody solution was stabilised with 5% skimmed milk powder and used to probe nitrocellulose blots of sheep cyst fluid. Control filters for antibody selection were lifted from confluent plaques of Agtl 1 recombined with the 'Rheo' test insert supplied by Vector Cloning Systems. Electrophoretic transfer of proteins to nitrocel-

lulose was carried out according to Towbin et al. [15] after 50 #g of protein per lane had been electrophoresed in a 7.5-20% SDS-PAGE gradient gel. The incubation of antibody with the strips of nitrocellulose was performed as previously described [7].

Sequencing. DNA sequencing was carried out according to the method of Sanger et al. [16]. Single-stranded DNA was prepared from the insert liberated from EcoRI-digested clone EgPS-3 ADNA by sub-cloning in M13mpl9 [17] according to Amersham protocols. A New England Biolabs 17mer primer (Cat No. 1212) was used to prime the sequencing reactions. Both strands of the cDNA were sequenced. Amino-acid sequencing of gel-purified 12-kDa antigen was carried out on Applied Biosystems 470A gas phase and 477A pulsed liquid phase peptide sequenators. Phenylthiohydantoin amino acids were detected with an on-line Applied Biosystems 120A analyser. Data collection and analysis were performed with an Applied Biosystems 900A module calibrated with 25-pmol phenylthiohydantoin-amino acid standards [18].

Assays for protease inhibition. Protease inhibition was performed in a microplate assay with radioactively labelled gelatin as a substrate [19]. The following enzymes from Sigma were used in the assay: TPCK Trypsin type XIII from bovine' pancreas (T8642); c~-chymotrypsin type I from bovine pancreas (C1384); elastase type IV from porcine pancreas (EO258). 25 /zl of a 250 ng m l - l solution of enzyme in PBS, pH 7.4, was added to each well and samples of the 12-kDa antigen, 70-90kDa control proteins and c~-1 antitrypsin from human plasma (Sigma A9024) were diluted in PBS and added in a volume of 25 #1. All incubations were carried out for 16 h at 37°C. Each supernatant and the corresponding well were counted in a LKB gamma-counter and the percentage counts released were then calculated for each sample as follows: cpm (supernatant)/(cpm (wells)) x 100%.

(supernatant)

+ cpm

The background counts released by inhibitor alone

84 were subtracted from each sample.

Assays for inhibition of neutrophil chemotaxis. Assays were carried out in modified Boyden chambers as described [20]. Purified rabbit C5adesarg was a gift from Peter Jose, Cardiothoracic Institute, University of London. Platelet activating factor (PAF) was a commercial preparation (Sigma P9525). Human peripheral neutrophils were isolated (from J.C.S.) by pelleting through Ficoll-Paque according to Nagy et al. [20]. Chemoattractant and inhibitor were diluted in HBSS, 0.4% (w/v) ovalbumin, 30 mM Hepes, pH 7.35 and 25 lzl placed in the bottom chambers. After overlaying the bottom chambers with nitrocellulose (Sartorius SM11301, 8 #m pore size) the top chambers were clamped into position and 25 itl of cells (2 x 106 per ml of HBSS, 0.4% (w/v) ovalbumin, 30 mM Hepes, pH 7.35) added. The chambers were incubated for 90 min at 37°C. The nitrocellulose filters were fixed in absolute alcohol for 2 min and stained in haematoxylin. Assays were performed in triplicate and cells that had migrated to the bottom surface of the filter were counted after coding in ten high-power fields. Dose-response curves for both C5a and PAF were obtained before assaying for inhibition in order to confirm the responsiveness of the cells and the optimum chemoattractant concentration. Results

Isolation of the 12-kDa antigen cDNA clone. During preparatory pepsinisation of the protoscoleces, many of them were observed under the light microscope to evaginate and become motile. This activity may be accompanied by a corresponding change in the mRNA repertoire of the parasite, and possibly extensive mRNA degradation. However, pepsinisation was necessary to remove any dead or dying parasites and host material which could contaminate the mRNA. Nevertheless, in vitro translation of the isolated RNA resulted in peptides ranging from 20 to 200 kDa, indicating the translational competence of the preparation (data not shown). Fig. I shows the antigens of sheep hydatid cyst fluid bound by the antiserum used to screen the cDNA library (lane 1, panel a). A variety of anti-

gens were bound, including the 12-kDa antigen. The mouse anti-12-kDa antiserum also bound 16kDa, 20-kDa, 24-kDa and 28-kDa antigens (lane 2, panel a). In addition, antibodies absorbed on a variety of clones (panel b) showed cross-reactivity between clone EgPS-3 and 12-kDa, 16-kDa, 20kDa, 24-kDa, and 28-kDa antigens in sheep cyst fluid. Taken together, these results suggest that successive additions of 4 kDa on a basic unit of 12 kDa share a protein epitope or epitopes expressed by clone EgPS-3. The mouse anti-12-kDa antiserum failed to react with the fusion protein of clone EgPS-3, possibly because the antiserum recognises different epitopes, e.g., carbohydrate, from the selected antibody. Additional immunological evidence that clone EgPS-3 encoded epitopes of the 12-kDa antigen was provided by its binding specificity for human antibodies to E. granulosus whilst .failing to react with a pool of human sera containing anti-E, multilocularis antibodies (data not shown), shown previously [7] not to cross-react with antigen B.

The sequence of clone EgPS-3. The carboxy- terminal portion of the coding strand was identified by the presence of a polyadenylated tail (Fig. 2). The putative polyadenylation signal in the 3' non-coding sequence is underlined. The cDNA is 275 bp in length, of which 44 bp comprise the polyadenylated tail and 165 bp an open reading frame in frame with the lacZ gene of Agtll. The translated open reading frame of 54 amino acids is shown, as is the putative overlap with the N-terminal amino acid sequence of the 12-kDa antigen. The match between the DNAderived sequence and the protein sequence is imperfect, with some residues having, according to the amino acid sequencing, two alternatives in approximately equal concentrations, and four DNAderived residues failing to match with the protein sequence at all. However, 79% of the residues are the same between the two sequences and the presence of apparently equally likely alternative residues at some positions suggests that the 12kDa antigen is expressed as isoforms from a polymorphic gene. If the DNA and amino-acid sequences are contiguous, then the 12-kDa antigen is 65 amino acids in length and its estimated relative molec-

85

a MWxlO -3

b 200.-~ 97-4'--~ 68 .--~ 43 ~,"

M W x l O -3

25-7.--~ 25"7"--~

18"4-..*, 14"3--'-~

18"4"--~ 14"3"--~

ii i~!ii~iiili iili ii i 1234

RxS ~, 1 3 5 8 9 1 6 1 8 3 1

Fig. 1. Antibodyspecificityof the antiserum used for screeningthe E. granulosus cDNA library. Sheep hydatid cyst fluid antigen was treated with 5% 2-mercaptoethanolprior to electrophoresis.Antigen was probed with the following antisera: (a) lane 1, rabbit antisheep hydatid cyst fluid; lane 2, mouse anti-12-kDa antiserum; lane 3, normal rabbit serum; lane 4, normal mouse serum. (b) R x S, rabbit anti-sheep hydatid cyst fluid; A, R x S selected on control Agtl 1 plaques; 1-31, R × S selected on recombinantEgPS clones. ular mass is 7400, substantially less than 12000. No asparagine-linked glycosylation of the 12-kDa antigen was detected by treatment of the antigen with peptide: N-glycanase F [21] (data not shown) and there are no N-linked carbohydrate acceptor sites in the sequence. The 12-kDa antigen is similar to some serine protease inhibitors. The comparison of the open

reading frame of clone EgPS-3 with baboon and human a-1 antitrypsin amino-acid sequences is shown in Fig. 3. These proteins showed sequence similarity over a limited region. The region of similarity is far from the P~ residue (the active site) of the protease inhibitors [22]. To test functional similarity, we chose an assay measuring inhibition of proteolysis. It was found that both electrophoretically purified 12-kDa anti-

gen and commercially produced c~-I antitrypsin inhibited the activity of porcine elastase at similar concentrations. Both inhibitors abolished elastase activity at a concentration of 2 #g m l - 1 (Fig. 4A). However, the 12-kDa antigen did not inhibit chymotrypsin (Fig. 4B) or trypsin (Fig. 4C), although ~-1 antitrypsin was an inhibitor of both in the assay. The molarity at which the gel-purified 12-kDa antigen abolished elastase activity was between 4 and 6 times greater than that of c~-1 antitrypsin. As a loss of inhibitory activity was observed with older preparations of gel-purified 12kDa antigen, the activity of the commercially supplied inhibitor and the purified protein could not be compared. Control incubations with the 70-90kDa proteins showed marginal inhibitory activity, indicating that possible contaminants of the 12-kDa antigen such as SDS or acrylamide had

86

I

10

X asp glu

leu lys

ser his met arg gln val met lys

pro thr

lys

A

met

~O 4o

leu lys met C T G A A A ATG

20

Q

•

•

•

_

~20

•

;elO

phe gly glu val lys tyr p h e p h e glu arg a s p p r o leu T T T GGC G A A G T G AAG T A C T T C TTC G A A C G T GAT CCG TTG

0

T

0

30

2

gly gln lys arg leu

;

•

4o

B

g y g n iys val val asp leu leu lys glu leu glu glu GGT CAG A A A GTG GTT G A C C T C T T A A A G G A A CTG G A A GAA

val phe gln leu leu a r g lys lys leu a r g met ala leu

O

~ 30"

6O

~ 2o I WI

arg set his leu arg g l y leu ile ala g l u gly glu stop

~ 10"

A G G TCC CAC CTC A G A G G G T T G ATT GCT G A A G G T G A A TAG

0

@

2 AGGTGCCAATACACTGTCATGTGACTAGTCATAGATTTTGCTCAATAAACCA

C

Fig. 2. The amino acid and cDNA sequences of the 12-kDa antigen. Identities between residues ascribed by amino acid sequencing and cDNA sequencing are indicated by black dots. X refers to the first residue that could not be identified owing to salt contamination. The bold numbers refer to number of amino-acids from the amino terminus. The DNA sequence consists of 275 bases. The polyadenylation signal is underlined. a-1ANTITRYPSIN

(H): 1 8 0 Q I N D Y V E K G T Q G K I V D L V K E L D R D T V F A L V 209

a-I A N T I T R Y P S I N

(B): ] 7 1 Q I N N Y V E K G T Q G K V V D L V K E L D R D T V F A L V 200 :

1 7 E V K Y F F E R D P L G Q K V V D L L K E L E K V F Q L L 45 oo o m o • ••mmmommmo o m • •o

Fig. 3. Sequence similarity between the translated open reading frame of EgPS-3 and primate a-1 antitrypsin. Only those regions showing significant similarity are presented. Numbers refer to residues from the amino terminus and H and B refer to human and baboon. II, Identical residue; D, similar residue.

little effect on proteolytic activity. The demonstration of a functional activity for the 12-kDa antigen which was predicted from the amino acid sequence derived from clone EgPS-3 is strong evidence that the peptide expressed by clone EgPS-3 corresponds to part of the 12-kDa antigen.

8

-¢- 12kDa -e- 70-90kDa " , , , , ~ ~ t i t r y p s i n

~: 40"

GTG TTC CAG T T G TTG A G G A A G A A G C T A C G C A T G G C A CTC

T C T A C T T T A T C T C T (A) 44

T

4 6 pg/ml inhibitor

60"

_ so:

50

EgPS-3

•"¢- 70-90kDa -4- cL-1 antiwpsin ~ 12kDa _

= 30

phe gly glu glu leu t y r a s p phe glu a r g asn p r o leu lys phe asp •

60

~: so

*

T

4 6 ,ug/ml inhibitor

8

E0"

~ 50" 40" ~psin

.~, 30"

~ 20" W

N 10" ,

2

4

,

!

6

8

,ug/ml i n h i b i t o r

Fig. 4. The activity of different proteases in the presence of the 12-kDa antigen. Proteases were present at 0.25 /zg m1-1 in all assays. (A) Elastase; (B) chymotrypsin; (C) trypsin.

The 12-kDa antigen inhibits human neutrophil chemotaxis. No chemoattractant activity was observed with the 70-90-kDa control proteins (Fig. 5). However, significant 12-kDa chemoattractant activity was observed. Chemoattractant activity of the 12-kDa antigen was inversely proportional to its concentration, indicating that high dose inhibition was exhibited at the concentrations tested. At the lowest concentration tested, 10 - 9 M 12kDa, 36% of maximal PAF activity and 18% of maximal C5a activity was measured. It is possible that maximal 12-kDa chemoattractant activity was not reached at the concentrations used. However, almost total inhibition of chemotaxis was

87 "~

100"

~=

80"

~

60"

~ ~

1

2

k

D

a

40'

,l= ~

20'

z 0 Molar Concentrations of 12kDa and 70-90kDa molecules

Fig. 5. Chemoattractant activity of the 12-kDa antigen towards human neutrophils. Molar concentrations are approximate.

observed at 10 -6 M 12-kDa, a concentration ten times lower than that required of C5a, suggesting a high potency for the 12-kDa antigen preparation. In Fig. 6A, inhibition of C5a-mediated chemotaxis of human neutrophils is shown. At 5 × 10 -7 M 12-kDa, 80% of the response to C5a by neutrophils was abolished. There was less inhibition

.~ 300" t~

r....~.e

-I=- 12kDa -e- 70-90kDa [C5a] = 5xlO-aM

,i=

z

0

s:~o-'

s~qo-'

5~o -°

5~o -~

Molar ConccritratJonsof 12kDaand70-90kDamolecules

.~ 3OO

200

,O- 12kDa -e- 70-90kDa IPAFI = 5~10-rM z

0

i

=

5=10-7

5=10-e

i

5=10-°

i

5x10-*

Molar Concentrations of 12kD and 70-90kDa molecules

Fig. 6. Inhibition of PAF and C5a chemoattractant activity by the 12-kDa antigen. Molar concentrations are approximate.

with decreasing 12-kDa concentration until no significant inhibition was observed at 5 × 10 -9 M 12-kDa. The decrease in inhibition may be accentuated by the increase in chemotaxis due to the 12-kDa antigen alone. The 70-90-kDa protein preparation inhibited 23% of the control chemotactic activity of C5a. In Fig. 6B a similar pattern of 12-kDa inhibition was observed when PAF was the chemoattractant. In this case, no inhibition was seen with the 70-90-kDa proteins compared with PAF alone, suggesting that the response of the cells to stimuli was unimpaired by contaminants in the polyacrylamide gel-extracted parasite proteins. At 5 × 10 -7 M 12-kDa, 70% inhibition of the response to PAF was observed; this was comparable with the inhibition of C5a demonstrated at this concentration.

Discussion A cDNA clone encoding the C-terminal portion of the 12-kDa antigen of E. granulosus sheep hydatid cyst fluid was sequenced. N-terminal amino acid sequence of the native peptide indicated that the actual relative molecular mass of this peptide may be nearer 7.4 kDa than 12 kDa, although Olinked glycosylation or anomalous migration of the protein in polyacrylamide may account for the higher SDS-PAGE estimated figure. Evidence is presented that the 7.4-kDa peptide shares epitopes with secreted proteins of higher Mr, stepwise increases of 4 kDa being observed in cross-reactive proteins. Thus the antigen may represent the carboxyl terminal of a larger protein with repeating 4-kDa domains. Proteolysis may account for the 'ladder' of peptides. The detected variation in the amino acid sequence may have been exacerbated by pooling cyst fluid from different cysts for antigen purification, thus introducing heterogeneity into the preparation. The mismatches between the protein sequence and the DNA-derived sequence may be due to the fact that the cDNA corresponds to a relatively rare allele. It is also possible that the amino acid sequence is not contiguous with the DNA-derived sequence but amino terminal to it and a joining sequence is missing. The 12-kDa molecule was obtained after a onestep purification by SDS-PAGE. Nevertheless, we are confident about its purity based on its mi-

88 gration as a single band on denaturing PAGE gels. Furthermore, the amino acid sequence of the peptide, determined by Edman degradation, produced a single sequence with occasional alternative residues (Fig. 2) and no major contaminants. A minor contaminant, present at levels undetectable by microsequencing, is unlikely to have exhibited the biological activities described in this paper. The possession of anti-protease and chemoattractant/anti-chemoattractant activity by the native peptide could have important implications for the survival of the parasite in an immunocompetent host. A secretory protein, taeniaestatin, from a rat cestode, T. taeniaeformis, shows similarity to the specific antigen described in this paper. Taeniaestatin is a 19.5-kDa protein that has been shown to inhibit trypsin and chymotrypsin [9], neutrophil chemotaxis [23], the alternative and classical complement pathways [8], and interleukin-2 stimulation of T-cell proliferation [24]. The 12-kDa protein described in this paper does not appear to inhibit complement or interleukin-2 activities (data not shown) but shares other functional characteristics with taeniaestatin. Whereas it has been suggested [23] that the anti-chemotactic activity of taeniaestatin may be related to its anti-protease activity, this is not likely for the peptide described here as it possesses chemoattractant activity of its own. The results indicate that the 12-kDa antigen does not inhibit chemotaxis of neutrophils by competition with the chemoattractant for its receptor because PAF and C5a are structurally dissimilar and bind to different receptors on the neutrophil [25]. Likewise, the 12-kDa antigen is unlikely to bind directly to PAF and C5a. Indeed, the 12-kDa antigen demonstrates its own chemoattractant activity and its inhibitory properties are more likely to be due to high-dose inhibition and desensitisation of cells than direct inhibition of PAF or C5a [26]. An eosinophil chemoattractant has been purified from T. taeniaeformis that was not, however, chemoattractive towards neutrophils [27]. Other eosinophil chemoattractants have been identified in Ascaris [28], Anisakis [29], and Schistosoma [30] so the existence of chemotaxis-influencing proteins expressed by parasitic helminths seems widespread. The in vitro concentration at which the 12-kDa

antigen inhibits neutrophil chemotaxis is similar to the concentration of this antigen in sheep cyst fluid. Assuming 100% of the antigen is recovered by gel purification, the concentration of this peptide in cyst fluid is approximately 10 - 7 M. This concentration is also in the range sufficient to inhibit elastase activity in the microplate assay. It is likely that different cysts contain different concentrations of ES antigens, but in the pools of sheep cyst fluid used to purify the antigen, the concentration isolated has been within the range required for chemotaxis inhibition and protease inhibition and at least two orders of magnitude higher than the concentrations required for chemoattractant activity. The activities of the antigen described in this paper were detected in in vitro assays. There are no demonstrations of these activities in vivo, although it is an attractive possibility that parasites secrete such 'interference molecules', which impair host immune function through a variety of activities. Protease inhibitors have been described from a wide variety of parasites that may perform similar functions to the antigen described in this paper [9]. The invading E. granulosus parasite is likely to be most vulnerable to immune attack in the early stages of infection, from the initial passage of the oncosphere through the gut wall to the subsequent development of the immature cyst [ 1]. During this period, no thick laminated outer layer has formed, leaving the developing parasite accessible to immune cells. No information is available on the levels of expression of the 12-kDa antigen early in development, nor on the ability of neutrophils to penetrate the wall of a mature cyst. These are experiments that need to be done. Another interesting aspect of the sequence of the 12-kDa antigen presented in this paper is its polymorphism. It seems that from a limited (and unknown) number of clonal populations of larval parasites, corresponding to the protoscoleces isolated from each cyst, amino-acid sequence diversity is exhibited by the antigen. This may have important implications for the co-evolution of parasite and host and for the speciation of E. granulosus. Changes in the host defence mechanisms exert a strong selection pressure and require a concomitant 'fluidity' in parasite escape mechanisms. Thus there may be selection for a high rate of

89

mutation in the 12-kDa antigen gene. A similar situation has been postulated in reverse, i.e., host protease inhibitors evolve rapidly to counter the large and varied repertoire of parasite proteases encountered [31]. A number of distinct strains of E. granulosus have been identified worldwide, and this is reflected in their restriction to particular intermediate hosts [32]. Such host specificity may result from sequence differences in proteins such as the one described in this paper, that prevent parasite expulsion from a particular host. The observed sequence polymorphism of the 12-kDa antigen may also be exploited as a target in the design of immunodiagnostic tests for identification of Echinococcus species and strains. Although a common feature of parasitic protozoa, especially malaria [33], as far as we are aware, no such sequence polymorphism has, to date, been described for any other flatworm antigen. Sequence variability was recently shown in a protective antigen of Trichostrongylus colubriformis [34], a parasitic nematode infecting the small intestine of sheep.

Acknowledgements We thank Dr. Louis Nagy and Professor Barry Kay for help with the chemotaxis experiments, Dr. Mike Hobart for help with some unpublished data, Alan Harris for running the automated protein sequencing, and John Collins and Andrew Coulson for the data base research. This work was supported by the Wellcome Trust and the Medical Research Council (U.K.) and the National Health and Medical Research Council (Australia).

References 1 Smyth, J.D. and McManus, D.P. (1989) The Physiology and Biochemistry of Cestodes, Cambridge University Press, Cambridge. 2 Heath, D.D. (1986) Immunobiology of Echinococcus infections. In: The Biology of Echinococcus and Hydatid Disease (Thompson, R.C.A., ed.), pp. 164-182, George Allen and Unwin, London. 3 Dada, B.J.O. and Belino, E.D. (1981) Immunization of sheep against cystic hydatidosis with homologous and heterologous metacestode antigens. Int. J. Zoonoses 8, 20-25. 4 Heath, D.D., Parmeter, S.N., Osborn, P.J. and Lawrence, S.B. (1981) Resistance to Echinococcus granulosus infection in lambs. J. Parasitol. 67, 797-799. 5 Craig, P.S., Zeyhle, E. and Romig, T. (1986) Hydatid disease: research and control in Turkana II; The role of immunological techniques for the diagnosis of hydatid dis-

ease. Trans. R. Soc. Trop. Med. Hyg. 80, 183-192. 6 Vidor, E., Piens, M.A. and Garin, J.P. (1987) Host serum protein levels in cysts of human hydatidosis. Trans. R. Soc. Trop. Med. Hyg. 81, 669-671. 7 Shepherd, J.C. and McManus, D.P. (1987) Specific and cross-reactive antigens of Echinococcus granulosus hydatid cyst fluid. Mol. Biochem. Parasitol. 25, 143-154. 8 Leid, R.W. (1988) Parasites and complement. Adv. Parasitol. 27, 131-168. 9 Suquet, C., Green-Edwards, C. and Leid, R.W. (1984) Isolation and partial characterisation of a Taenia taeniaeformis metacestode proteinase inhibitor. Int. J. Parasitol. 14, 165-172. 10 Studier, F.W. (1973) Analysis of bacteriophage T7 early RNAs and proteins on slab gels. J. Mol. Biol. 79, 237-248. 11 Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature 227, 680-685. 12 Huyhn, T.V., Young, R.A. and Davis, R.W. (1985) Constructing and screening cDNA libraries in Agtl0 and Agtl 1. In: DNA Cloning, Vol. 1 (Glover, D.M., ed.), pp. 49-78, IRL Press, Oxford. 13 Chirgwin, J.M., Przybla, A.E., McDonald, R.J. and Rutter, W.J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294--5298. 14 Ozaki, L.S., Mattei, D., Jendoubi, M., Druihle, P., Blisnick, T., Guillotte, M., Puijalon, O. and Da Silva, L.P. (1986) Plaque antibody selection: rapid immunological analysis of a large number of recombinant phage clones positive to sera raised against Plasmodium falciparum antigens. J. Immunol. Methods 88, 213-219. 15 Towbin, H., Staehelin, T. and Gordon, J. (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76, 4350-4354. 16 Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467. 17 Messing, J. (1983) New M13 vectors for cloning. Methods Enzymol. 101, 20-79. 18 Geisow, M.J. and Aitken, A. (1988) Gas or pulsed-liquid phase sequence analysis. In: Protein Sequencing: A Practical Approach (Giesow, M.J. and Findlay, J.B.C., eds.), pp. 85-95, IRL Press, Oxford. 19 Robertson, B.D., Kwan-Lim, G.E. and Maizels, R.M. (1988) A sensitive microplate assay for the detection of proteolytic enzymes. Anal. Biochem. 172, 284-287. 20 Nagy, L., Lee, T.H. and Kay, A.B. (1982) Neutrophil chemotactic activity in antigen-induced late asthmatic reactions. New Engl. J. Med. 306, 497-501. 21 Tarentino, A.L., Gomez, C.M. and Plummer, T.H. (1985) Deglycosylation of asparagine-linked glycans by peptide: N-glycosidase F. Biochemistry 24, 4665-4671. 22 Kurachi, K., Chandra, T., Degen, S.J.F., White, T.T., Marchioro, T.L. and Woo, S.L.C. (1981) Cloning and sequence of cDNA coding for c~-I antitrypsin. Proc. Natl. Acad. Sci. USA 78, 6826~830. 23 Leid, R.W., Grant, R.F. and Suquet, C.M. (1987) Inhibition of equine neutrophil chemotaxis and chemokinesis by a Taenia taeniaeformis proteinase inhibitor, taeniaestatin. Parasite Immunol. 9, 195-204. 24 Leid, R.W., Suquet, C.M., Bouwer, H.G.A. and Hinrichs. D.J. (1986) Interleukin inhibition by a parasite proteinase inhibitor, taeniaestatin. J. Immunol. 137, 2700-2702.

90 25 Allen, R.A., Traynor, A.E., Omann, G.M. and Jesaitis, A.J. (1988) The chemotactic peptide receptor. A model for future understanding of chemotactic disorders. Hematol. Oncol. Clin. North. Am. 2, 33-40. 26 Wilde, M.W., Carlson, K.E., Manning, D.R. and Zigmond, S.H. (1988) Chemoattractant-stimulated GTPase activity is decreased on membranes from polymorphonuclear leukocytes incubated in chemoattractant. J. Biol. Chem. 264, 190-196. 27 Potter, K.A. and Leid, R.W. (1986) Isolation and partial characterisation of an eosinophil chemotactic factor from metacestodes of Taenia taeniaeformis (ECF-Tt). J. Immunol. 136, 1712-1717. 28 Tanaka, J., Baba, T. and Torisu, M. (1979) Ascaris and eosinophils, II. Isolation and characterisation of eosinophil chemotactic factor and neutrophil chemotactic factor of parasite in Ascaris antigen. J. Immunol. 122, 302-308. 29 Tanaka, J. and Torisu, M. (1978) Anisakis and eosinophils, I. Detection of a soluble factor selectively chemotactic for eosinophils in the extract of Anisakis larvae. J. lmmunol.

120, 745-749. 30 Tsudo, S., Fukuyama, K. and Epstein, W.L. (1979) Low molecular weight eosinophil chemotactic factor in granulomatous liver in murine schistosomiasis. J. Immunol. 122, 2554-2557. 31 Hill, R.E. and Hastie, N.D. (1987) Accelerated evolution in the reactive centre regions of serine protease inhibitors. Nature 326, 96-99. 32 McManus, D.P. and Smyth, J.D. (1986) Hydatidosis: changing concepts in epidemiology and speciation. Parasitol. Today 2, 163-167. 33 Mitchell, G.H. (1989) An update on candidate malaria vaccines. Parasitology 98, $29-$47. 34 Savin, K.W., Dopheide, T.A.A., Frenkel, M.J., Wagland, B.M., Grant, W.N. and Ward, C.W. (1990) Characterization, cloning and host-protective activity of a 30kilodalton glycoprotein secreted by the parasitic stages of Trichostrongylus colubriformis. Mol. Biochem. Parasitol. 41, 167-176.