A putative mitochondrial mechanism for antioxidative cytoprotection by 17beta-estradiol

Experimental Eye Research 78 (2004) 933–944 www.elsevier.com/locate/yexer

A putative mitochondrial mechanism for antioxidative cytoprotection by 17beta-estradiol Andrea N. Moora, Srinivas Gottipatia, Robert T. Malletb, Jie Sunb, Frank J. Giblinc, Rouel Roquea, Patrick R. Cammarataa,* a

Department of Cell Biology and Genetics, University of North Texas Health Science Center, 3500 Camp Bowie Boulevard, Fort Worth, TX 76107, USA b Department of Integrative Physiology, University of North Texas Health Science Center, Fort Worth, TX 76107, USA c Eye Research Institute, Oakland University, Rochester, MI 48309, USA Received 4 November 2003; accepted in revised form 7 January 2004

Abstract It has been demonstrated that estrogens are potent antioxidants and protect against H2O2-mediated depletion of intracellular ATP in human lens epithelial cells (HLE-B3) [Invest. Ophthalmol. Vis. Sci. 44 (2003) 2067]. To investigate the mechanism by which 17b-estradiol (17bE2) protects against oxidative stress, HLE-B3 cells were exposed to insult with H2O2 at physiological (50 mM ) and moderately supraphysiological (100 mM ) levels over a time course of several hours, with and without pretreatment with 17b-E2. The ability of 17b-E2 to prevent H2O2-induced injury to several oxidant susceptible components of the cellular ATP generating machinery, including abundances of mitochondrial gene transcripts encoding respiratory chain subunits and cytochrome c, the glycolytic pathway enzyme, glyceraldehyde-3phosphate dehydrogenase (GAPDH) and the energy-shuttling creatine kinase (CK) system, and mitochondrial membrane potential ðDCm Þ; a measure of mitochondrial membrane integrity, were determined 3 hr after oxidative insult. Northern blot analysis revealed H2O2-induced reductions in mitochondrial transcripts for nicotinamide adenine dinucleotide dehydrogenase (NADH) subunits 4 and 5 and cytochrome c. H2O2 also inactivated GAPDH but did not alter CK activity. Pretreatment and simultaneous addition of 17b-E2 with H2O2 did not prevent the reductions in mitochondrial transcript levels and GAPDH activity. 17b-Estradiol did moderate the collapse of mitochondrial membrane potential ðDCm Þ in response to H2O2 as demonstrated by JC-1 staining and fluorescence microscopy. Although the precise mode of action responsible for protection by estradiols against oxidative stress remains to be determined, these results indicate that the hormone stabilizes the mitochondrial membrane, thereby preserving the driving force for oxidative ATP synthesis. q 2004 Elsevier Ltd. All rights reserved. Keywords: hydrogen peroxide; mitochondria; estrogen; human lens epithelial cell; cataract; glyceraldehyde 3-phosphate dehydrogenase; creatine kinase

1. Introduction Hydrogen peroxide (H2O2), an oxidant generated from the dismutation of superoxide anion by superoxide dismutase, has been strongly implicated in the formation of cataract. Elevated H2O2 concentrations have been reported in the aqueous humor of cataract patients, and lenses exposed to high concentrations of H2O2 become opaque (Spector and Garner, 1981, 1982). On the other hand, studies in cultured cells (Hales et al., 1997) and animal model studies (Bigsby et al., 1999) support a beneficial * Corresponding author. Dr Patrick R. Cammarata, Department of Cell Biology and Genetics, University of North Texas Health Science Center, 3500 Camp Bowie Boulevard, Fort Worth, TX 76107, USA. E-mail address: [email protected] (P.R. Cammarata). 0014-4835/$ - see front matter q 2004 Elsevier Ltd. All rights reserved. DOI:10.1016/j.exer.2004.01.001

effect of estrogen against experimental cataract formation in lens. Epidemiological studies indicate beneficial effects of hormone replacement therapy against cataract in postmenopausal women (Harding, 1994; Klein et al., 1994; Cumming and Mitchell, 1997; Freeman et al., 2001; Younan et al., 2002; Weintraub et al., 2002). Oxidative stress causes profound injury to a number of intracellular macromolecules in eukaryotic cells, including lipid peroxidation, protein alterations, breakage of covalent bonds of carbohydrates and cleavage of DNA. Oxidative insult can overburden conventional intracellular antioxidant enzymes, such as superoxide dismutase, glutathione peroxidase and catalase. Impairment of these antioxidant systems would interfere with the detoxification of oxidants and, thus, expose biomolecules to oxidant attack, as well

934

A.N. Moor et al. / Experimental Eye Research 78 (2004) 933–944

as resulting in the deleterious loss of reduced glutathione levels. The glycolytic enzyme, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a primary target for inactivation by H2O2 (Hyslop et al., 1988; Mallet et al., 2002); its inactivation constrains glycolytic ATP production and causes accumulation of upstream glycolytic intermediates (Chatham et al., 1989; Mallet et al., 2002). Creatine kinase (CK) exchanges high-energy phosphate bonds between ADP and creatine, thereby effecting metabolic energy translocation from the mitochondria to cellular energyconsuming processes (Saks et al., 1994). Inactivation of CK by H2O2 has been demonstrated in skeletal muscle (Suzuki et al., 1992) and myocardium (Suzuki et al., 1992; Mekhfi et al., 1996). By opening mitochondrial permeability transition pores (PTPs), oxidative stress collapses the mitochondrial membrane potential ðDCm Þ; a major determinant of the driving force for oxidative phosphorylation. Mitochondria, via cellular respiration, represent an additional source of ATP generation in lens epithelial cells. Mitochondrial integrity has also been found to be particularly susceptible to oxidative stress, and factors affected include release of calcium, ATP depletion and loss of electron transport capacity (reviewed in Crawford et al., 1997). Mitochondrial gene transcripts important in the production of proteins involved with cellular respiration have been reported to be targets of oxidative stress in the human lens epithelial cell line SRA 01-04 (Carper et al., 1999). Under chronic conditions of oxidative stress, mitochondria can be subject to irreversible increase in permeability of the inner mitochondrial membrane resulting in collapse of membrane potential. We previously reported that estrogens can preserve mitochondrial function, cell viability and intracellular ATP levels in cultured human lens epithelial cells during oxidative stress (Wang et al., 2003). In the current study, we further tested the protective effects of estrogen against oxidative stress using cultured human lens epithelial cells (HLE-B3) with the aim of determining the cellular mechanism(s) responsible for preserving cellular ATP. We assessed the ability of 17b-estradiol (17b-E2) to mitigate the adverse effects of H2O2 on several cellular ATP-generating systems, including mitochondrial gene transcripts involved in cellular respiration, the key enzymes GAPDH and CK, an enzyme that displays age-related expression of isoforms in the human lens (Friedman et al., 1989) and, as a measure of mitochondrial stability, DCm :

2. Materials and methods 2.1. Chemicals 17b-E2 was purchased from Research Biochemicals International (Natick, MA, USA). For use in our experiments, the steroid was dissolved in 100% ethanol at a concentration of 10 mM , diluted to 1 mM and finally diluted

in culture medium to a final concentration of 1 mM . Unless otherwise stated, steroid treatment to cell cultures involved an overnight (18 hr) preincubation followed by fresh administration of the steroid in the presence of H2O2. Those cells receiving vehicle (ethanol only) pretreatment were maintained in fresh culture medium at the same final ethanol concentration as used with the 17b-E2 treatment. Control cells were maintained in culture medium with appropriate changes of fresh medium. H2O2 was purchased from Fisher Scientific (Fair Lawn, NJ, USA) and was diluted in culture medium to a final concentration for use. 5,50 ,6,60 -Tetrachloro1,10 ,3,30 -tetraethyl-benzimidazolylcarbocyanine iodide (JC-1) was purchased from Molecular Probes (Eugene, OR, USA). 2.2. Tissue culture HLE-B3 cells, a human lens epithelial cell line immortalized by SV-40 viral transformation (Andley et al., 1994), were obtained from Usha Andley (Washington University School of Medicine, Department of Ophthalmology, St Louis, MO, USA). Cells were cultured in Eagle’s minimal essential medium (MEM) supplemented with 20% fetal bovine serum (FBS) (Hyclone Laboratories, Logan, UT, USA), 2 mM L -glutamine and 0·02 g l21 gentamycin solution (Sigma Chemical Co. St Louis, MO, USA) in 75 cm2 culture flasks at 378C and 5%CO2/95%O2. 2.3. Reverse transcription-polymerase chain reaction HLE-B3 cells grown in 75 cm2 culture flasks were harvested by scraping and rinsed once with 1 £ PBS (pH 7·4) and pelleted by centrifugation at 3000g for 5 min. Total RNA was extracted using either a TRIzolw Reagent (Invitrogen Corp. Carlsbad, CA, USA) or a Trizol kit (Tel-Test, Friendwood, TX, USA) according to the supplier’s protocol. RNA pellets were air dried for 10 min and subsequently dissolved in deionized water at 658C for 15 min. The concentration and purity of the RNA preparation were determined by measuring the absorbance of RNA at wavelengths 260 and 280 nm (Hitachi Instruments Inc., Tokyo, Japan). RNA was stored at 2 808C for subsequent experiments. cDNA was prepared with AMV reverse transcriptase (Promega, Madison, WI, USA) using random hexamer primers (Promega, Madison, WI, USA). RNA was initially denatured at 858C for 3 min then placed on ice for 3– 5 min. The reaction was performed in a total volume of 20 ml containing: 1·0 or 2·5 mg of total RNA (specified per experiment), 10 U of AMV reverse transcriptase, 25 ng ml21 random hexamer, 4 ml of 5 £ AMV reverse transcriptase buffer, 4 ml of 5 mM MgCl2, 1 mM dNTPs (Promega, Madison, WI, USA) and 2U/ml RNasin (Promega, Madison, WI, USA). The reaction was incubated at 428C for 45 min.

A.N. Moor et al. / Experimental Eye Research 78 (2004) 933–944

935

Table 1 Effects of H2O2 and 17b-E2 on glyceraldehyde-3-phosphate dehydrogenase (GAPDH) activity in HLE-B3 cells Determination conditions

20% FBS/MEM Serum-free MEM a b

Units per mg protein Control (0 hr)

1 mM 17b-E2 (3 hr)

100 mM H2O2 þ 1 mM 17b-E2 (3 hr)

100 mM H2O2 (3 hr)

0·274 ^ 0·014 0·569 ^ 0·086

0·215 ^ 0·059 0·560 ^ 0·095

0·144 ^ 0·021a 0·361 ^ 0·059b

0·134 ^ 0·027a 0·316 ^ 0·073b

Values represent n ¼ 6 based on six individual cell populations. Represents significantly different from controls under the same medium condition (20% FBS) ðP , 0·05Þ: Represents significantly different from controls under the same medium condition (Serum-free) ðP , 0·05Þ:

PCR primers were specifically designed to nicotinamide adenine dinucleotide dehydrogenase (NADH) subunit 4, NADH subunit 5, cytochrome B, cytochrome c, 16S (mitochondrial) and 18S (cytoplasmic) (See Table 3 for the appropriate oligonucleotide primer pairs which were designed against human genes and synthesized by Sigma Genosys (Spring, TX, USA)). Sequence analysis was performed to confirm the PCR products. For PCR reactions, 2·5 ml of cDNA from the reverse transcriptase reactions was amplified in a total volume of 50 ml containing 0·2 mM of target gene primers (sense and antisense), 0·75 mM MgCl2, 0·2 mM each of dATP, dGTP, dCTP and dTTP, 1 U of Taq polymerase (Promega, Madison, WI, USA) and 5 ml of 10 £ PCR buffer (Promega, Madison, WI, USA). Samples were overlaid with 200 ml mineral oil. Amplification was performed on a Perkin Elmer DNA Thermal Cycler 480 (Perkin Elmer, Boston, MA) for 35 cycles. 2.4. 32P-labeling of internal oligonucleotide probes for Southern and Northern blot analysis 32

P-labelled internal oligonucleotide probes were prepared for hybridization as follows: 20 ng of oligonucloetide (the DNA sequence of internal oligoDNA for each gene listed in Table 3) was mixed with water and boiled in a 1008C water bath for 5 min, followed by mixing with 10 £ kinase buffer, 10 U T4 polynucleotide kinase (Promega, Madison, WI, USA) and g32P-ATP (Perkin Elmer NEN, Boston, MA, USA). The reaction was performed at 378C for 30 min and inactivated by heating at 708C for 15 min. Quick Spine (TE) columns (Boeheringer Mannheim, Indianapolis, IN, USA) were used to separate the labelled internal oligoDNA from residual unlabeled DNA. 2.5. Southern blot RT-PCR products were run on 1·8% agarose gels in 1 £ TAE buffer at 100 V for 2 hr. The gels were photographed with a fluorescent ruler, followed by rinsing with distilled water for 5 min. The gels were then covered with a denaturation solution (1·5 M NaCl/0·5 M NaOH) and gently agitated for 25 min at room temperature. After rinsing with distilled water for 5 min, gels were soaked in neutralization solution (1·5 M NaCl/0·5 M Tris – HCL, pH 7·5) and agitated

for an additional 30 min. DNA was transferred from the agarose gels to Hybond-N nylon membranes (Amersham Biosciences, Piscataway, NJ, USA) by capillary transfer overnight at room temperature. After overnight transfer, the DNA was fixed on the membrane with a UV Crosslinker (FB-UXL-1000, Fisher Scientific, Houston, TX, USA). The membrane was then prehybridized with 10 ml of Rapidhyb-buffer (Amersham Biosciences, Piscataway, NJ, USA) at 428C in a microhybridization oven (Bellco Glass, Inc. Vineland, NJ, USA) for 2 hr. For hybridization, 2 – 10 ml of Rapid-hyb-buffer was mixed with specific 32P-labelled internal oligonucleotides and incubated with a membrane at 428C for 16 – 18 hr. After hybridization, the membrane was washed with 2 £ SSC/0·5% SDS (20 min), 2 £ SSC/0·1% SDS (20 min), 0·1 £ SSC/0·5% SDS (30 min), 0·1 £ SSC/0·1% SDS (30 min) at 428C. Each membrane was exposed to Kodak Biomax Maximum Sensitivity autoradiographic film (Eastman Kodak, Rochester, NY, USA) at 2 708C for 1 – 2 hr. 2.6. Northern blot HLE-B3 cells were maintained in either 20% FBS/MEM (for the 20% FBS group) or 0·5% FBS/MEM (for the serumfree group) and supplemented with either ethanol vehicle (H2O2 only groups) or 1 mM 17b-E2 (H2O2 þ 17b-E2 groups) overnight. Control groups received either 20% FBS/MEM or 0·5% FBS/MEM overnight. The next day the H 2O 2 only groups received fresh media (either 20%FBS/MEM or serum-free MEM) containing 50 mM H2O2 þ ethanol vehicle while the H2O2 þ 17b-E2 groups received fresh media (either 20% FBS/MEM or serum-free MEM) containing 50 mM H2O2 þ 1 mM 17b-E2 over a time course of 1 – 5 hr. Control cells received either 20% FBS/MEM or serum-free MEM. The lower concentration of 50 mM H2O2 was used because preliminary experiments indicated that 100 mM H2O2 produced excessive reductions in mitochondrial transcript levels. Total RNA was extracted from HLE-B3 cells using a TRIzolw Reagent. Purified RNA (3 mg/sample) was separated by electrophoresis in 1·0% agarose – formaldehyde denaturing gels and subsequently blotted to Hybond-N nylon membrane by capillary transfer for 18 hr at room temperature. The membranes were fixed with a UV crosslinker (FB-UXL-1000, Fisher Scientific,

936

A.N. Moor et al. / Experimental Eye Research 78 (2004) 933–944

Houston, TX, USA), prehybridized with 10 ml of Rapidhyb-buffer at 428C in a microhybridization oven for 2 hr followed by hybridization with specific 32P-labelled internal oligonucleotides at 428C for 16– 18 hr. After hybridization, the membranes were washed with 2 £ SSC/0·5% SDS (20 min), 2 £ SSC/0·1% SDS (20 min) at room temperature and exposed to Kodak Biomax Maximum Sensitivity autoradiographic film (Eastman Kodak, Rochester, NY, USA) at 2 700C for 1– 2 hr.

(pH 7·4) and scraped in 1·0 ml of 0·1 M triethanolamine (TEA) buffer containing 2·0 mM EDTA. Cells were sonicated briefly and centrifuged at 28 000g for 15 min. The GAPDH enzyme activity was assayed in a mixture which consisted of 0·065 M TEA, 2·2 mM EDTA, 6·0 mM 3-phosphoglyceric acid, 1·1 mM ATP, 1·3 mM MgSO4, 0·2 mM NADH and 20 units of phosphoglyceric phosphokinase (see Giblin et al., 1990).

2.7. Measurement of H2O2 concentration in serum and serum-free culture medium

HLE-B3 cells were treated with H2O2 and 17b-E2 exactly as described in the GAPDH experiment (see above). Following treatments, cells were rinsed immediately with ice-cold 1 £ PBS (pH 7·4), scrapped in 5 ml of 1 £ PBS (pH 7·4) and centrifuged at 2000 rpm for 7 min. CK enzyme activity was measured according to Bergmeyer (1983). Assay buffer I consisted of an Imidazole buffer(100 mM , pH 7·5) with 2 mM EDTA, 10 mM Mg – acetate, 20 mM D -glucose, 2 mM ADP, 5 mM AMP, 10 mM AP5A, 20 mM NAC, 2 mM NADP, 3000 U l21 HK and 2000 U l21 G6PDH. Assay buffer II consisted of 3 M Creatine-P. The assay was performed by adding 1·0 ml of buffer I to the cuvette þ 50– 100 ml of the cell sample. A baseline was read for 50 sec, followed by the addition of 10 ml of buffer II and CK activity was measured for 2 –5 min.

HLE-B3 cells were maintained in 20% FBS/MEM and the night before the experiment one set of cells was placed in 0·5% FBS/MEM and another set of cells placed in 20% FBS/MEM. This progression into low serum allows a less traumatic transition of cells into serum-free medium the following day. Following this overnight period, the 0·5% FBS/MEM group of cells was switched into 10 ml serumfree MEM and the 20% FBS/MEM group received 10 ml 20% FBS/MEM. Additionally, a parallel experiment was performed that omitted the cells and allowed for the measurement of H2O2 concentrations in medium alone. Initial baseline samples (200 ml) were taken from each of the dishes from both groups (serum and serum-free) and placed directly into 200 ml of ice-cold 0·3 M HClO4 to deproteinize and stabilize them (Bergmeyer, 1983). Both groups then received H2O2 (100 mM final concentration) and samples (200 ml) were taken over a time course of 0, 1, 3, 5, 10, 15, 30, 60 and 180 min and placed directly into 200 ml of ice-cold 0·3 M HClO4 as above. A standard curve and analysis of H2O2 concentration were performed using peroxidase and 2,20 -azino-di-[3-ethyl-benzothiazoline-(6)sulphonic acid] (ABTS) as described in Bergmeyer (1983). Hydrogen peroxide concentrations were measured using a UV –Visible spectrophotometer (UV-1601PC) (Shimadzu Scientific Instruments, Inc., Columbia, MD, USA). 2.8. Glyceraldehyde-3-phosphate dehydrogenase assay HLE-B3 cells were maintained in either 20% FBS/MEM (for the 20% FBS groups) or 0·5% FBS/MEM (for the serumfree groups) and supplemented with either ethanol vehicle (H2O2 only groups) or 1 mM 17b-E2 (H2O2 þ 17b-E2 groups) overnight. Control groups received either 20% FBS/MEM or 0·5% FBS/MEM overnight with or without 1mM 17b-E2. The next day the H2O2 only groups received fresh media (either 20%FBS/MEM or serum-free MEM) containing 100 mM H2O2 þ ethanol vehicle while the H2O2 þ 17b-E2 groups received fresh media (either 20% FBS/MEM or serum-free MEM) containing 100 mM H2O2 þ 1 mM 17b-E2 for 3 hr. Control cells received either 20% FBS/MEM or serum-free MEM with or without 1 mM 17b-E2. Cells were rinsed immediately with ice-cold 1 £ PBS

2.9. Creatine kinase assay

2.10. Measurement of mitochondrial membrane potential using JC-1 staining HLE-B3 cells were treated with H2O2 and 17b-E2 as above (see Section 2.8) with the exception that instead of measuring at 3 hr, a time course was carried out over 0, 90 and 180 min. Following treatments, adherent cells were rinsed with Dulbecco’s Modified Eagle’s Medium (DMEM) without phenol red (Sigma Chemical Co., St Louis, MO, USA) and incubated with DMEM containing 10% serum and 5 mg ml21 JC-1 at 378C for 30 min. JC-1 is a cationic dye that exhibits potential-dependent accumulation of JC-1 monomer from J-aggregates in mitochondria, indicated by a fluorescence emission shift from red (, 590 nm) to green (, 525 nm), as the mitochondrial PTP opens (i.e. depolarizes). Therefore, mitochondrial depolarization is indicated by a decrease in the red/green fluorescence intensity ratio. Polarized mitochondria are thus marked by orange-red fluorescent staining, while depolarized cells will be marked by diffuse green fluorescence. Following incubation in JC-1, cells were rinsed gently with DMEM and digitally photographed with a green filter on an Olympus IMT-2 inverted microscope with an epifluorescent attachment (Olympus Optical Co. Ltd, Tokyo, Japan). 2.11. Statistical analysis Significant differences between groups were determined by an independent sample Student’s t-test (two-tailed) using SPSS version 11·0 for Windows. For all experiments, data

A.N. Moor et al. / Experimental Eye Research 78 (2004) 933–944

937

are reported as mean ^ SD and P values , 0·05 were considered statistically significant.

3. Results 3.1. H2O2 exposure of HLE-B3 cells in serum and serum-free culture medium To define the experimental conditions of H2O2 exposure of cultured lens epithelial cells (HLE-B3), the duration of stability of the peroxide radical in culture medium and the relative amounts of H2O2 taken up by cells versus that amount which is removed from the culture medium due to oxidation of serum components, were determined. Four experimental culture conditions were examined and the extracellular hydrogen peroxide concentration determined post-administration of 100 mM H2O2 to the medium. The four conditions were; 20% fetal bovine serum in minimal essential medium (FBS/MEM) with cells, 20% FBS/MEM without cells (Fig. 1(A)), serum-free MEM with cells and serum-free MEM without cells (Fig. 1(B)). With 20% FBS/MEM in the absence of cells, the concentration of H2O2 (initially 100 mM ) rapidly fell by 50% (, 50 mM ) within 1 min of addition to the culture medium. Thereafter, a gradual decline of peroxide in the culture medium was observed over the next 179 min, so that approximately only 10 mM H2O2 was detectable in the culture medium by the end of the 180 min sampling. When a monolayer of cells was present, peroxide was undetectable 1 min after its addition to the culture medium (Fig. 1(A)). In other words, while , 50 mM peroxide was immediately removed from the medium due to oxidation of serum proteins, the monolayer of epithelial cells was able to remove the remainder (, 50 mM ) within the first minute after addition of 100 mM H2O2 to the culture medium. Under the condition of serum-free MEM without cells, the initial bolus concentration of H2O2 remained relatively constant in the culture medium over the 180 min time course, indicating that little if any H2O2 removal occurred. This is consistent with the fact that in the absence of serum proteins, no loss of peroxide radical by protein oxidation was taking place. However, in the case of serum-free MEM with cells, the concentration of H2O2 fell by 75– 80% within 1 min and H2O2 was undetectable by 60 min (Fig. 1(B)). That is, in the absence of serum components, HLE-B3 cells rapidly take up , 75 mM H2O2 within the first 1 min of exposure to 100 mM H2O2, and the remaining , 20 mM was removed over the next 60 min. Clearly, the ‘buffering’ capacity of serum proteins in the culture medium prevents about , 50% of the peroxide from impacting the cell monolayer; the absence of serum proteins creates a much harsher exposure of peroxide radical to the cultured cells.

Fig. 1. Time course of H2O2 disappearance from culture media: effects of cells and serum. Four conditions were implemented, (A) 20% FBS/MEM with cells (X), 20% FBS/MEM without cells (W), (B) serum-free MEM with cells (X) and serum-free MEM without cells (W). Extracellular H2O2 concentration was monitored over a time course of 0– 180 min from an initial bolus of 0·1 mM (100 mM ) in the culture medium. Results are expressed as means ^ SD from three separate experiments.

3.2. Effect of H2O2 and 17b-E2 on GAPDH and CK activity in HLE-B3 cells To test whether extramitochondrial ATP generating pathways were inhibited by H2O2 and could be protected from H2O2-induced damage by 17b-E2, GAPDH, a key enzyme involved in ATP generation during glycolysis and CK, which catalyzes energy transfer between ATP

938

A.N. Moor et al. / Experimental Eye Research 78 (2004) 933–944

Table 2 Effects of H2O2 and 17b-E2 on creatine kinase (CK) activity in HLE-B3 cells Determination conditions

20% FBS/MEM Serum-free MEM

Units per mg protein Control (3 hr)

Control þ 17b-E2 (3 hr)

100 mM H2O2 (3 hr)

100 mM H2O2 þ 1 mM 17b-E2 (3 hr)

0·082 ^ 0·008 0·073 ^ 0·014

0·091 ^ 0·012 0·078 ^ 0·004

0·087 ^ 0·004 0·062 ^ 0·005

0·076 ^ 0·008 0·060 ^ 0·008

Values represent n ¼ 3 based on three individual cell populations.

and phosphocreatine was assayed using HLE-B3 cells under serum and serum-free conditions. In either 20% FBS/MEM or serum-free medium, GAPDH activity was significantly reduced by peroxide insult to a similar extent as compared to controls; the simultaneous addition of 17b-E2 offered no protective advantage (Table 1). No loss of CK activity was apparent when the 100 mM H2O2 administration was performed in the presence of 20% serum. Under serum-free MEM conditions, 100 mM H2O2 exposure resulted in a slight but measurable reduction of CK enzyme activity (Table 2); 17b-E2 was ineffective in preventing that partial inactivation of CK activity. 3.3. RT-PCR detection of mRNA of genes encoding cellular respiratory enzymes involved in ATP production in HLE-B3 Cells Using several mitochondrial transcripts previously reported to be susceptible to peroxide stress (Carper et al., 1999), we tested whether 17b-E2 could prevent their H2O2induced downregulation. The detection of mRNA for several genes encoding for cellular respiratory enzymes involved in ATP production in HLE-B3 cells was performed using RT-PCR. Table 3 indicates the specific human

oligonucleotide primer pairs designed for each of the genes examined. Total RNA was extracted from cultured HLE-B3 cells and subjected to RT-PCR for NADH subunit 4, NADH subunit 5, cytochrome B and cytochrome c. 16S mitochondrial rRNA, 18S cytoplasmic rRNA and actin were analyzed as reference controls. Each cDNA product yielded one band at the correct predicted molecular weight (data not shown). Sequence analysis confirmed the authenticity of the PCR products (data not shown). Southern blot analysis using exclusive internal oligonucleotides was used to confirm the specificity of the primer pairs directed against NADH subunit 4, NADH subunit 5, cytochrome B, cytochrome c, 16S mitochondrial rRNA and 18S cytoplasmic rRNA. The RT-PCR reaction products were electrophoresed through agarose, in the order, NADH subunit 4, NADH subunit 5, cytochrome B, cytochrome c, 16S mitochondrial rRNA and 18S cytoplasmic rRNA, transferred to nylon membrane and probed with their respective specific radiolabeled internal oligonucleotide. Southern blot using internal oligonucleotides to each primer set showed that there was no overlapping recognition between PCR reaction products and that only a single band was present (data not shown). In this manner, the authenticity of all transcripts detected by coupled RT-PCR were systematically verified.

Table 3 Human oligonucleotide primer pairs Gene (gene bank accession #)

Left/right/internal

Location

PCR product (bp)

NADH subunit 4 (AF346998)

50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50

813 –832 1015–1034 933 –952 582 –601 753 –772 605 –624 540 –559 663 –682 578 –597 299 –318 538 –557 372 –391 795 –814 895 –914 838 –857 1377–1396 1667–1686 1442–1461

203

NADH subunit 5 (AF346998)

Cytochrome B (AF346998)

Cytochrome c (AF346998)

Mitochondrial rRNA 16S (AF346998)

Cytoplasmic rRNA 18S (K03432)

. aacaagctccatctgcctac , 30 . tgtgagtgcgttcgtagttt , 30 . cgcagtcattctcataatcg , 30 . ctcatgagacccacaacaaa , 30 . agtgcttgagtggagtaggg , 30 . cccttctaaacgctaatcca , 30 . ctttcacttcatcttgccct , 30 . gtggaaggtgattttatcgg , 30 . cafcacrccaccrccrarrc , 30 . ccrrrraccactccagccta , 30 . ctgagctttgtaggagggta , 30 . aaatcccctagaagtccac , 30 . taaaaggaactcggcaaatc , 30 . ttaaacatgtgtcactgggc , 30 . catcacctctagcatcacca , 30 . ataacgaacgagactctggc , 30 . gcttatgacccgcacttact , 30 . ttcttagagggacaagtggc , 30

172

124

240

101

291

A.N. Moor et al. / Experimental Eye Research 78 (2004) 933–944

3.4. Effect of H2O2 and 17b-E2 on mitochondrial transcript levels in HLE-B3 cells HLE-B3 cells incubated in the absence or presence of 1 mM 17b-E2 were exposed to 50 mM H2O2 and changes in the abundances of mitochondrial transcripts were analyzed using Northern blot analysis (Fig. 2). In 20% FBS/MEM, 50 mM H2O2 prompted little observable downregulation of the mitochondrial transcripts for cytochrome c and NADH subunits 4 or 5 over the 5 hr time course. However, in serum-free MEM, 50 mM H2O2 caused marked reductions in all three mitochondrial transcripts. Loss of cytochrome c and NADH subunit 5 mRNA levels were most apparent by 3 –5 hr, while NADH subunit 4 showed a decrease as early as 1 hr. Pretreatment and simultaneous addition of 17b-E2 did not prevent the H2O2-induced reduction in mitochondrial transcript levels. 3.5. Effect of H2O2 and 17b-E2 on mitochondrial membrane potential in HLE-B3 cells Mitochondrial membrane potential ðDCm Þ was monitored in HLE-B3 cells using JC-1 staining and fluorescence microscopy. As shown in representative figures, control lens epithelial mitochondria displayed intense red fluorescence

939

from J-aggregates in both 20% FBS/MEM (Fig. 3(A) –(C)) and serum-free MEM conditions (Fig. 4(A) – (C)) throughout the 180 min duration of the experiment. Mitochondria were depolarized 90 min after exposure to 100 mM H2O2: red J-aggregate fluorescence was less prominent, and yellow fluorescence, indicating a mixture of J-aggregates and JC-1 monomers, increased concomitantly (Figs. 3(E) and 4(E)). By 180 min post-administration 100 mM H2O2, mitochondria were depolarized further in both 20% FBS/MEM (Fig. 3(F)) and serum-free conditions (Fig. 4(F)). Closer examination showed that a subpopulation of mitochondria remained polarized in either culture condition as a portion of cells in the field of view retained red fluorescence while a greater percentage of cells were depolarized and showed yellow or green. 17b-E2 appeared to offer significant protection against the H2O2-induced mitochondrial membrane depolarization for cells maintained in 20% FBS/MEM as there was substantially less JC-1 monomers (Fig. 3(I)) compared to H2O2 treated cells in the absence of hormone (Fig. 3(F)). On the other hand, cells maintained in the serum-free culture condition with 17b-E2 (Fig. 4(I)) displayed a degree of JC-1 monomers more similar to the H2O2 treated cells in the absence of 17b-E2 (Fig. 4(F)), indicating that the hormone addition was less effective in the deterrence of mitochondrial membrane depolarization with

Fig. 2. Effect of H2O2 and 17b-E2 on mitochondrial transcript levels in HLE-B3 cells in serum and serum-free culture conditions. Autoradiograph of Northern blot analysis of mitochondrial transcripts encoding respiratory chain proteins (cytochrome c, NADH subunit 4, NADH subunit 5) in control (C) and H2O2treated cells in the presence and absence of 17b-E2 over a time course of 1, 3 and 5 hr. 18S cytoplasmic rRNA was probed to establish equal loading of purified RNA (3 mg/sample).

940

A.N. Moor et al. / Experimental Eye Research 78 (2004) 933–944

Fig. 3. 17b-Estradiol mitigates H2O2-induced mitochondrial depolarization under serum-supplemented conditions. Lens epithelial cell cultures were exposed to 100 mM H2O2 in the presence and absence of 17b-E2 as described in Section 2. Mitochondrial DCm was assessed using JC-1 staining and fluorescence microscopy as described in Section 2. The red fluorescence, indicating polarized mitochondria, was viewed as J-aggregates, whereas the green fluorescence, indicating depolarized mitochondria, was viewed as JC-1 monomers. Yellow fluorescence indicated a mixture of polarized and depolarized mitochondria within individual cells. Lens epithelial cells maintained in H2O2-free 20% FBS/MEM had red fluorescence and trace weak yellow/green fluorescence in individual cells, indicating that the mitochondria were polarized (A –C). Lens epithelial cells subjected to a bolus addition of H2O2 had increasingly low intensity of red fluorescence and strong green fluorescence over the duration of 180 min, indicating that many of these lens epithelial mitochondria were depolarized (D–F). Lens epithelial cells treated with H2O2 and 17b-E2 showed a decreased intensity of red fluorescence and increased yellow (mixture of red/green fluorescence mitochondria) or trace green fluorescence indicating some of the lens epithelial mitochondria were depolarized (G– I). These images are typical of four fields taken from two separate experiments for each treatment. Each field represents the view through a 10 £ objective and identical digital camera settings. The numerical values listed below indicate normalized relative areas of red, green and yellow fluorescence in the field, expressed as percentages. Control at 180 min (Red 95·4, Green 0·1, Yellow 4·5). H2O2 at 180 min (Red 59·7, Green 24·1, Yellow 16·2). H2O2 þ 17b-E2 at 180 min (Red 81·6, Green 2·2, Yellow 16·2).

Fig. 4. 17b-Estradiol fails to prevent H2O2 -induced mitochondrial depolarization under serum-free conditions. Experiments were conducted as described in Section 2 of Fig. 3. Lens epithelial cells maintained H2O2-free in serum-deprived medium had red fluorescence and trace weak yellow/green fluorescence in individual cells, indicating that the mitochondria were polarized (A–C). Lens epithelial cells subjected to a bolus addition of H2O2 exhibited decreased red fluorescence and appearance of yellow and green fluorescence by 180 min, indicating mitochondrial depolarization (D–F). A similar time course of fluorescence changes was observed in 17b-E2-treated cells following H2O2 administration (G –I), indicating that the hormone was less efficient in the prevention of mitochondrial depolarization under the harsher serum-free oxidative condition. These images are typical of four fields taken from two separate experiments for each treatment. Each field represents the view through a 10 £ objective and identical digital camera settings. The numerical values listed below indicate normalized relative areas of red, green and yellow fluorescence in the field, expressed as percentages. Control at 180 min (Red 95·5, Green 0·2, Yellow 4·3). H2O2 at 180 min (Red 51·3, Green 30·2, Yellow 18·5). H2O2 þ 17b-E2 at 180 min (Red 59·2, Green 18·6, Yellow 22·2).

A.N. Moor et al. / Experimental Eye Research 78 (2004) 933–944

the more severe serum-free H2O2 exposure. This higher concentration of H2O2 is clearly a more pathologic insult from which cells exhibit less ability to recover.

4. Discussion Mitochondrial dysfunction resulting from oxidative stress has been implicated in the pathologic cascade which culminates in cellular death. Estrogens have been proposed to exert a stabilizing effect on mitochondria and mitigate mitochondrial-mediated apoptotic cell death linked with mitochondrial distress (Dykens and Stout, 2001; Dykens et al., 2002; Dykens et al., 2003; Wang et al., 2003). The conclusions drawn from the present study confirmed that mitochondria rank among the selective targets for oxidative damage in cultured human lens epithelial cells. Estrogen proved cytoprotective against oxidative stress and under a defined set of culture conditions, maintained mitochondrial integrity and thereby prevented mitochondrial depolarization, likely by stabilizing the PTP against opening. This study employed the use of human lens epithelial cells maintained in both serum-supplemented and serum-free culture conditions. The effects of H2O2 on several cellular energy-metabolizing processes were examined, and the ability of 17b-E2 to exert antioxidative cytoprotection was tested. Wang et al. (2003) showed significant accumulations of reactive oxygen species (ROS) in HLE-B3 cells exposed to H2O2 in the presence of 20% serum but did not monitor H2O2 concentration in the culture medium over the duration of H2O2 exposure. Serum proteins such as albumin exhibit antioxidative properties and can detoxify ROS (Kouoh et al., 1999). Therefore, it was essential to determine the amounts of H2O2 taken up or neutralized by the cells versus the amounts buffered by serum components in the culture medium (Fig. 1). In serum-free conditions, cells rapidly removed approximately 75% of the 100 mM H2O2 bolus within 1 min, and the remainder (,20%) within 60 min. In contrast, less than 50% of the H2O2 bolus was removed by cells in serum-containing MEM, since half the bolus was rapidly detoxified by serum components within the first minute. Therefore, the bolus addition of H2O2 to the serumsupplemented medium produced a more moderate exposure of the cultured cells to oxidative insult. Nevertheless, the amount of H2O2 entering cells maintained in 20% FBS/ MEM was sufficient to exert injurious, albeit less harsh, effects. Conditions in which aqueous humor H2O2 concentrations are increased inflict oxidative damage to the lens culminating in cataract. The physiological concentration of hydrogen peroxide in aqueous humor has been reported to be in the range of 25 – 60 mM . However, the precise physiological range of H2O2 concentration in the aqueous humor is controversial. Depending upon the method of detection employed, oxygen tension, temperature

941

and ascorbate concentration, to name just a few of the variables, peroxide concentration in the aqueous humor has been reported to be less than 10 mM (Sharma et al., 1997; Bleau et al., 1998) and as high as 100 mM (Spector et al., 1998). Moreover, H2O2 concentrations in the aqueous humor of cataract patients can vary from 10 to 660 mM (Spector and Garner, 1981; Ramachandran et al., 1991). The peroxide insult employed throughout these studies was designed to be in the physiologic (, 50 mM ) to near physiologic (, 100 mM ) range depending upon whether the cells were sustained under conditions which included serum-supplementation or were maintained serumdeprived, respectively. We recently reported that the cell death induced in cultured human lens epithelial cells by H2O2 is associated with accumulation of intracellular ROS, collapse of mitochondrial membrane potential ðDcm Þ; and profound depletion of ATP. On the other hand, estrogens appeared to mitigate mitochondrial collapse of Dcm ; ATP depletion and cell death without affecting total production of ROS (Wang et al., 2003). In the current study, experiments were designed to further delineate the mechanism by which 17b-E2 could act to minimize the damaging effects of H2O2 exposure to HLE-B3 cells. We examined three potential cellular targets of H2O2, which, if impaired by the oxidant, could account for the oxidative stress-induced depletion of intracellular ATP, and sought to determine whether 17b-E2 administration prevented such impairments. Hydrogen peroxide has been reported to induce specific expressed gene changes in H2O2-treated lens epithelial cells in culture, including genes involved in cellular respiration and mRNA and peptide processing (Carper et al., 1999). In that study, it was reported that mitochondrial transcripts were disproportionately affected by oxidative stress. Reductions in mitochondrial transcript levels resulting from oxidative stress have also been reported in hamster fibroblasts (Crawford et al., 1997). On this basis several mitochondrial gene products involved in cellular respiration were selected for study in this investigation. In accordance with earlier reports, as little as 50 mM H2O2 sharply lowered mitochondrial mRNA encoding NADH subunits 4, 5 and cytochrome c in serum-free culture medium (Fig. 2). Pretreatment and simultaneous addition of 17b-E2 during H2O2 challenge to HLE-B3 cells in serum-free medium did not prevent the loss of mitochondrial transcript levels. Therefore, improved gene transcription of cellular respiratory enzymes by 17b-E2 did not appear to be responsible for the hormone’s protection of intracellular ATP levels. Several enzyme components of the cellular ATPgenerating metabolic machinery are inactivated by reactive oxygen intermediates. Conceivably, 17b-E2 could ameliorate oxidant-induced ATP depletion by protecting these enzymes from oxidative damage, thereby preserving cellular ATP synthesis. Two well-known targets of H2O2, glyceraldehyde 3-phosphate dehydrogenase (Chatham et al., 1989; Reddan et al., 1993; Janero et al., 1994; Mallet et al.,

942

A.N. Moor et al. / Experimental Eye Research 78 (2004) 933–944

2002) and CK (Suzuki et al., 1992; Mekhfi et al., 1996; Genet et al., 2000) were examined in this study. Both enzymes contain sulfhydryl groups crucial for catalytic activity which are selectively oxidized by H2O2 (Suzuki et al., 1992; Kim et al., 2002). GAPDH inactivation by H2O2 limits glycolytic flux and causes accumulation of upstream glycolytic intermediates (Chatham et al., 1989; Mallet et al., 2002). In this study, partial inactivation of GAPDH by H2O2 persisted for at least 3 hr after the oxidant was administered. However, cytoprotective concentrations of 17b-E2 did not mitigate this GAPDH inactivation (Table 1). Moreover, we tested whether the bolus addition of 100 mM H2O2, in the presence or absence of serum supplementation, might not be too caustic an exposure to permit estradiol recovery action. To that end, cells were exposed to 50 mM H2O2 in the presence or absence of 1 mM 17b-E2 for 3 hr with and without serum supplementation. Under these conditions, GAPDH activity (expressed as units/mg protein) was also inactivated relative to control values (albeit less so than with 100 m M H2 O2 ); 0·172 ^ 0·039 (þ 17b-E 2) and 0·176 ^ 0·032 (2 17b-E2) with 20% FBS/MEM and 0·479 ^ 0·036 (þ 17b-E2) and 0·518^ 0·060 (2 17b-E2) in serum-free MEM. Again, 17b-E2 did not alleviate GAPDH inactivation. By catalyzing the reversible transfer of high-energy phosphate bonds between ADP and creatine, CK isoenzymes shuttle metabolic energy from the mitochondria to energy-consuming ATPases elsewhere in the cell (Saks et al., 1994). This system is most active in tissues with highenergy demands including brain, skeletal muscle and myocardium. In neonatal human lens, the only isoform of CK expressed is a variant cathodic CK. By sexual maturation, there is a dramatic increase in the expression of BB creatine kinase (Friedman et al., 1989). CK likely localizes in the lenticular epithelium. CK activity, to the best of our knowledge, unreported in cultured lens epithelium, was detectable; however, this activity was only minimally impaired 3 hr after H2O2 administration, and was unaffected by 17b-E2 (Table 2). Although these results seem to indicate that 17b-E2 did not impact GAPDH or CK, it should be noted that the enzymes were measured in cells harvested more than 2 hr after H2O2 had disappeared from the culture media. In myocardium, GAPDH was markedly inactivated by 10 min exposure to 100 mM H2O2, but the enzyme spontaneously recovered over the subsequent 90 min H2O2-free perfusion (Mallet et al., 2002). Thus, it is conceivable that lens epithelial GAPDH and/or CK may have been more severely impaired at earlier time points, but subsequently recovered. In that case, 17b-E2 may have protected the enzymes from such severe but transient inactivation. Loss of intracellular ATP and ensuing cell death may be initiated in mitochondria by either a PTP-dependent mechanism (Susin et al., 1998) or one of two PTPindependent mechanisms (Vander Heiden et al., 1997;

Yang et al., 1997) via activation of apoptotic cascades. Our results with JC-1 staining suggest a PTP-dependent mechanism and supports the notion that 17b-E2 acts by stabilizing the PTP against depolarization (Figs. 3 and 4). We do not, as yet, know the precise mode of action for the cytoprotective effects by 17b-E2 in HLE-B3 cells. Previous data from this laboratory, based on fluorescence resonance energy transfer between two dyes; nonyl acridine orange, which stains cardiolipin, lipid found exclusively in the mitochondrial inner membrane and tetramethylrhodamine, a potentiometric dye taken up by mitochondria, demonstrated that at a given Ca2þ or oxidative load, a larger portion of the mitochondrial population retains Dcm and hence continues to function in the presence of 17b-E2 (Wang et al., 2003). Such a response readily explains preservation of ATP levels by estradiols during exposure to H2O2, as well as repression of necrotic and apoptotic cell death. Although comprehensive investigation of apoptotic mechanisms was beyond the scope of this study, the current findings support activation by H2O2 of a recognized mitochondrially-induced apoptotic cascade which is mediated by opening the mitochondrial PTP (He et al., 2000). Such a mechanism might account, at least in part, for the H2O2 associated cell death and ATP depletion reported by Wang et al. (2003). Although the mechanism of estrogen-mediated cytoprotection against H2O2-induced mitochondrial dysfunction remains to be determined, several possibilities exist. The peroxide-induced collapse of mitochondrial membrane potential in HLE-B3 cells is an event that eliminates the driving force for mitochondrial ATP production as oxidative insult readily represses electron transport efficiency and oxidative phosphorylation, primarily by inactivating both the Fe – S reaction centers of several of the electron transport respiratory centers, and heme moieties in the cytochromes (Dykens, 1994, 1997). Oxidative stress exacerbates subsequent free radical production, which compromises cellular, and mitochondrial integrity by inducing peroxidation of membrane lipids and impeding oxidative phosphorylation. The resulting acute loss of ATP impairs the transmembrane ion-dependent ATPases, thereby precipitating cell death from osmotic failure (Dykens, 1999). Furthermore, estrogens have been shown to prevent calcium-induced cytochrome c release from heart mitochondria (Morkuniene et al., 2002), and to promote increased mitochondrial sequestration of cytosolic Ca2þ coupled with an increase in Bcl-2 expression to sustain mitochondrial Ca2þ load tolerance and function (Nilsen and Diaz Brinton, 2003). Another possibility is that 17b-E2 interacts directly with mitochondria by binding to the mitochondrial PTP thereby preventing oxidation of sensitive vicinal dithiol groups in the ‘S-site’ and ‘Psite’ of the PTP (Bernardi, 1999). Moreover, estrogens might affect mitochondrial lipid peroxidation. In this regard, it has been shown that physiological

A.N. Moor et al. / Experimental Eye Research 78 (2004) 933–944

concentrations of 17b-E2 reduce lipid peroxidation in neuronal cultures (Gridley et al., 1998), possibly by inserting into the plane of the inner mitochondrial membrane (J.W. Simpkins, personal communication). Whilst soluble ROS provoke lipid peroxidation, estradiols donate protons to damaged mitochondrial lipids, effectively reversing oxidative damage and maintaining membrane integrity. Suggestive evidence exists for the association of estradiol with mitochondria in vivo. Monje and Boland (2002) have identified naturally occurring b estrogen receptors in the mitochondria of uterine and mammary cell lines, and shown by Western blot and ligand blotting, that estradiol associates with the b estrogen receptor in isolated mitochondrial fractions. We recently confirmed the presence of wild type b estrogen receptor in mitochondria of HLE-B3 cells (Cammarata et. al., 2004). Alternatively, protection by estradiol against peroxide-induced mitochondrial dysfunction does not necessarily require the direct interaction of the hormone with mitochondrial membrane. Estradiol could be acting as a free radical scavenger. H2O2 is a potent diffusible pro-oxidant that initiates a series of oxidative events in cells. We previously demonstrated that 17b-E2 at concentrations ranging from low physiological (1 nM ) to pharmacological (10 mM ) were unable to dampen the intracellular accumulation of ROS due to H2O2 exposure. Therefore, the cytoprotective effects of 17b-E2 in the cultured human lens epithelial cells are clearly not mediated by changes in the accumulation or clearance of intracellular soluble ROS (Wang et al., 2003), so the hormone is likely not acting as a free radical scavenger. Death signal-induced localization of p53 protein to mitochondria has been suggested as an apoptotic signalling pathway preceding changes in mitochondrial membrane potential, cytochrome c release and procaspase-3 activation (Marchenko et al., 2000). Estradiol has been shown to inhibit NF-kappaB activation by an antioxidant mechanism in oxidatively stressed hepatocytes (Omoya et al., 2001). However, other workers have shown that estradiol does not prevent degradation of IkappaB-alpha suggesting the existence of estrogen-sensitive pathways, other than IkappaB-alpha regulation, to modulate NF-kappaB (Galea et al., 2002). It is conceivable that estradiol, through a pathway that remains to be determined, modulates NF-kappaB activation, and in doing so prevents the targeting of p53 protein to mitochondria thereby abrogating oxidative stressinduced apoptotic signalling. Experiments are currently in progress to determine by which of these mechanisms estrogens may be acting to protect cultured lens cells against oxidative stress-mediated cell death.

Acknowledgements This work was supported by Public Health National Service Awards to F.J.G. (EY02027) and P.R.C.

943

(EY05570). The authors wish to thank Victor Leverenz, Melissa Worthy, Zhaohui Wang and Bhooma Srinivasan for their technical support and Dr Lawrence X. Oakford for graphics assistance in the preparation of this manuscript.

References Andley, U.P., Rhim, J.S., Chylack Jr., L.T., Flemming, T.P., 1994. Propagation and immortalization of human lens epithelial cells in culture. Invest. Ophthalmol. Vis. Sci. 35, 3094–3102. Bergmeyer, H.U., 1983. Methods of Enzymatic Analysis, Third Ed, Academic Press, New York, NY, USA. Bernardi, P., 1999. Mitochondrial transport of cations: channels, exchangers, and permeability transition. Physiol. Rev. 79, 1127–1155. Bigsby, R.M., Cardenas, H., Caperell-Grant, A., Grubbs, C.J., 1999. Protective effects of estrogen in a rat model of age-related cataracts. Proc. Nat. Acad. Sci. USA 96, 9328–9332. Bleau, G., Giasson, C., Brunette, I., 1998. Measurement of hydrogen peroxide in biological samples containing high levels of ascorbic acid. Anal. Biochem. 263, 13 –17. Cammarata, P.R., Chu, S., Moor, A., Wang, Z., Yang, X., Simpkins, J.W., 2004. Subcellular distribution of native estrogen receptor a and b subtypes in cultured human lens epithelial cells. Exp. Eye Res. 78(4), 861–871. Carper, D.A., Sun, J.K., Iwata, T., Zigler Jr., J.S., Ibaraki, N., Lin, L., Reddy, V., 1999. Oxidative stress induces differential gene expression in a human lens epithelial cell line. Invest. Ophthalmol. Vis. Sci. 40, 400– 406. Chatham, J.C., Gilbert, H.F., Radda, G.K., 1989. The metabolic consequences of hydroperoxide perfusion on the isolated rat heart. Eur. J. Biochem. 184, 657 –662. Crawford, D.R., Wang, Y., Schools, G.P., Kochheiser, J., Davies, J.A., 1997. Down-regulation of mammalian mitochondrial RNAs during oxidative stress. Free Radic. Biol. Med. 22, 551–559. Cumming, R.G., Mitchell, P., 1997. Hormone replacement therapy, reproductive factors, and cataract. The Blue Mountains Eye study. Am. J. Epidemiol. 145, 242–249. Dykens, J.A., 1994. Isolated cerebellar and cerebral mitochondria produce free radicals when exposed to elevated Ca2þand Naþ: implications for neurodegeneration. J. Neurochem. 63, 584–591. Dykens, J.A., 1997. Mitochondrial free radical production and the etiology of neurodegenerative disease. In: Beal, M. F., Bodis-Wollner, I., Howell, N. (Eds.), Neurodegenerative Diseases: Mitochondria and Free Radicals in Pathogenesis, Wiley, New York, pp. 29–55. Dykens, J.A., 1999. Free radicals and mitochondrial dysfunction in excitotoxicity and neurodegenerative diseases. In: Koliatos, V. E., Ratan, V.V. (Eds.), Cell Death and Diseases of the Nervous System, Humana, Totowa, NJ, pp. 45 –68. Dykens, J.A., Fleck, B., Ghosh, S., Lewis, M., Velicelebi, G., Ward, M., 2002. A novel FRET-based assay of mitochondrial membrane potential in situ. Mitochondrion 1, 461– 473. Dykens, J.A., Simpkins, J.W., Wang, J., Gordon, K., 2003. Polycyclic phenols, estrogens and neuroprotection: a proposed mitochondrial mechanism. Exp. Gerontol. 38, 101–107. Dykens, J.A., Stout, A.K., 2001. Fluorescent dyes and assessment of mitochondrial membrane potential in FRET modes. Meth. Cell Biol. 65, 285– 309. Freeman, E.E., Munoz, B., Schein, O.D., West, S.K., 2001. Hormone replacement therapy and lens opacities: the Salisbury Eye evaluation project. Arch. Ophthalmol. 119, 1687–1692. Friedman, D.L., Hejtmancik, J.F., Hope, J.N., Perryman, M.B., 1989. Developmental expression of creatine kinase isozymes in mammalian lens. Exp. Eye Res. 49, 445 –457. Galea, E., Santizo, R., Feinstein, D.L., Adamson, P., Greenwood, J., Koenig, H.M., Pelligrino, D.A., 2002. Estrogen inhibits NF kappa

944

A.N. Moor et al. / Experimental Eye Research 78 (2004) 933–944

B-dependent inflammation in brain endothelium without interfering with I kappa B degradation. Neuroreport 13, 1469– 1472. Genet, S., Kale, R.K., Baquer, N.Z., 2000. Effects of free radicals on cytosolic creatine kinase activities and protection by antioxidant enzymes and sulfhydryl compounds. Mol. Cell Biochem. 210, 23–28. Giblin, F.J., Reddan, J.R., Schrimscher, L., Dziedzic, D.C., Reddy, V.N., 1990. The relative roles of the glutathione redox cycle and catalase in the detoxification of H2O2 by cultured rabbit lens epithetlial cells. Exp. Eye Res. 50, 795 –804. Gridley, K.E., Green, P.S., Simpkins, J.W., 1998. A novel, synergistic interaction between 17 beta-estradiol and glutathione in the protection of neurons against beta-amyloid 25-35-induced toxicity in vitro. Mol. Pharmacol. 54, 874 –880. Hales, A.M., Chamberlain, C.G., Murphy, C.R., McAvoy, J.W., 1997. Estrogen protects lenses against cataract induced by transforming growth factor-beta (TGFbeta). J. Exp. Med. 185, 273–280. Harding, J.J., 1994. Estrogens and cataract. Arch. Ophthalmol. 112, 1511. He, L., Poblenz, A.T., Medrano, C.J., Fox, D.A., 2000. Lead and calcium prodice rod photoreceptor cell apoptosis by opening the mitochondrial permeability transition pore. J. Biol. Chem. 275, 12175– 12184. Hyslop, P.A., Hinshaw, D.B., Halsey Jr., W.A., Schraufsta¨tter, I.U., Sauerheber, R.D., Spragg, R.G., Jackson, J.H., Cochrane, C.G., 1988. Mechanisms of oxidant-mediated cell injury. J. Biol. Chem. 263, 1665–1675. Janero, D.R., Hreniuk, D., Sharif, H.M., 1994. Hydroperoxide-induced oxidative stress impairs heart muscle cell carbohydrate metabolism. Am. J. Physiol. Cell Physiol. 266, C179–C188. Kim, J.R., Kwon, K.S., Yoon, H.W., Lee, S.R., Rhee, S.G., 2002. Oxidation of proteinaceous cysteine residues by dopamine-derived H2O2 in PC12 cells. Arch. Biochem. Biophys. 397, 414–423. Klein, B.E., Klein, R., Ritter, L.L., 1994. Is there evidence of an estrogen effect on age-related lens opacities? The Beaver Dam Eye study. Arch. Ophthalmol. 112, 85 –91. Kouoh, F., Gressier, B., Luyckx, M., Brunet, C., Dine, T., Cazin, M., Cazin, J.C., 1999. Antioxidant properties of albumin: effect on oxidative metabolism of human neutrophil granulocytes. Farmaco 54, 695–699. Mallet, R.T., Squires, J.E., Bhatia, S., Sun, J., 2002. Pyruvate restores contractile function and antioxidant defences of hydrogen peroxidechallenged myocardium. J. Mol. Cell Cardiol. 34, 1173– 1184. Marchenko, N.D., Zaika, A., Moll, U.M., 2000. Death signal-induced localization of p53 protein to mitochondria. A potential role in apoptotic signaling. J. Biol. Chem. 275, 16202–16212. Mekhfi, H., Veksler, V., Mateo, P., Maupoil, V., Rochette, L., VenturaClapier, R., 1996. Creatine kinase is the main target of reactive oxygen species in cardiac myofibrils. Circ. Res. 78, 1016– 1027. Monje, P., Boland, R., 2002. Expression of cellular localization of naturally occurring b estrogen receptors in uterine and mammary cell lines. J. Cell Biochem. 86, 136–144. Morkuniene, R., Jekabsone, A., Borutaite, V., 2002. Estrogens prevent calcium-induced release of cytochrome c from heart mitochondria. FEBS Lett. 521, 53– 56.

Nilsen, J., Diaz Brinton, R., 2003. Mechanism of estrogen-mediated neuroprotection: regulation of mitochondrial calcium and Bcl-2 expression. Proc. Nat. Acad. Sci.USA 100, 2842– 2847. Omoya, T., Shimizu, I., Zhou, Y., Okamura, Y., Inoue, H., Lu, G., Itonaga, M., Honda, H., Nomura, M., Ito, S., 2001. Effects of idoxifene and estradiol on NF-kappa B activation in cultured rat hepatocytes undergoing oxidative stress. Liver 21, 183 –191. Ramachandran, S., Morris, S.M., Devamanoharan, P., Henein, M., Varma, S.D., 1991. Radio-isotopic determination of hydrogen peroxide in aqueous humor and urine. Exp. Eye Res. 53, 503 –506. Reddan, J.R., Sevilla, M.D., Giblin, F.J., Padgaonkar, V., Dziedzic, D.C., Leverenz, V., Misra, I.C., Peters, J.L., 1993. The superoxide dismutase mimic TEMPOL protects cultured rabbit lens epithelial cells from hydrogen peroxide insult. Exp. Eye Res. 56, 543 –554. Saks, V.A., Khuchua, Z.A., Vasilyeva, E.V., Belikova, O.Y., Kuznetsov, A.V., 1994. Metabolic compartmentation and substrate channelling in muscle cells. Role of coupled creatine kinases in in vivo regulation of cellular respiration—a synthesis. Mol. Cell Biochem. 133 – 134, 155 –192. Sharma, Y., Druger, R., Mataic, D., Bassnet, S., Beebe, D.C., 1997. Aqueous humor hydrogen peroxide and cataract. Invest. Ophthalmol. Vis. Sci. 38, S1149. Spector, A., Garner, W.H., 1981. Hydrogen peroxide and human cataract. Exp. Eye Res. 33, 673–681. Spector, A., Garner, W.H., 1982. Uncoupling of Na/K ATPase by H2O2. Fed. Proc. Fed. Am. Soc. Exp. Biol. 41, 1370. Spector, A., Ma, W., Wang, R.R., 1998. The aqueous humor is capable of generating and degrading H2O2. Invest. Ophthalmol. Vis. Sci. 39, 1188–1197. Susin, S.A., Zamzami, N., Kroemer, G., 1998. Mitochondria as regulators of apoptosis: doubt no more. Biochim. Biophys. Acta 1366, 151 –165. Suzuki, Y.J., Edmondson, J.D., Ford, G.D., 1992. Inactivation of rabbit muscle creatine kinase by hydrogen peroxide. Free Radic. Res. Commun. 16, 131–136. Vander Heiden, M.G., Chandel, N.S., Williamson, E.K., Schumacker, P.T., Thompson, C.B., 1997. Bcl-xL regulates the membrane potential and volumje homeostasis of mitochondria. Cell 91, 627–637. Weintraub, J.M., Taylor, A., Jacques, P., 2002. Postmenopausal hormone use and lens opacities. Opthal. Epidemiol. 9, 179 –190. Wang, X., Simpkins, J.W., Dykens, J.A., Cammarata, P.R., 2003. Oxidative damage to human lens epithelial cells in culture: estrogen protection of mitochondrial potential, ATP, and cell viability. Invest. Ophthalmol. Vis. Sci. 44, 2067– 2067. Yang, J., Liu, X., Bhalla, K., Kim, C.N., Ibrado, A.M., Cai, J., Peng, T.L., Jones, D.P., Wang, X., 1997. Protection of apoptosis by Bcl-2: release of cytochrome c from mitochondria blocked. Science 275, 1129– 1132. Younan, C., Mitchell, P., Cumming, R.G., Panchapakesan, J., Rochtchina, E., Hales, A.M., 2002. Hormone replacement therapy, reproductive factors, and the incidence of cataract and cataract surgery: The Blue Mountains Eye study. Am. J. Epidemiol. 155, 997 –1006.