- Email: [email protected]
A rapid and efficient one-step site-directed deletion, insertion, and substitution mutagenesis protocol
Analytical Biochemistry 434 (2013) 254–258
Contents lists available at SciVerse ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
A rapid and efficient one-step site-directed deletion, insertion, and substitution mutagenesis protocol Deguang Wu, Xuewu Guo, Jun Lu, Xi Sun, Feng Li, Yefu Chen, Dongguang Xiao ⇑ Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education, Tianjin Industrial Microbiology Key Laboratory, College of Biotechnology, Tianjin University of Science and Technology, Tianjin 300457, China
a r t i c l e
i n f o
Article history: Received 29 September 2012 Received in revised form 9 November 2012 Accepted 20 November 2012 Available online 19 December 2012 Keywords: Site-directed mutagenesis Separate PCR amplification Homologous recombination One-step ligation Mutation frequency
a b s t r a c t A rapid and efficient site-directed mutagenesis (SDM) protocol based on two separate polymerase chain reaction (PCR) amplifications and homologous recombination in Escherichia coli is described. This protocol can introduce deletions, substitutions, and insertions into any amplifiable site of the target genes by ligating two amplified DNA fragments into vectors. Compared with previously reported PCR-based SDM methods, our protocol significantly prevents primer dimerization even though partially complementary primers were used for PCR. The genome with the target gene was used directly as template, and DpnI was unnecessary. All of the procedures were performed within 24 h. The mutation frequencies of deletion, substitution, and insertion of the PEP4 (encode proteinase A) gene of Saccharomyces cerevisiae were nearly 100% using this new method. Thus, this method can potentially facilitate high-throughput genetic engineering and structure–function analyses and is useful for molecular biological research. Ó 2013 Elsevier Inc. All rights reserved.
Site-directed mutagenesis (SDM)1 has increasingly become an indispensable tool to study the relationship of the structure–function of gene and proteins. This tool is most frequently used to introduce mutations at different sites of the open reading frame of target genes and evaluate the effects on protein function [1]. Several polymerase chain reaction (PCR)-based traditional SDM methods, including megaprimer, overlap extension, and inverted PCRs, as well as a modified protocol of these methods [2–8] are routinely used for mutagenesis. However, these methods require two PCR rounds, multiple steps of enzymatic treatment, and primer or template purification or modification. With the application of the QuikChange SDM system (QCM) developed by Stratagene (La Jolla, CA, USA), numerous commercial SDM kits, such as the Mutan km system from TaKaRa (Madison, WI, USA), the Phushion system from Finnzyme (Espoo, Finland), and the GeneTailor system from Invitrogen (New York, NY, USA), can be easily purchased on the market. However, these kits and their modified versions hardly overcome the limiting melting point and the forming primer dimer because their mutant primers contain the complementary region. The QCM-like kits require either phosphorylated primers or an extra step [9]. Numerous novel SDM methods based on the QCM-like kits have been developed during recent years to address these problems [10–18]. Most of ⇑ Corresponding author. Fax: +86 022 60602298. E-mail address: [email protected] (D. Xiao). Abbreviations used: SDM, site-directed mutagenesis; PCR, polymerase chain reaction; QCM, QuikChange SDM system. 1
0003-2697/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ab.2012.11.028
these methods have been applied and are efficient. These methods can be widely used for various difficult-to-construct mutants, which the traditional SDM protocol cannot perform. However, these newly developed SDM methods have common disadvantages, including cloning the target gene into vectors and digesting the parental template with the DpnI after PCR amplification. The full-length plasmid sequence is amplified for any mutant type, during which PCR errors may occur, although a high-fidelity DNA polymerase is used. In general, the longer the fragments amplified, the greater the total number of PCR errors will be. In some of these methods, various extra steps, such as two-stage PCR, gel purification of PCR products, denaturation, and annealing, are expensive and time-consuming. In this study, based on the circularization of linear DNA products via homologous recombination in vivo [19], we describe a rapid and efficient protocol dependent on two separate PCR amplifications and one-step ligation to introduce deletions, insertions, and substitutions into any amplifiable site of the target genes. This method allows mutant generation at a mutagenic frequency of close to 100% and also has numerous advantages over those aforementioned strategies. Materials and methods Plasmid and strains The pUC19 (2686 bp) plasmid, which was purchased from TaKaRa, was used as the original vector to introduce mutations.
One-step site-directed mutagenesis protocol / D. Wu et al. / Anal. Biochem. 434 (2013) 254–258
Escherichia coli DH5a was used to construct plasmids. The genome of the industrial brewing yeast, Saccharomyces cerevisiae S6 (our laboratory), was used as the template to amplify mutagenic segments of the PEP4 gene of S. cerevisiae [20] by PCR. Preparation of DNA and primers Plasmid DNA was prepared from E. coli by a plasmid DNA extraction kit (Solarbio, Beijing, China). Genomic DNA was prepared from S. cerevisiae S6 by a yeast genomic DNA extraction kit (Solarbio). All oligonucleotide primers were synthesized and purified by DingGuo ChangSheng Biotech (Beijing, China). The detailed sequences of these oligonucleotide primers are listed in Table 1. Amplification, purification, and digestion of target gene The PCR amplifications were carried out with a general PCR system. Two segments of the target gene were simultaneously amplified by two separate PCR amplifications in each mutant type (deletion, insertion, and substitution). These segments were named A and B. The 50-ll PCR mixture consisted of 1 ll of genomic DNA as template (100 ng), 1 ll of each primer (0.4 lM each), 5 ll of dNTP mixture, 10 ll of 5 buffer, 31 ll of distilled H2O, and 1 ll of Pfu DNA polymerase (2.5 U). The reaction started with template pre-denaturation at 95 °C for 5 min, followed by 25 cycles of 94 °C for 45 s, 63 °C for 45 s, and 72 °C for 70 s and then an extension step at 72 °C for 10 min. Finally, the solution was stored at 4 °C before the next step. In this experiment, all six PCRs were performed using the same procedure and reaction parameters. The PCR amplification products were evaluated by agarose gel electrophoresis and purified by an Omega PCR purification kit. The A and B segments were digested with restriction enzymes BamHI and SphI, respectively. The pUC19 plasmid was digested with BamHI and SphI. A 40-ll reaction mixture also contained the collected DNA and 2 ll of related restriction enzymes in 1 digestion buffer. The mixture was incubated at 37 °C for 2 h, followed by another purification step with the aforementioned DNA purification kit. The digested pUC19 plasmid and DNA products were later used for a ligation reaction in one tube. Ligation, transformation, and verification of recombinant plasmids For any mutant type, the A and B segments were always ligated with the digested pUC19 plasmid in a ligation reaction. The ligation mixture (20 ll) contained the digested A and B segments (4 ll each, 500 ng), 2 ll of digested pUC19 plasmid (100 ng), and 700 U of T4 DNA ligase (TaKaRa) in 1 ligation buffer supplied in the kit. The ligation mixture was incubated at 16 °C for 1 to 2 h.
Next, the 20-ll ligation solution was used for transformation with DH5a-competent bacteria. We plated 200 ll of solution onto a single Luria–Bertani (LB)/ampicillin plate, incubated at 37 °C overnight, and screened for desired mutants. The introduction of SDM was checked by plasmid DNA sequencing (BGI, Beijing, China) and several restriction enzymatic digestions. The digested product was loaded on 1% agarose gel in 1 TAE buffer and observed with ultraviolet (UV) light.
Results Outline of principle of method The outline of principle of method is illustrated in Fig. 1, which shows that we developed an easy four-step protocol that can be completed within 24 h. Step 1: Primers design Two pairs of primers should be prepared to generate a mutant. These primer pairs consist of two flanking (A-up and B-down) primers and two internal (A-down and B-up) primers, which comprise two major parts: a 50 -complementary region containing the target mutant sequences and an 8-bp minimum [18] 30 -template annealing region. The primers were designed to anneal to the template sequences flanking the target sites, which were sequences for deletion/substitution or introduction of insertion. The 50 -complementary sequences of internal primers, which were to become overlapping sequences in step 2 and used as homologous arms in vivo homologous recombination of step 4, varied from case to case. For insertion or substitution, the 50 -complementary sequences included the foreign sequences to be introduced. For deletion, the 50 -complementary sequences included at least 4 bp [19] from each side of the region to be deleted. Step 2: PCR amplification of two DNA segments For any mutant type, two mutagenic segments, A and B, of the target gene were amplified from genomic DNA template by two separate PCR amplifications. A-up and A-down primers were used for the A segment, whereas B-up and B-down primers were used for the B segment. After amplification, the upstream of A and the downstream of B contained the restriction enzyme sites I and II, which were used for ligation of A and B segments to vectors and generation of linear recombinant vectors in step 3. The downstream of A and the upstream of B contained the overlapping sequences, which were used for circularization of linear recombinant vectors by in vivo homologous recombination in step
Table 1 PCR primers used in this study. Primer name
Sequence (50 ? 30 )
Restriction site
DA-up
CGCGGATCCGAGAGAAGATGGTAGATACC GTGACCACCTGCAGCAACTTGGTTGGCGCTGAC GTTGCTGCAGGTGGTCACGATGTTCCATTGAC
BamHI
DA-down DB-up DB-down SA-up SA-down SB-up SB-down IA-up IA-down IB-up IB-down
255
TCAAGCATGCCTAGAGCGCAGCCTGTGAATCT GCGGATCCCGTAACCAAGGACAAATACCCAT TTTCTGAGGTACCGCTAAGCATGAGCTAAATGTTGCTCGAAAGTGAC GCTTAGCGGTACCTCAGAAATCAATTTGAGAAAGCTAACCCCGAAGT CCTAGGCATGCTTATTTTTCGCTTCTGCTTAC AGGGGATCCTAACCAAGGACAAATACCCATAG AGCTGAGGTACCACGGTCACTTTTGGCCTAAATGAGCTAAATG GACCGTGGTACCTCAGCTACTTGACTCAATTTGAGAAAGCTAAC CCGTGCATGCTATTTTTCGCTTCTGCTTAC
– – SphI BamHI – – SphI BamHI – – SphI
Note: The first letters of the primer names listed above—D, S, and I—represent the deletion, substitution, and insertion mutagenesis primers, respectively. The complementary sequences of primers that create 18 to 20 bp of homology in the terminal ends of PCR products after amplification are in bold. The restriction enzyme sites are underlined.
256
One-step site-directed mutagenesis protocol / D. Wu et al. / Anal. Biochem. 434 (2013) 254–258
Fig.1. Schemes for the principle of method. (Step 1) Primer design. Two pairs of primers (A-up and A-down; B-up and B-down) were designed for two separate PCR amplifications. The black arrows of these primers are sequences annealing to regions flanking the target site. The striped boxes indicate the complementary regions, which were the overlapping sequences in step 2 and used as the homologous arms in vivo homologous recombination. The black boxes indicate the target gene. I and II indicate the restriction enzyme sites to be introduced. For deletion mutagenesis, the open box represents the deleted region and the striped boxes represent the overlapping regions. For substitution mutagenesis, the gridding box represents the substituted region. For insertion mutagenesis, the vertical bar represents the inserted site. (Step 2) Two separate PCR amplifications. The striped boxes represent the homologous blunt ends in the downstream of the A segment and the upstream of the B segment. (Step 3) Ligation of two segments of target gene into vector. Both ends of the A and B segments were simultaneously ligated into vector with the restriction enzyme sites I and II in one ligation reaction to generate the linear recombinant vector with two homologous blunt ends. (Step 4) Transformation and circularization of linear recombinant vector in E. coli. The two copies of homologous blunt ends were changed to one, and the linear recombinant vector was circularized via homologous recombination. The mutant target gene comprising the A and B segments was successfully cloned into the vector.
4. Then, the A and B PCR products were purified and used for digestion. Step 3: Digestion and ligation of PCR-amplified DNA segments to vector The A and B purified segments were digested with restriction enzymes I and II, respectively. The original vector plasmid was simultaneously digested with restriction enzymes I and II. After digestion, the enzymes were separately purified by a DNA purification kit. The A and B purified segments were simultaneously ligated into the vector with the restriction enzyme sites I and II in a tube by T4 DNA ligase. Then, linear recombinant vectors with two homologous blunt ends were generated. Step 4: Transformation and circularization of linear recombinant vector in E. coli The linear recombinant vectors, which resulted from the ligation products in step 3, were all transformed into competent E. coli and circularized via homologous recombination based on overlapping sequence in vivo. Introducing deletion, substitution, and insertion mutations into the PEP4 gene We introduced deletion, substitution, and insertion mutants into the PEP4 gene of S. cerevisiae to demonstrate that our protocol
was viable and efficient. According to the principle of method, two mutagenic segments of target gene for any mutant type were simultaneously amplified with their respective primers (Table 1) by two separate PCR amplifications. In this experiment, six DNA fragments were simultaneously amplified using the same procedure and PCR parameters. Agarose gel electrophoresis showed that satisfactory amplification products were obtained (Fig. 2). The results indicate that two separate PCR amplifications can be performed simultaneously using the genome as the template for any mutant type only if the annealing temperature of these primers fit each PCR. For any mutant type, we obtained approximately 50 to 80 colonies on every plate. A total of 15 colonies were randomly selected and analyzed by respective restriction enzymatic digestion (data not shown) and sequencing (Fig. 3, rows D2, S2, and I2) from each mutant type. Three mutant types (deletion, substitution, and insertion) were accurately introduced into the PEP4 gene of S. cerevisiae (Fig. 3). For deletion, the 162-bp prosequence (encodes the propeptide of proteinase A) of the PEP4 gene was completely deleted (Fig. 3, row D1). For substitution, the TTAGGCCAAAAGTACTTGAC sequences from the prosequence of the PEP4 gene were replaced with GCTTAGCGGTACCTCAGAAA (Fig. 3, row S1). For insertion, we introduced an 18-bp (GACCGTGGTACCTCAGCT) insertion into the prosequence of the PEP4 gene (Fig. 3, row I1). In summary, the overall efficiencies of mutagenesis for deletions, substitutions, and insertions were 100%, 100%, and 99.3%, respectively (Table 2).
One-step site-directed mutagenesis protocol / D. Wu et al. / Anal. Biochem. 434 (2013) 254–258
257
Fig.2. Agarose gel electrophoresis of two mutant DNA segments for every mutagenesis type. Lane M: DL5000 Marker (TaKaRa); lanes 1, 3, and 5: A segment of the PEP4 gene that was introduced deletion, substitution, and insertion mutagenesis, respectively; lanes 2, 4, and 6: B segment of the PEP4 gene that was introduced deletion, substitution, and insertion mutagenesis, respectively.
Discussion We have described a highly efficient protocol that allows rapid mutagenesis, including deletion, substitution, and insertion. Our protocol, based on two separate PCR amplifications and one-step ligation of two mutagenic segments from the target gene, avoids the limitations of other methods. Compared with other PCR-based mutagenesis methods reported previously, three special and essential parts exist in our protocol. First, the genome with the target gene was directly used as the template to PCR instead of the plasmid-cloning target gene. Contrary to other methods, the target gene does not need to be cloned into a plasmid, and the full-length plasmid sequence does not need to be amplified in our protocol, resulting in a lower total number of PCR errors [11]. This strategy avoids the occurrence of methylated and hemimethylated DNA that need to be destroyed by DpnI [10,11,15]. Second, the A and B segments of the target gene were amplified via two separate PCR amplifications to overcome the problems associated with primer pair self-annealing attributed to completely or partially complementary primers [8,12,17]. Third, two mutagenic segments (A and B) were simultaneously ligated into a vector in one tube, and the linear recombinant vector with the homologous terminal ends was transformed into competent E. coli and generated recombinant DNA circles in vivo. Several rules should be followed in applying our protocol to generate mutants properly. First, the melting temperature (Tm) of four primers for any mutant type should be adjusted appropriately to its most suitable value by altering the structure of primers. Thus, A and B segments can be amplified using the same PCR parameters. The common and highly efficient restriction enzymes I and II should be different because the ligation efficiency is higher. In the ligation mixture, the ratio of A and B segments should be 1:1 (molar concentration), and the ratio of A and B segments should range from 5:1 to 8:1 with respect to the vector (molar concentration). In summary, the specific advantages of the proposed method include the following: (i) there is no limiting melting temperature and no forming primer dimer; (ii) in certain cases, three SDM types (deletion, insertion, and substitution) can use the same PCR parameters simultaneously; (iii) less the number of total PCR errors for large DNA fragments using two separate PCR amplifications; (iv) the digestion of parental template is unnecessary; and (v) ligation of two DNA fragments into vector is inexpensive, time-saving, and
Fig.3. Sequence comparison and sequencing results of site-directed mutagenesis. Rows D1, S1, and I1: comparison of the sequences before (above) and after (below) deletion, substitution, and insertion mutation, respectively; rows D2, S2, and I2: sequencing results of deletion, substitution, and insertion mutation, respectively. The boxes represent the mutant region.
efficient. However, our protocol is not perfect and include the following disadvantages. The A and B segments were amplified with the same PCR parameters. However, sometimes nonspecific PCR products were amplified even though the primers were suitable. Thus, gel purification of PCR products should be performed. Furthermore, the primary limitation to maximal accuracy and the size of gene product (A and B) is the efficiency of the DNA polymerase used for PCR. However, the size limit of substitution and insertion is dependent on the maximal length of commercially available primers except for deletion. Our new protocol was successfully used to generate deletion, substitution, and insertion mutagenesis. Other experiments performed in our laboratory demonstrated that our protocol was also especially well-suited to construct large recombinant plasmids greater than 10 kb (data not shown). For example, a DNA fragment greater than 5 kb needs to be cloned into the desired plasmid. We can separate the large DNA fragment into two small fragments (2 and 3 kb), which are separately amplified by PCR. Two advantages exist in this method of constructing recombinant plasmid. First, the smaller the amplified DNA fragments in PCR, the lower the relative base mutation rate of PCR product. Second, ligations of two small DNA fragments into the same plasmid are easier than that of a large DNA fragment in one ligation reaction. Similarly, the fusion of two gene segments can be performed by this method to construct recombinant plasmid. According to previous research [18],
258
One-step site-directed mutagenesis protocol / D. Wu et al. / Anal. Biochem. 434 (2013) 254–258
Table 2 Efficiency of mutagenesis PCR. Mutation
Colonies screened by restriction digestion
Colonies sequenced
Colonies of correctly mutated sequence
Efficiency (%)
Deletion Substitution Insertion
15 15 15
15 15 15
15 15 14
100 100 93.3
this protocol can also be used for site saturation mutagenesis by randomized primers. In conclusion, our protocol provides a rapid, efficient, and cost-effective technique to generate mutants and construct recombinant plasmid. This technology will consequently accelerate our understanding of the structure–function relationships of target proteins and genes. Acknowledgments This work was financially supported by the Cheung Kong Scholars and Innovative Research Team Program in University of Ministry of Education, China (Grant No. IRT1166), the National Natural Science Foundation of China (No. 31271916), the Youth Foundation of Application Base and Frontier Technology Project of Tianjin, China (12JCQNJC06500) and School Foundation of Tianjin University of Science and Technology (20120112). References [1] R.M.P. Siloto, R.J. Weselake, Site saturation mutagenesis: methods and applications in protein engineering, Biocatal. Agric. Biotechnol. 1 (2012) 181–189. [2] F. Marini III, A. Naeem, J.N. Lapeyre, An efficient 1-tube PCR method for internal site-directed mutagenesis of large amplified molecules, Nucleic Acids Res. 21 (1993) 2277–2278. [3] V. Picard, E. Ersdal-Badju, A. Lu, S.C. Bock, A rapid and efficient one-tube PCRbased mutagenesis technique using Pfu DNA polymerase, Nucleic Acids Res. 22 (1994) 2587–2591.
[4] J. Brøns-Poulsen, N. Petersen, M. Hørder, K. Kristiansen, An improved PCRbased method for site directed mutagenesis using megaprimers, Mol. Cell. Probes 12 (1998) 345–348. [5] Z.B. Nagy, F. Felföldi, L. Tamás, L.G. Puskás, A one-tube, two-step polymerase chain reaction-based site-directed mutagenesis method with simple identification of the mutated product, Anal. Biochem. 324 (2004) 301–303. [6] Y. Adereth, K.J. Champion, T. Hsu, V. Dammai, Site-directed mutagenesis using Pfu DNA polymerase and T4 DNA ligase, BioTechniques 38 (2005) 864–868. [7] N. Chapnik, H. Sherman, O. Froy, A one-tube site-directed mutagenesis method using PCR and primer extension, Anal. Biochem. 372 (2008) 255–257. [8] W.C. Tseng, J.W. Lin, T.Y. Wei, T.Y. Fang, A novel megaprimed and ligase-free, PCR-based, site-directed mutagenesis method, Anal. Biochem. 375 (2008) 376– 378. [9] H.H. Hogrefe, J. Cline, G.L. Youngblood, R.M. Allen, Creating randomized amino acid libraries with the QuikChange multi site-directed mutagenesis kit, BioTechniques 33 (2002) 1158–1165. [10] J. Li, C. Li, W. Xiao, D. Yuan, G. Wan, L. Ma, Site-directed mutagenesis by combination of homologous recombination and DpnI digestion of the plasmid template in Escherichia coli, Anal. Biochem. 373 (2008) 389–391. [11] H. Wan, Y. Li, Y. Fan, F. Meng, C. Chen, Q. Zhou, A site-directed mutagenesis method particularly useful for creating otherwise difficult-to-make mutants and alanine scanning, Anal. Biochem. 420 (2012) 163–170. [12] D. Qi, K.B. Scholthof, A one-step PCR-based method for rapid and efficient sitedirected fragment deletion, insertion, and substitution mutagenesis, J. Virol. Methods 149 (2008) 85–90. [13] J. Chiu, D. Tillett, I.W. Dawes, P.E. March, Site-directed, ligase-independent mutagenesis (SLIM) for highly efficient mutagenesis of plasmids greater than 8 kb, J. Microbiol. Methods 73 (2008) 195–198. [14] H. Wang, N. Zhou, F. Ding, Z. Li, R. Chen, A. Han, R. Liu, An efficient approach for site-directed mutagenesis using central overlapping primers, Anal. Biochem. 418 (2011) 304–306. [15] O. Edelheit, A. Hanukoglu, I. Hanukoglu, Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure–function studies, BMC Biotechnol. 9 (2009) 61–68. [16] D.L. Steffens, J.G.K. Williams, Efficient site-directed saturation mutagenesis using degenerate oligonucleotides, J. Biomol. Tech. 18 (2007) 147–149. [17] H. Liu, J. Naismith, An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol, BMC Biotechnol. 8 (2008) 91–100. [18] L. Zheng, U. Baumann, J.L. Reymond, An efficient one-step site-directed and site-saturation mutagenesis protocol, Nucleic Acids Res. 32 (2004) e115. [19] D.H. Jones, S.C. Winistorfer, Site-specific mutagenesis and DNA recombination by using PCR to generate recombinant circles in vitro or by recombination of linear PCR products in vivo, Methods 2 (1991) 2–10. [20] G. Ammerer, C. Hunter, J. Rothman, G. Saari, L. Valls, T. Stevens, PEP4 gene of Saccharomyces cerevisiae encodes proteinase A, a vacuolar enzyme required for processing of vacuolar precursors, Mol. Cell. Biol. 6 (1986) 2490–2499.
Contents lists available at SciVerse ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
A rapid and efficient one-step site-directed deletion, insertion, and substitution mutagenesis protocol Deguang Wu, Xuewu Guo, Jun Lu, Xi Sun, Feng Li, Yefu Chen, Dongguang Xiao ⇑ Key Laboratory of Industrial Fermentation Microbiology, Ministry of Education, Tianjin Industrial Microbiology Key Laboratory, College of Biotechnology, Tianjin University of Science and Technology, Tianjin 300457, China
a r t i c l e
i n f o
Article history: Received 29 September 2012 Received in revised form 9 November 2012 Accepted 20 November 2012 Available online 19 December 2012 Keywords: Site-directed mutagenesis Separate PCR amplification Homologous recombination One-step ligation Mutation frequency
a b s t r a c t A rapid and efficient site-directed mutagenesis (SDM) protocol based on two separate polymerase chain reaction (PCR) amplifications and homologous recombination in Escherichia coli is described. This protocol can introduce deletions, substitutions, and insertions into any amplifiable site of the target genes by ligating two amplified DNA fragments into vectors. Compared with previously reported PCR-based SDM methods, our protocol significantly prevents primer dimerization even though partially complementary primers were used for PCR. The genome with the target gene was used directly as template, and DpnI was unnecessary. All of the procedures were performed within 24 h. The mutation frequencies of deletion, substitution, and insertion of the PEP4 (encode proteinase A) gene of Saccharomyces cerevisiae were nearly 100% using this new method. Thus, this method can potentially facilitate high-throughput genetic engineering and structure–function analyses and is useful for molecular biological research. Ó 2013 Elsevier Inc. All rights reserved.
Site-directed mutagenesis (SDM)1 has increasingly become an indispensable tool to study the relationship of the structure–function of gene and proteins. This tool is most frequently used to introduce mutations at different sites of the open reading frame of target genes and evaluate the effects on protein function [1]. Several polymerase chain reaction (PCR)-based traditional SDM methods, including megaprimer, overlap extension, and inverted PCRs, as well as a modified protocol of these methods [2–8] are routinely used for mutagenesis. However, these methods require two PCR rounds, multiple steps of enzymatic treatment, and primer or template purification or modification. With the application of the QuikChange SDM system (QCM) developed by Stratagene (La Jolla, CA, USA), numerous commercial SDM kits, such as the Mutan km system from TaKaRa (Madison, WI, USA), the Phushion system from Finnzyme (Espoo, Finland), and the GeneTailor system from Invitrogen (New York, NY, USA), can be easily purchased on the market. However, these kits and their modified versions hardly overcome the limiting melting point and the forming primer dimer because their mutant primers contain the complementary region. The QCM-like kits require either phosphorylated primers or an extra step [9]. Numerous novel SDM methods based on the QCM-like kits have been developed during recent years to address these problems [10–18]. Most of ⇑ Corresponding author. Fax: +86 022 60602298. E-mail address: [email protected] (D. Xiao). Abbreviations used: SDM, site-directed mutagenesis; PCR, polymerase chain reaction; QCM, QuikChange SDM system. 1
0003-2697/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ab.2012.11.028
these methods have been applied and are efficient. These methods can be widely used for various difficult-to-construct mutants, which the traditional SDM protocol cannot perform. However, these newly developed SDM methods have common disadvantages, including cloning the target gene into vectors and digesting the parental template with the DpnI after PCR amplification. The full-length plasmid sequence is amplified for any mutant type, during which PCR errors may occur, although a high-fidelity DNA polymerase is used. In general, the longer the fragments amplified, the greater the total number of PCR errors will be. In some of these methods, various extra steps, such as two-stage PCR, gel purification of PCR products, denaturation, and annealing, are expensive and time-consuming. In this study, based on the circularization of linear DNA products via homologous recombination in vivo [19], we describe a rapid and efficient protocol dependent on two separate PCR amplifications and one-step ligation to introduce deletions, insertions, and substitutions into any amplifiable site of the target genes. This method allows mutant generation at a mutagenic frequency of close to 100% and also has numerous advantages over those aforementioned strategies. Materials and methods Plasmid and strains The pUC19 (2686 bp) plasmid, which was purchased from TaKaRa, was used as the original vector to introduce mutations.
One-step site-directed mutagenesis protocol / D. Wu et al. / Anal. Biochem. 434 (2013) 254–258
Escherichia coli DH5a was used to construct plasmids. The genome of the industrial brewing yeast, Saccharomyces cerevisiae S6 (our laboratory), was used as the template to amplify mutagenic segments of the PEP4 gene of S. cerevisiae [20] by PCR. Preparation of DNA and primers Plasmid DNA was prepared from E. coli by a plasmid DNA extraction kit (Solarbio, Beijing, China). Genomic DNA was prepared from S. cerevisiae S6 by a yeast genomic DNA extraction kit (Solarbio). All oligonucleotide primers were synthesized and purified by DingGuo ChangSheng Biotech (Beijing, China). The detailed sequences of these oligonucleotide primers are listed in Table 1. Amplification, purification, and digestion of target gene The PCR amplifications were carried out with a general PCR system. Two segments of the target gene were simultaneously amplified by two separate PCR amplifications in each mutant type (deletion, insertion, and substitution). These segments were named A and B. The 50-ll PCR mixture consisted of 1 ll of genomic DNA as template (100 ng), 1 ll of each primer (0.4 lM each), 5 ll of dNTP mixture, 10 ll of 5 buffer, 31 ll of distilled H2O, and 1 ll of Pfu DNA polymerase (2.5 U). The reaction started with template pre-denaturation at 95 °C for 5 min, followed by 25 cycles of 94 °C for 45 s, 63 °C for 45 s, and 72 °C for 70 s and then an extension step at 72 °C for 10 min. Finally, the solution was stored at 4 °C before the next step. In this experiment, all six PCRs were performed using the same procedure and reaction parameters. The PCR amplification products were evaluated by agarose gel electrophoresis and purified by an Omega PCR purification kit. The A and B segments were digested with restriction enzymes BamHI and SphI, respectively. The pUC19 plasmid was digested with BamHI and SphI. A 40-ll reaction mixture also contained the collected DNA and 2 ll of related restriction enzymes in 1 digestion buffer. The mixture was incubated at 37 °C for 2 h, followed by another purification step with the aforementioned DNA purification kit. The digested pUC19 plasmid and DNA products were later used for a ligation reaction in one tube. Ligation, transformation, and verification of recombinant plasmids For any mutant type, the A and B segments were always ligated with the digested pUC19 plasmid in a ligation reaction. The ligation mixture (20 ll) contained the digested A and B segments (4 ll each, 500 ng), 2 ll of digested pUC19 plasmid (100 ng), and 700 U of T4 DNA ligase (TaKaRa) in 1 ligation buffer supplied in the kit. The ligation mixture was incubated at 16 °C for 1 to 2 h.
Next, the 20-ll ligation solution was used for transformation with DH5a-competent bacteria. We plated 200 ll of solution onto a single Luria–Bertani (LB)/ampicillin plate, incubated at 37 °C overnight, and screened for desired mutants. The introduction of SDM was checked by plasmid DNA sequencing (BGI, Beijing, China) and several restriction enzymatic digestions. The digested product was loaded on 1% agarose gel in 1 TAE buffer and observed with ultraviolet (UV) light.
Results Outline of principle of method The outline of principle of method is illustrated in Fig. 1, which shows that we developed an easy four-step protocol that can be completed within 24 h. Step 1: Primers design Two pairs of primers should be prepared to generate a mutant. These primer pairs consist of two flanking (A-up and B-down) primers and two internal (A-down and B-up) primers, which comprise two major parts: a 50 -complementary region containing the target mutant sequences and an 8-bp minimum [18] 30 -template annealing region. The primers were designed to anneal to the template sequences flanking the target sites, which were sequences for deletion/substitution or introduction of insertion. The 50 -complementary sequences of internal primers, which were to become overlapping sequences in step 2 and used as homologous arms in vivo homologous recombination of step 4, varied from case to case. For insertion or substitution, the 50 -complementary sequences included the foreign sequences to be introduced. For deletion, the 50 -complementary sequences included at least 4 bp [19] from each side of the region to be deleted. Step 2: PCR amplification of two DNA segments For any mutant type, two mutagenic segments, A and B, of the target gene were amplified from genomic DNA template by two separate PCR amplifications. A-up and A-down primers were used for the A segment, whereas B-up and B-down primers were used for the B segment. After amplification, the upstream of A and the downstream of B contained the restriction enzyme sites I and II, which were used for ligation of A and B segments to vectors and generation of linear recombinant vectors in step 3. The downstream of A and the upstream of B contained the overlapping sequences, which were used for circularization of linear recombinant vectors by in vivo homologous recombination in step
Table 1 PCR primers used in this study. Primer name
Sequence (50 ? 30 )
Restriction site
DA-up
CGCGGATCCGAGAGAAGATGGTAGATACC GTGACCACCTGCAGCAACTTGGTTGGCGCTGAC GTTGCTGCAGGTGGTCACGATGTTCCATTGAC
BamHI
DA-down DB-up DB-down SA-up SA-down SB-up SB-down IA-up IA-down IB-up IB-down
255
TCAAGCATGCCTAGAGCGCAGCCTGTGAATCT GCGGATCCCGTAACCAAGGACAAATACCCAT TTTCTGAGGTACCGCTAAGCATGAGCTAAATGTTGCTCGAAAGTGAC GCTTAGCGGTACCTCAGAAATCAATTTGAGAAAGCTAACCCCGAAGT CCTAGGCATGCTTATTTTTCGCTTCTGCTTAC AGGGGATCCTAACCAAGGACAAATACCCATAG AGCTGAGGTACCACGGTCACTTTTGGCCTAAATGAGCTAAATG GACCGTGGTACCTCAGCTACTTGACTCAATTTGAGAAAGCTAAC CCGTGCATGCTATTTTTCGCTTCTGCTTAC
– – SphI BamHI – – SphI BamHI – – SphI
Note: The first letters of the primer names listed above—D, S, and I—represent the deletion, substitution, and insertion mutagenesis primers, respectively. The complementary sequences of primers that create 18 to 20 bp of homology in the terminal ends of PCR products after amplification are in bold. The restriction enzyme sites are underlined.
256
One-step site-directed mutagenesis protocol / D. Wu et al. / Anal. Biochem. 434 (2013) 254–258
Fig.1. Schemes for the principle of method. (Step 1) Primer design. Two pairs of primers (A-up and A-down; B-up and B-down) were designed for two separate PCR amplifications. The black arrows of these primers are sequences annealing to regions flanking the target site. The striped boxes indicate the complementary regions, which were the overlapping sequences in step 2 and used as the homologous arms in vivo homologous recombination. The black boxes indicate the target gene. I and II indicate the restriction enzyme sites to be introduced. For deletion mutagenesis, the open box represents the deleted region and the striped boxes represent the overlapping regions. For substitution mutagenesis, the gridding box represents the substituted region. For insertion mutagenesis, the vertical bar represents the inserted site. (Step 2) Two separate PCR amplifications. The striped boxes represent the homologous blunt ends in the downstream of the A segment and the upstream of the B segment. (Step 3) Ligation of two segments of target gene into vector. Both ends of the A and B segments were simultaneously ligated into vector with the restriction enzyme sites I and II in one ligation reaction to generate the linear recombinant vector with two homologous blunt ends. (Step 4) Transformation and circularization of linear recombinant vector in E. coli. The two copies of homologous blunt ends were changed to one, and the linear recombinant vector was circularized via homologous recombination. The mutant target gene comprising the A and B segments was successfully cloned into the vector.
4. Then, the A and B PCR products were purified and used for digestion. Step 3: Digestion and ligation of PCR-amplified DNA segments to vector The A and B purified segments were digested with restriction enzymes I and II, respectively. The original vector plasmid was simultaneously digested with restriction enzymes I and II. After digestion, the enzymes were separately purified by a DNA purification kit. The A and B purified segments were simultaneously ligated into the vector with the restriction enzyme sites I and II in a tube by T4 DNA ligase. Then, linear recombinant vectors with two homologous blunt ends were generated. Step 4: Transformation and circularization of linear recombinant vector in E. coli The linear recombinant vectors, which resulted from the ligation products in step 3, were all transformed into competent E. coli and circularized via homologous recombination based on overlapping sequence in vivo. Introducing deletion, substitution, and insertion mutations into the PEP4 gene We introduced deletion, substitution, and insertion mutants into the PEP4 gene of S. cerevisiae to demonstrate that our protocol
was viable and efficient. According to the principle of method, two mutagenic segments of target gene for any mutant type were simultaneously amplified with their respective primers (Table 1) by two separate PCR amplifications. In this experiment, six DNA fragments were simultaneously amplified using the same procedure and PCR parameters. Agarose gel electrophoresis showed that satisfactory amplification products were obtained (Fig. 2). The results indicate that two separate PCR amplifications can be performed simultaneously using the genome as the template for any mutant type only if the annealing temperature of these primers fit each PCR. For any mutant type, we obtained approximately 50 to 80 colonies on every plate. A total of 15 colonies were randomly selected and analyzed by respective restriction enzymatic digestion (data not shown) and sequencing (Fig. 3, rows D2, S2, and I2) from each mutant type. Three mutant types (deletion, substitution, and insertion) were accurately introduced into the PEP4 gene of S. cerevisiae (Fig. 3). For deletion, the 162-bp prosequence (encodes the propeptide of proteinase A) of the PEP4 gene was completely deleted (Fig. 3, row D1). For substitution, the TTAGGCCAAAAGTACTTGAC sequences from the prosequence of the PEP4 gene were replaced with GCTTAGCGGTACCTCAGAAA (Fig. 3, row S1). For insertion, we introduced an 18-bp (GACCGTGGTACCTCAGCT) insertion into the prosequence of the PEP4 gene (Fig. 3, row I1). In summary, the overall efficiencies of mutagenesis for deletions, substitutions, and insertions were 100%, 100%, and 99.3%, respectively (Table 2).
One-step site-directed mutagenesis protocol / D. Wu et al. / Anal. Biochem. 434 (2013) 254–258
257
Fig.2. Agarose gel electrophoresis of two mutant DNA segments for every mutagenesis type. Lane M: DL5000 Marker (TaKaRa); lanes 1, 3, and 5: A segment of the PEP4 gene that was introduced deletion, substitution, and insertion mutagenesis, respectively; lanes 2, 4, and 6: B segment of the PEP4 gene that was introduced deletion, substitution, and insertion mutagenesis, respectively.
Discussion We have described a highly efficient protocol that allows rapid mutagenesis, including deletion, substitution, and insertion. Our protocol, based on two separate PCR amplifications and one-step ligation of two mutagenic segments from the target gene, avoids the limitations of other methods. Compared with other PCR-based mutagenesis methods reported previously, three special and essential parts exist in our protocol. First, the genome with the target gene was directly used as the template to PCR instead of the plasmid-cloning target gene. Contrary to other methods, the target gene does not need to be cloned into a plasmid, and the full-length plasmid sequence does not need to be amplified in our protocol, resulting in a lower total number of PCR errors [11]. This strategy avoids the occurrence of methylated and hemimethylated DNA that need to be destroyed by DpnI [10,11,15]. Second, the A and B segments of the target gene were amplified via two separate PCR amplifications to overcome the problems associated with primer pair self-annealing attributed to completely or partially complementary primers [8,12,17]. Third, two mutagenic segments (A and B) were simultaneously ligated into a vector in one tube, and the linear recombinant vector with the homologous terminal ends was transformed into competent E. coli and generated recombinant DNA circles in vivo. Several rules should be followed in applying our protocol to generate mutants properly. First, the melting temperature (Tm) of four primers for any mutant type should be adjusted appropriately to its most suitable value by altering the structure of primers. Thus, A and B segments can be amplified using the same PCR parameters. The common and highly efficient restriction enzymes I and II should be different because the ligation efficiency is higher. In the ligation mixture, the ratio of A and B segments should be 1:1 (molar concentration), and the ratio of A and B segments should range from 5:1 to 8:1 with respect to the vector (molar concentration). In summary, the specific advantages of the proposed method include the following: (i) there is no limiting melting temperature and no forming primer dimer; (ii) in certain cases, three SDM types (deletion, insertion, and substitution) can use the same PCR parameters simultaneously; (iii) less the number of total PCR errors for large DNA fragments using two separate PCR amplifications; (iv) the digestion of parental template is unnecessary; and (v) ligation of two DNA fragments into vector is inexpensive, time-saving, and
Fig.3. Sequence comparison and sequencing results of site-directed mutagenesis. Rows D1, S1, and I1: comparison of the sequences before (above) and after (below) deletion, substitution, and insertion mutation, respectively; rows D2, S2, and I2: sequencing results of deletion, substitution, and insertion mutation, respectively. The boxes represent the mutant region.
efficient. However, our protocol is not perfect and include the following disadvantages. The A and B segments were amplified with the same PCR parameters. However, sometimes nonspecific PCR products were amplified even though the primers were suitable. Thus, gel purification of PCR products should be performed. Furthermore, the primary limitation to maximal accuracy and the size of gene product (A and B) is the efficiency of the DNA polymerase used for PCR. However, the size limit of substitution and insertion is dependent on the maximal length of commercially available primers except for deletion. Our new protocol was successfully used to generate deletion, substitution, and insertion mutagenesis. Other experiments performed in our laboratory demonstrated that our protocol was also especially well-suited to construct large recombinant plasmids greater than 10 kb (data not shown). For example, a DNA fragment greater than 5 kb needs to be cloned into the desired plasmid. We can separate the large DNA fragment into two small fragments (2 and 3 kb), which are separately amplified by PCR. Two advantages exist in this method of constructing recombinant plasmid. First, the smaller the amplified DNA fragments in PCR, the lower the relative base mutation rate of PCR product. Second, ligations of two small DNA fragments into the same plasmid are easier than that of a large DNA fragment in one ligation reaction. Similarly, the fusion of two gene segments can be performed by this method to construct recombinant plasmid. According to previous research [18],
258
One-step site-directed mutagenesis protocol / D. Wu et al. / Anal. Biochem. 434 (2013) 254–258
Table 2 Efficiency of mutagenesis PCR. Mutation
Colonies screened by restriction digestion
Colonies sequenced
Colonies of correctly mutated sequence
Efficiency (%)
Deletion Substitution Insertion
15 15 15
15 15 15
15 15 14
100 100 93.3
this protocol can also be used for site saturation mutagenesis by randomized primers. In conclusion, our protocol provides a rapid, efficient, and cost-effective technique to generate mutants and construct recombinant plasmid. This technology will consequently accelerate our understanding of the structure–function relationships of target proteins and genes. Acknowledgments This work was financially supported by the Cheung Kong Scholars and Innovative Research Team Program in University of Ministry of Education, China (Grant No. IRT1166), the National Natural Science Foundation of China (No. 31271916), the Youth Foundation of Application Base and Frontier Technology Project of Tianjin, China (12JCQNJC06500) and School Foundation of Tianjin University of Science and Technology (20120112). References [1] R.M.P. Siloto, R.J. Weselake, Site saturation mutagenesis: methods and applications in protein engineering, Biocatal. Agric. Biotechnol. 1 (2012) 181–189. [2] F. Marini III, A. Naeem, J.N. Lapeyre, An efficient 1-tube PCR method for internal site-directed mutagenesis of large amplified molecules, Nucleic Acids Res. 21 (1993) 2277–2278. [3] V. Picard, E. Ersdal-Badju, A. Lu, S.C. Bock, A rapid and efficient one-tube PCRbased mutagenesis technique using Pfu DNA polymerase, Nucleic Acids Res. 22 (1994) 2587–2591.
[4] J. Brøns-Poulsen, N. Petersen, M. Hørder, K. Kristiansen, An improved PCRbased method for site directed mutagenesis using megaprimers, Mol. Cell. Probes 12 (1998) 345–348. [5] Z.B. Nagy, F. Felföldi, L. Tamás, L.G. Puskás, A one-tube, two-step polymerase chain reaction-based site-directed mutagenesis method with simple identification of the mutated product, Anal. Biochem. 324 (2004) 301–303. [6] Y. Adereth, K.J. Champion, T. Hsu, V. Dammai, Site-directed mutagenesis using Pfu DNA polymerase and T4 DNA ligase, BioTechniques 38 (2005) 864–868. [7] N. Chapnik, H. Sherman, O. Froy, A one-tube site-directed mutagenesis method using PCR and primer extension, Anal. Biochem. 372 (2008) 255–257. [8] W.C. Tseng, J.W. Lin, T.Y. Wei, T.Y. Fang, A novel megaprimed and ligase-free, PCR-based, site-directed mutagenesis method, Anal. Biochem. 375 (2008) 376– 378. [9] H.H. Hogrefe, J. Cline, G.L. Youngblood, R.M. Allen, Creating randomized amino acid libraries with the QuikChange multi site-directed mutagenesis kit, BioTechniques 33 (2002) 1158–1165. [10] J. Li, C. Li, W. Xiao, D. Yuan, G. Wan, L. Ma, Site-directed mutagenesis by combination of homologous recombination and DpnI digestion of the plasmid template in Escherichia coli, Anal. Biochem. 373 (2008) 389–391. [11] H. Wan, Y. Li, Y. Fan, F. Meng, C. Chen, Q. Zhou, A site-directed mutagenesis method particularly useful for creating otherwise difficult-to-make mutants and alanine scanning, Anal. Biochem. 420 (2012) 163–170. [12] D. Qi, K.B. Scholthof, A one-step PCR-based method for rapid and efficient sitedirected fragment deletion, insertion, and substitution mutagenesis, J. Virol. Methods 149 (2008) 85–90. [13] J. Chiu, D. Tillett, I.W. Dawes, P.E. March, Site-directed, ligase-independent mutagenesis (SLIM) for highly efficient mutagenesis of plasmids greater than 8 kb, J. Microbiol. Methods 73 (2008) 195–198. [14] H. Wang, N. Zhou, F. Ding, Z. Li, R. Chen, A. Han, R. Liu, An efficient approach for site-directed mutagenesis using central overlapping primers, Anal. Biochem. 418 (2011) 304–306. [15] O. Edelheit, A. Hanukoglu, I. Hanukoglu, Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure–function studies, BMC Biotechnol. 9 (2009) 61–68. [16] D.L. Steffens, J.G.K. Williams, Efficient site-directed saturation mutagenesis using degenerate oligonucleotides, J. Biomol. Tech. 18 (2007) 147–149. [17] H. Liu, J. Naismith, An efficient one-step site-directed deletion, insertion, single and multiple-site plasmid mutagenesis protocol, BMC Biotechnol. 8 (2008) 91–100. [18] L. Zheng, U. Baumann, J.L. Reymond, An efficient one-step site-directed and site-saturation mutagenesis protocol, Nucleic Acids Res. 32 (2004) e115. [19] D.H. Jones, S.C. Winistorfer, Site-specific mutagenesis and DNA recombination by using PCR to generate recombinant circles in vitro or by recombination of linear PCR products in vivo, Methods 2 (1991) 2–10. [20] G. Ammerer, C. Hunter, J. Rothman, G. Saari, L. Valls, T. Stevens, PEP4 gene of Saccharomyces cerevisiae encodes proteinase A, a vacuolar enzyme required for processing of vacuolar precursors, Mol. Cell. Biol. 6 (1986) 2490–2499.