- Email: [email protected]
A rapid and versatile site-directed method of mutagenesis for double-stranded plasmid DNA
Gene,69 (1988)325-330 Elsevier
325
GEN 02571
Short Communi~tions A rapid and versatile site-directed method of mutagenesis for double-stranded piasmid DNA (Recombinant DNA; synthetic oligodeoxynucleotides;
pertussis toxin subunit S2; E. coli; mutation)
Ada Velati Bellini, Francesca de Ferra and Cuido Grandi ENIRICERCHE
S.p.A., Department of Molecular Biology, 20097 Milan (Italy)
Received18January 1988 Revisedand accepted 22 April 1988 Received by publisher 27 May 1988
SUMMARY
This paper describes a new method for site-directed mutagenesis which allows mutations by deletion, insertion or substitution of large fragments of DNA with more than 50% efficiency and does not require subcioning in a single-str~ded (ss) DNA vehicle. The site of mutagenesis is removed from a linearized plasmid DNA by BAL 3 1 digestion, ss DNA regions are generated by limited exonuclease treatment and the mutated target site is reconstituted by annealing of the plasmid DNA to a 35-70 nucleotide long mutated ss oligodeoxynucleotide containing the desired mutation. The circularized plasmid is finally used to transform directly Escherichia coli competent cells.
INTRODUCIION
Many techniques of in vitro mutagenesis are available which selectively modify a given nucleotide sequ~ce(Botstein and Shortfe, 1985; Kunkel, 1985; Correspondence to: Dr. G. Grandi, ENIRICERCHE S.p.A., Via S. Salvo, 1, 20097 S. Donato Milanese, Milan (Italy) Tel. (02) 5205970. Abbreviations: bp, base pair(s); BSA, bovine serum albumin; gene coding for Cm acetylase; Cm, chloramphenicol; ds, double strand(ed); DTT, dithiothreitol; Exo, exonuclease; kb, kilobase or 1000 bp; Km, kanamycin; nt, nucleotide(s); ohgo, olig~eoxynucleotide; R, resistance; SDS, sodium dodecyl sulfate; ss, single strand(ed); u, unit(s). cut,
0378-I 119/88/$03.50 0 1988 Elsevier
Science Publishers
B.V. (Biomedical
Waye et al., 1985; Taylor and Eckstein, 1985; Walder and Walder, 1986; Mandecki, 1986; Mural and Foote, 1986). The most common methods employ synthetic oligos complements to the region surrounding the site of mutagenesis (target site), Usually this region, present in an ss phage DNA, is annealed to the synthetic oligo and converted into the ds form in an in vitro polymerization-ligation reaction; the mutants are selected after cell transformation Using these techniques it is possible to mutagenize efficiently short nucleotide sequences, but the efficiency decreases dramatically when either long sequences or several sites within the same region should be altered. The method we propose here has several advanDivision)
326
tages: it allows insertions or deletions of DNA fragments of variable length with equal efftciency and sequence modifications at multiple sites in a single step; furthermore, it does not require subcloning in ss phage vectors. Finally, the method turns out to be more than 50% efficient. We report hereafter the general strategy of mutagenesis and an example of its general applicability consisting in the construction of a deletion mutant of an expression plasmid, coding for the S2 subunit of pertussis toxin (Nicosia, 1986; Locht and Keith, 1986) in which a 100-bp leader sequence was substituted with the start codon for methionine.
EXPERIMENTAL AND DISCUSSION
(a) Strategy of mutagenesis The strategy of mutagenesis is schematically represented in Fig. 1. The experimental steps of the procedure can be summarized as follows.
REl
l
I,
RE2
(1) The plasmid DNA is linearized with a restriction enzyme (REl) which cuts within 100 bp from the target site, followed by limited digestion with BAL 3 1 to remove sequences up to and including the site to be mutagenized. The digested DNA is subsequently treated either with ,? Exo or Exo III to generate ends of opposite polarity from the ends generated by REl. This DNA fragment is then subjected to digestion with RE2 (any enzyme which cuts only once in the plasmid) and the fragment which originally contained the target site is isolated. (2) A second fragment of DNA is prepared from the original plasmid by double digestion with REl and RE2. The fragment which does not contain the target site is isolated. Since the method is based on the presence of protruding ends of opposite polarity at both sides of the target site, in case REl should leave blunt ends it is necessary to expose 5’ or 3’ protruding ends by limited exposure to either J. Exo or Exo III before digestion with the second restriction enzyme. (3) A synthetic ss oligo is prepared with sequence complemental to the exposed ends at both sides of the target site and including the mutated target site. (4) The two DNA fragments thus prepared and the oligo bridging the gap in the region of the target site are then mixed and ligated in a single reaction step, to obtain a circular molecule with ss gaps. The ligation mixture is used to transform directly E. coli competent cells. The ability of E. coli to fill-in the ss portions in the hybrid plasmid and the existence of a unique combination of complement~y sequences allow the selective cloning of only those plasmids which contain the desired sequence.
Bei 31 x exe or+exom I,
RE2
RE2
I
-,,i
Fig. 1. Strategy of site-directed mutagenesis. For details see EXPERIMENTAL AND DISCUSSION, section a. The filled-in circle indicates the site to be mutagenized (target site); the open box represents the synthetic oligo designed with the desired mutation (open circle); the blackened segment represents the fragment to be muta~en~ed. Ends could be either 3’ or 5’ protruding according to the strategy followed.
(b) Example: site-directed mutagenesis of the S2 subunit gene To prove the general applicability of this mutagenesis method for either case in which the REl site would leave 5’ or 3’ protruding ends, we report here the deletion of the secretion leader sequence of the pertussis toxin S2 gene (Nicosia, 1986; Locht and Keith, 1986). The mutagenesis was carried out starting from the pSM223 plasmid coding for the precursor toxin subunit S2. In pSM223, an E. co~i-Bacillus ~~bt~l~ shuttle expression vector obtained in our laboratory
321
Hifldrn S
A exe
A fragment
HindlIl H
5
Fig. 2. Removal linearization
of the leader sequence
of pSM223
containing
1 u of BAL 31 nuclease
precipitations,
the DNA was treated
specifications.
The reaction
carried
coding region from the pertussis
with SstI and EcoRI, (BRL)
S2, subunit represents
oligo including
volume containing
conditions.
Mannheim)
see EXPERIMENTAL
(a) and (b) were followed after
After
EDTA
with ethanol. pH 9.4,2.5
AND DISCUSSION,
and two ethanol
to the manufacturer’s
In case (b), the 1 Exo reaction mM MgCl,,
segment
was
50 pg/ml BSA, 4 pg
section b. Abbreviations:
The filled-in circle indicates
(open circle). The blackened
in 50 ~1 of a solution
inactivation
for 2 min at 37°C according
67 mM glycine-KOH
S, SstI; E, EcoRI; H, HindIII. the desired mutation
S2 gene. Protocols
3 pg of linear DNA were incubated
with phenol and the DNA was precipitated
For details
S2 gene; LS, leader sequence; the synthetic
in standard
with 1.8 u of Exo III (Boehringer
was stopped
toxin subunit
In both cases,
for 2 min at 22°C
out at 23°C for 2 min in 40 ~1 reaction
of linear DNA and 24 u of enzyme.
respectively.
P, promoter;
the target site. The striped segment represents
the gene which has been
mutagenized.
(unpublished), the EcoRI site is located just downstream from a Gram-positive ribosome-binding site and a TS-like promoter. The sequence of the plasmid to be deleted consisted of a 100 bp long region spanning from the REl site to the codon for the first amino acid (Ser) of the mature subunit S2. pSM223 contains two convenient REl sites (SstI and EcoRI) placed 4 and 20 bp upstream from the ATG of the leader sequence and leaving 3’ (Fig. 2a) and 5’ (Fig. 2b) overhanging ends, respectively. The pres-
ence of these two possible REl sites enabled us to prove the versatility of our mutagenesis method by employing either of the two different approaches, (a) and (b), outlined in Fig. 2. In both cases the pSM223 plasmid was linearized, either with SstI or EcoRI (step l), and then digested with BAL 3 1 exonuclease to remove sequences up to and including the target site. The extent of BAL 3 1 digestion was checked by following the reduction of the size of the EcoRIHind111 (or SstI-HindIII) fragment on agarose gel
328
+I
4
MET
EcoRI
SST1
CGGCGGAAJGACGAJGCCJGGCGJGGA~AAGAAJTCCJCCTJJGAGCJ 3'
5’ Fig.
3. Structure and sequence of the 50-nt-long synthetic ss ohgo. The 3’ and 5’ ends are complementary to the SstI end of the B fragment and to the first 27 nt of the mature S2 subunit gene, respectively. The mutated target site is boxed; the symbol ( + 1) indicates the codon for the first amino acid of the mature S2 subunit; the arrow indicates the direction of translation, The oligo was chemically synthesized using a System One DNA Synthesizer (Beckman), purified from polyacrylamide gel and dissolved in water to a final concentration of 20 pg/ml.
and by using the hybridization procedure described below. The subsequent Exo III reaction (step 2) provided the 5’ overhanging terminus necessary for the annealing to the synthetic mutagenic oligo (Fig. 3). The DNA was then digested with a second single-cutting restriction enzyme (Hind111 = RE2) located outside the mutagenesis region. The A fragment, which had lost the target site, was isolated from agarose gel (Maniatis et al., 1982) (step 3) and ligated to the electrophoretic~ly purified other
/---JAGCT
LEADER
a’----ATCGTCAtTCCGCCG-
TCGAGTTTCCTCCTTAAGAATACAFGTGCGGfCCGlA~CAGlAAGGC~~GC .’ --+I t2 +3 +I( +s +6 +7 C8 t9 ?mEST-
SEQUENCE
”
+l +2 +3 +‘I +5 +6 +7 18 +9 ~ER~I~R~ROI;i.YfLE~AL~LE~RO~l~O4
TCCACGCCAGGCATCGTCATTCCGCCG AGGt GCGGl CCGTAGCAGl AAGGCGGC
I~~~“G:S::~~E:~~~~~~:~~r,1
ssil
s’
portion of the piasmid (B fragments prepared in two different ways as shown in Fig. 2, a and b (step 4). In those cases in which the REl enzyme would leave 3’ protruding ends (Sri in Fig. 2a), fragment B is simply derived from the entire plasmid doubly cut with SstI t HindIII. On the other hand, if the enzyme REl leaves 5’ prot~ding @coRI in Fig. 2b) or blunt ends, fragment B is prepared by linearization of the entire plasmid with .&&RI, brief treatment with I Exo and secondary cutting with HiPzdIII. The
$2
pSM 223
-ExT
c”
3’
,.----AGCTCAAAGGAGG
S’-- - -ATCGTCATTCCGCCG+Hr
TCGAGTTTC&TCCTTAAGAATACAGGTGCGGTCCGTAGCAGTAAGGCGGC~1 ---+I +2 t3 411 +5 +G +7 +a cg
EGKI-
HINDII~
Fig. 4. In vitro mutagenesis ofpertussis toxin subunit S2 starting from pSM223 plasmid. (a) Structure of the hybrid molecule obtained at the end of the procedure when the SsfI enzyme is used. (b) Structure of the hybrid molecule obtained at the end of the procedure when the EcoRl enzyme is used. For details see EXPERIMENTAL AND DISCUSSION, section b. The box marked ‘Leader sequence’ represents the target site which has been deleted. Numbers indicate the amino acids (or the corresponding nucleotide sequence) of the mature S2 subunit. The arrow indicates the orientation of the S2 gene. Underlined is the start codon. The dashed tines indicate the ambiguity of the beginning of the nuclease-treated DNA termini.
329
1 Exo digestion provides the necessary 3’ overhanging terminus for the proper annealing to the oligo, as depicted in Fig. 3. The final constructs obtained following procedures (a) and (b), in which fragments A and B are ligated in the presence of the synthetic oligo, are illustrated in detail in Fig. 4. The ligation mixtures were used to transform directly E. coli HB 101 (Boyer and Roulland-Dussoix, 1969)competent cells according to Hanahan (1983). Positive clones were selected on plates containing either Km or Cm (pSM223 harbours the cut gene derived from pC194 and the pUBll0 KmR gene which are functional in both E. CO&and B. subtilis). It is evident that a critical step in this procedure is represented by the Exo III and/or ,? Exo digestion of plasmid DNA. It is important to obtain a long-
enough-exposed region of ss DNA to allow stable base pairing to the oligo. In this regard, we found it very convenient to assay the extent of nuclease digestion by using a rapid and simple hybridization procedure. The synthetic oligo was labelled at its 5’ end with [ y-32P]dATP and then separately hybridized to A and B fra~ents (for details see legend to Fig. 5). The hybrid molecules were loaded onto an agarose gel and the gel was autoradiographed. A radioactive signal in correspondence with the A and B fragments (Fig. 5) should indicate that the stability of the annealed region is high enough to be maintained under the electrophoretic conditions used. We always found that when this happened the structure was transformation-competent. The plasmids were extracted from the transformed colonies and the mutagenized ones were identified by restriction analysis and sequence determination (Maxam and Gilbert, 1980). Using the first approach eleven out of 18 colonies analyzed showed the correct sequence, whereas with the second approach both of the two mutated plasmids which were sequenced contained the expected mutation. Both experiments resulted in the construction of a mutated plasmid which promoted intracellular expression of the mature form of subunit S2 once inserted into B, subtiiis cells (A.V.B. and G.G., unpublished results). (c) Conclusions
0.6 Fig. 5. Hybridization ofthe 32P-labelled synthetic oligo with the products of Exo III and 2 Exo digestions. Lanes: 1, labelled synthetic oligo; 2, labelled synthetic oligo in the presence of Exo-III-digested A fragment (0.6 kb); 3, Iabeiled synthetic oligo in the presence of 1 Exo-digested B fragment (6.5 kb). Sizes in kb are indicated on the right margin. For the hybridization reaction 10 ng of digested DNA were annealed to 10 ng of synthetic oligo in 50 ~1 of a solution containing 60 mM Tris *HCl pH 7.5, 1 mM EDTA. After 5 min 65”C, the hybridization mixture was incubated at 14°C overnight. 1Lv’cpm of each reaction were loaded onto a 1% agarose gel and autoradiography was performed at -80°C with intensifying screen.
This work describes a new, rapid and efficient in vitro mutagenesis method. Using restriction enzyme analysis, we were able to identify clones harbouring the desired deletion in the 52 sequence in a three-day experiment once the plasmid to be modified and the mutagenic oligo were available. The constructed deletion was about 100 nt long and, in theory, there is no limitation to the length of the sequence to be removed. The efficiency of the mutagenesis protocol we used was very high (60 and 100% for the two examples reported) and the nonmutated plasmids turned out to be products of dimerization events of the SstI-Hind111 pSM223 fragment (B fragment). A careful choice of fragment concentration in the ligase mixture should minimize dimer fo~ation and therefore increase the yield of mutagenesis to values constantly close to 100%. The efficiency of tr~sformation seems to depend
330
greatly on the effectiveness of the nuclease digestions which can be conveniently followed by using the rapid hyb~dization test described (Fig. 5). The extent of complementarity between the mutagenic oligo and the ss termini of the plasmid molecule is also critical. It is clear that the longer the basepairing segment the more stable is the structure and consequently the higher is the expected efficiency of tr~sfo~ation. A limitation of the system consists in the requirement of a unique restriction site in the region of the target site. Although the restriction site can be located either upstream or downstream from the target site, the distance of the target site from the restriction site should not exceed 50 to 100 nt, otherwise the length of the oligo to be synthesized would be prohibitive. The subcloning of the DNA fragment to be mutagenized into the multiclon~g site of the pUC plasmid family could be particularly useful for those cases in which such a restriction site is not available. Although this remains a minor limitation of the method, it still represents a substantial improvement over other methods of plasmid mutagenesis which require the presence of a single cutting restriction enzyme site immediately upstream from the target site (Mandecki, 1986). We are now routinely using this method in our laboratory on different plasmids and genes, and we are consistently obtaining the desired mutations (deletions, insertions and substitutions) with frequencies of mutagenesis ranging from 30 to 100x, with a median value of 56% over six mutagenesis experiments completed. This makes us confident about the general applicability of the procedure. Although this method could be used to efficiently obtain any kind of mutation, it is particularly valuable when long deletions have to be generated. The other methods described in the literature so far are much less eflicient in that respect.
ACKNOWLEDGEMENTS
We are deeply indebted to M~~uisa Melli for helpful discussion and critical reading of this paper. This research was supported by a grant from SCLAVO S.p.A., Siena, Italy.
REFERENCES Botstein, D. and Shortle, D.: Strategies and applications of in vitro mutagenesis. Science 229 (1985) 1193-1201. Boyer, H.W. and Roulland-Dussoix, D.: A complementation analysis of the restriction and modification of DNA in Escherichia coli. J. Mol. Biol. 41 (1969) 459-479. Hanahan, D.: Studies on transformation ofI.?. coli with plasmids. J. Mol. Biol. 166 (1983) 557-580. Kunkel, T.A.: Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82 (1985) 488-492. Locht, C. and Keith, J.M.: Pertussis toxin gene: nucleotide sequence and generic organization. Science 232 (1986) 1258-1264. Mandecki, W.: Oiigonuc~eotide-directed double-strand break repair in plasmids of E. coli: a method for site-specific mutagenesis. Proc. Natl. Acad. Sci. USA 83 (1986) 7177-7181. Maniatis,T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Maxam, A. and Gilbert, W.: Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 65 (1980) 499-560. Mural, R.J. and Foote, R.S.: ‘Bandaid’ mutagenesis: a novel technique for oligonucleotide-directed site-specific mutagenesis. DNA 5 (1986) 84. Nicosia, A., Perugini, M., Franzini, C., Casagli, MC., Borri, M.G., Antoni, G., Almoni, M., Neri, P., Ratti, G. and Rappuoli, R.: Cloning and sequencing of the pertussis toxin genes: operon, structure and gene duplication. Proc. Natl. Acad. Sci. USA 83 (1986) 4631-4635. Taylor, J.W., Ott, J. and Eckstein, C.: The rapid generation of oligonucieotide-directed mutations at high frequency using phosphoro~ioate-modified DNA. Nucleic Acids Res. 13 (1985) 8765-8785. Walder, R.Y. and Walder, J.A.: Oligonucleotide-directed mutagenesis using the yeast transformation system. Gene 42 (1986) 133-139. Waye, M.M.Y., Verhoeyen, M.E., Jones, P.T. and Winter, G.: EcoK selection vectors for shotgun cloning into Ml3 and deletion mutagenesis. Nucleic Acids Res. 13 (1985) 8561-8571. Communicated by J.A. Hoch.
325
GEN 02571
Short Communi~tions A rapid and versatile site-directed method of mutagenesis for double-stranded piasmid DNA (Recombinant DNA; synthetic oligodeoxynucleotides;
pertussis toxin subunit S2; E. coli; mutation)
Ada Velati Bellini, Francesca de Ferra and Cuido Grandi ENIRICERCHE
S.p.A., Department of Molecular Biology, 20097 Milan (Italy)
Received18January 1988 Revisedand accepted 22 April 1988 Received by publisher 27 May 1988
SUMMARY
This paper describes a new method for site-directed mutagenesis which allows mutations by deletion, insertion or substitution of large fragments of DNA with more than 50% efficiency and does not require subcioning in a single-str~ded (ss) DNA vehicle. The site of mutagenesis is removed from a linearized plasmid DNA by BAL 3 1 digestion, ss DNA regions are generated by limited exonuclease treatment and the mutated target site is reconstituted by annealing of the plasmid DNA to a 35-70 nucleotide long mutated ss oligodeoxynucleotide containing the desired mutation. The circularized plasmid is finally used to transform directly Escherichia coli competent cells.
INTRODUCIION
Many techniques of in vitro mutagenesis are available which selectively modify a given nucleotide sequ~ce(Botstein and Shortfe, 1985; Kunkel, 1985; Correspondence to: Dr. G. Grandi, ENIRICERCHE S.p.A., Via S. Salvo, 1, 20097 S. Donato Milanese, Milan (Italy) Tel. (02) 5205970. Abbreviations: bp, base pair(s); BSA, bovine serum albumin; gene coding for Cm acetylase; Cm, chloramphenicol; ds, double strand(ed); DTT, dithiothreitol; Exo, exonuclease; kb, kilobase or 1000 bp; Km, kanamycin; nt, nucleotide(s); ohgo, olig~eoxynucleotide; R, resistance; SDS, sodium dodecyl sulfate; ss, single strand(ed); u, unit(s). cut,
0378-I 119/88/$03.50 0 1988 Elsevier
Science Publishers
B.V. (Biomedical
Waye et al., 1985; Taylor and Eckstein, 1985; Walder and Walder, 1986; Mandecki, 1986; Mural and Foote, 1986). The most common methods employ synthetic oligos complements to the region surrounding the site of mutagenesis (target site), Usually this region, present in an ss phage DNA, is annealed to the synthetic oligo and converted into the ds form in an in vitro polymerization-ligation reaction; the mutants are selected after cell transformation Using these techniques it is possible to mutagenize efficiently short nucleotide sequences, but the efficiency decreases dramatically when either long sequences or several sites within the same region should be altered. The method we propose here has several advanDivision)
326
tages: it allows insertions or deletions of DNA fragments of variable length with equal efftciency and sequence modifications at multiple sites in a single step; furthermore, it does not require subcloning in ss phage vectors. Finally, the method turns out to be more than 50% efficient. We report hereafter the general strategy of mutagenesis and an example of its general applicability consisting in the construction of a deletion mutant of an expression plasmid, coding for the S2 subunit of pertussis toxin (Nicosia, 1986; Locht and Keith, 1986) in which a 100-bp leader sequence was substituted with the start codon for methionine.
EXPERIMENTAL AND DISCUSSION
(a) Strategy of mutagenesis The strategy of mutagenesis is schematically represented in Fig. 1. The experimental steps of the procedure can be summarized as follows.
REl
l
I,
RE2
(1) The plasmid DNA is linearized with a restriction enzyme (REl) which cuts within 100 bp from the target site, followed by limited digestion with BAL 3 1 to remove sequences up to and including the site to be mutagenized. The digested DNA is subsequently treated either with ,? Exo or Exo III to generate ends of opposite polarity from the ends generated by REl. This DNA fragment is then subjected to digestion with RE2 (any enzyme which cuts only once in the plasmid) and the fragment which originally contained the target site is isolated. (2) A second fragment of DNA is prepared from the original plasmid by double digestion with REl and RE2. The fragment which does not contain the target site is isolated. Since the method is based on the presence of protruding ends of opposite polarity at both sides of the target site, in case REl should leave blunt ends it is necessary to expose 5’ or 3’ protruding ends by limited exposure to either J. Exo or Exo III before digestion with the second restriction enzyme. (3) A synthetic ss oligo is prepared with sequence complemental to the exposed ends at both sides of the target site and including the mutated target site. (4) The two DNA fragments thus prepared and the oligo bridging the gap in the region of the target site are then mixed and ligated in a single reaction step, to obtain a circular molecule with ss gaps. The ligation mixture is used to transform directly E. coli competent cells. The ability of E. coli to fill-in the ss portions in the hybrid plasmid and the existence of a unique combination of complement~y sequences allow the selective cloning of only those plasmids which contain the desired sequence.
Bei 31 x exe or+exom I,
RE2
RE2
I
-,,i
Fig. 1. Strategy of site-directed mutagenesis. For details see EXPERIMENTAL AND DISCUSSION, section a. The filled-in circle indicates the site to be mutagenized (target site); the open box represents the synthetic oligo designed with the desired mutation (open circle); the blackened segment represents the fragment to be muta~en~ed. Ends could be either 3’ or 5’ protruding according to the strategy followed.
(b) Example: site-directed mutagenesis of the S2 subunit gene To prove the general applicability of this mutagenesis method for either case in which the REl site would leave 5’ or 3’ protruding ends, we report here the deletion of the secretion leader sequence of the pertussis toxin S2 gene (Nicosia, 1986; Locht and Keith, 1986). The mutagenesis was carried out starting from the pSM223 plasmid coding for the precursor toxin subunit S2. In pSM223, an E. co~i-Bacillus ~~bt~l~ shuttle expression vector obtained in our laboratory
321
Hifldrn S
A exe
A fragment
HindlIl H
5
Fig. 2. Removal linearization
of the leader sequence
of pSM223
containing
1 u of BAL 31 nuclease
precipitations,
the DNA was treated
specifications.
The reaction
carried
coding region from the pertussis
with SstI and EcoRI, (BRL)
S2, subunit represents
oligo including
volume containing
conditions.
Mannheim)
see EXPERIMENTAL
(a) and (b) were followed after
After
EDTA
with ethanol. pH 9.4,2.5
AND DISCUSSION,
and two ethanol
to the manufacturer’s
In case (b), the 1 Exo reaction mM MgCl,,
segment
was
50 pg/ml BSA, 4 pg
section b. Abbreviations:
The filled-in circle indicates
(open circle). The blackened
in 50 ~1 of a solution
inactivation
for 2 min at 37°C according
67 mM glycine-KOH
S, SstI; E, EcoRI; H, HindIII. the desired mutation
S2 gene. Protocols
3 pg of linear DNA were incubated
with phenol and the DNA was precipitated
For details
S2 gene; LS, leader sequence; the synthetic
in standard
with 1.8 u of Exo III (Boehringer
was stopped
toxin subunit
In both cases,
for 2 min at 22°C
out at 23°C for 2 min in 40 ~1 reaction
of linear DNA and 24 u of enzyme.
respectively.
P, promoter;
the target site. The striped segment represents
the gene which has been
mutagenized.
(unpublished), the EcoRI site is located just downstream from a Gram-positive ribosome-binding site and a TS-like promoter. The sequence of the plasmid to be deleted consisted of a 100 bp long region spanning from the REl site to the codon for the first amino acid (Ser) of the mature subunit S2. pSM223 contains two convenient REl sites (SstI and EcoRI) placed 4 and 20 bp upstream from the ATG of the leader sequence and leaving 3’ (Fig. 2a) and 5’ (Fig. 2b) overhanging ends, respectively. The pres-
ence of these two possible REl sites enabled us to prove the versatility of our mutagenesis method by employing either of the two different approaches, (a) and (b), outlined in Fig. 2. In both cases the pSM223 plasmid was linearized, either with SstI or EcoRI (step l), and then digested with BAL 3 1 exonuclease to remove sequences up to and including the target site. The extent of BAL 3 1 digestion was checked by following the reduction of the size of the EcoRIHind111 (or SstI-HindIII) fragment on agarose gel
328
+I
4
MET
EcoRI
SST1
CGGCGGAAJGACGAJGCCJGGCGJGGA~AAGAAJTCCJCCTJJGAGCJ 3'
5’ Fig.
3. Structure and sequence of the 50-nt-long synthetic ss ohgo. The 3’ and 5’ ends are complementary to the SstI end of the B fragment and to the first 27 nt of the mature S2 subunit gene, respectively. The mutated target site is boxed; the symbol ( + 1) indicates the codon for the first amino acid of the mature S2 subunit; the arrow indicates the direction of translation, The oligo was chemically synthesized using a System One DNA Synthesizer (Beckman), purified from polyacrylamide gel and dissolved in water to a final concentration of 20 pg/ml.
and by using the hybridization procedure described below. The subsequent Exo III reaction (step 2) provided the 5’ overhanging terminus necessary for the annealing to the synthetic mutagenic oligo (Fig. 3). The DNA was then digested with a second single-cutting restriction enzyme (Hind111 = RE2) located outside the mutagenesis region. The A fragment, which had lost the target site, was isolated from agarose gel (Maniatis et al., 1982) (step 3) and ligated to the electrophoretic~ly purified other
/---JAGCT
LEADER
a’----ATCGTCAtTCCGCCG-
TCGAGTTTCCTCCTTAAGAATACAFGTGCGGfCCGlA~CAGlAAGGC~~GC .’ --+I t2 +3 +I( +s +6 +7 C8 t9 ?mEST-
SEQUENCE
”
+l +2 +3 +‘I +5 +6 +7 18 +9 ~ER~I~R~ROI;i.YfLE~AL~LE~RO~l~O4
TCCACGCCAGGCATCGTCATTCCGCCG AGGt GCGGl CCGTAGCAGl AAGGCGGC
I~~~“G:S::~~E:~~~~~~:~~r,1
ssil
s’
portion of the piasmid (B fragments prepared in two different ways as shown in Fig. 2, a and b (step 4). In those cases in which the REl enzyme would leave 3’ protruding ends (Sri in Fig. 2a), fragment B is simply derived from the entire plasmid doubly cut with SstI t HindIII. On the other hand, if the enzyme REl leaves 5’ prot~ding @coRI in Fig. 2b) or blunt ends, fragment B is prepared by linearization of the entire plasmid with .&&RI, brief treatment with I Exo and secondary cutting with HiPzdIII. The
$2
pSM 223
-ExT
c”
3’
,.----AGCTCAAAGGAGG
S’-- - -ATCGTCATTCCGCCG+Hr
TCGAGTTTC&TCCTTAAGAATACAGGTGCGGTCCGTAGCAGTAAGGCGGC~1 ---+I +2 t3 411 +5 +G +7 +a cg
EGKI-
HINDII~
Fig. 4. In vitro mutagenesis ofpertussis toxin subunit S2 starting from pSM223 plasmid. (a) Structure of the hybrid molecule obtained at the end of the procedure when the SsfI enzyme is used. (b) Structure of the hybrid molecule obtained at the end of the procedure when the EcoRl enzyme is used. For details see EXPERIMENTAL AND DISCUSSION, section b. The box marked ‘Leader sequence’ represents the target site which has been deleted. Numbers indicate the amino acids (or the corresponding nucleotide sequence) of the mature S2 subunit. The arrow indicates the orientation of the S2 gene. Underlined is the start codon. The dashed tines indicate the ambiguity of the beginning of the nuclease-treated DNA termini.
329
1 Exo digestion provides the necessary 3’ overhanging terminus for the proper annealing to the oligo, as depicted in Fig. 3. The final constructs obtained following procedures (a) and (b), in which fragments A and B are ligated in the presence of the synthetic oligo, are illustrated in detail in Fig. 4. The ligation mixtures were used to transform directly E. coli HB 101 (Boyer and Roulland-Dussoix, 1969)competent cells according to Hanahan (1983). Positive clones were selected on plates containing either Km or Cm (pSM223 harbours the cut gene derived from pC194 and the pUBll0 KmR gene which are functional in both E. CO&and B. subtilis). It is evident that a critical step in this procedure is represented by the Exo III and/or ,? Exo digestion of plasmid DNA. It is important to obtain a long-
enough-exposed region of ss DNA to allow stable base pairing to the oligo. In this regard, we found it very convenient to assay the extent of nuclease digestion by using a rapid and simple hybridization procedure. The synthetic oligo was labelled at its 5’ end with [ y-32P]dATP and then separately hybridized to A and B fra~ents (for details see legend to Fig. 5). The hybrid molecules were loaded onto an agarose gel and the gel was autoradiographed. A radioactive signal in correspondence with the A and B fragments (Fig. 5) should indicate that the stability of the annealed region is high enough to be maintained under the electrophoretic conditions used. We always found that when this happened the structure was transformation-competent. The plasmids were extracted from the transformed colonies and the mutagenized ones were identified by restriction analysis and sequence determination (Maxam and Gilbert, 1980). Using the first approach eleven out of 18 colonies analyzed showed the correct sequence, whereas with the second approach both of the two mutated plasmids which were sequenced contained the expected mutation. Both experiments resulted in the construction of a mutated plasmid which promoted intracellular expression of the mature form of subunit S2 once inserted into B, subtiiis cells (A.V.B. and G.G., unpublished results). (c) Conclusions
0.6 Fig. 5. Hybridization ofthe 32P-labelled synthetic oligo with the products of Exo III and 2 Exo digestions. Lanes: 1, labelled synthetic oligo; 2, labelled synthetic oligo in the presence of Exo-III-digested A fragment (0.6 kb); 3, Iabeiled synthetic oligo in the presence of 1 Exo-digested B fragment (6.5 kb). Sizes in kb are indicated on the right margin. For the hybridization reaction 10 ng of digested DNA were annealed to 10 ng of synthetic oligo in 50 ~1 of a solution containing 60 mM Tris *HCl pH 7.5, 1 mM EDTA. After 5 min 65”C, the hybridization mixture was incubated at 14°C overnight. 1Lv’cpm of each reaction were loaded onto a 1% agarose gel and autoradiography was performed at -80°C with intensifying screen.
This work describes a new, rapid and efficient in vitro mutagenesis method. Using restriction enzyme analysis, we were able to identify clones harbouring the desired deletion in the 52 sequence in a three-day experiment once the plasmid to be modified and the mutagenic oligo were available. The constructed deletion was about 100 nt long and, in theory, there is no limitation to the length of the sequence to be removed. The efficiency of the mutagenesis protocol we used was very high (60 and 100% for the two examples reported) and the nonmutated plasmids turned out to be products of dimerization events of the SstI-Hind111 pSM223 fragment (B fragment). A careful choice of fragment concentration in the ligase mixture should minimize dimer fo~ation and therefore increase the yield of mutagenesis to values constantly close to 100%. The efficiency of tr~sformation seems to depend
330
greatly on the effectiveness of the nuclease digestions which can be conveniently followed by using the rapid hyb~dization test described (Fig. 5). The extent of complementarity between the mutagenic oligo and the ss termini of the plasmid molecule is also critical. It is clear that the longer the basepairing segment the more stable is the structure and consequently the higher is the expected efficiency of tr~sfo~ation. A limitation of the system consists in the requirement of a unique restriction site in the region of the target site. Although the restriction site can be located either upstream or downstream from the target site, the distance of the target site from the restriction site should not exceed 50 to 100 nt, otherwise the length of the oligo to be synthesized would be prohibitive. The subcloning of the DNA fragment to be mutagenized into the multiclon~g site of the pUC plasmid family could be particularly useful for those cases in which such a restriction site is not available. Although this remains a minor limitation of the method, it still represents a substantial improvement over other methods of plasmid mutagenesis which require the presence of a single cutting restriction enzyme site immediately upstream from the target site (Mandecki, 1986). We are now routinely using this method in our laboratory on different plasmids and genes, and we are consistently obtaining the desired mutations (deletions, insertions and substitutions) with frequencies of mutagenesis ranging from 30 to 100x, with a median value of 56% over six mutagenesis experiments completed. This makes us confident about the general applicability of the procedure. Although this method could be used to efficiently obtain any kind of mutation, it is particularly valuable when long deletions have to be generated. The other methods described in the literature so far are much less eflicient in that respect.
ACKNOWLEDGEMENTS
We are deeply indebted to M~~uisa Melli for helpful discussion and critical reading of this paper. This research was supported by a grant from SCLAVO S.p.A., Siena, Italy.
REFERENCES Botstein, D. and Shortle, D.: Strategies and applications of in vitro mutagenesis. Science 229 (1985) 1193-1201. Boyer, H.W. and Roulland-Dussoix, D.: A complementation analysis of the restriction and modification of DNA in Escherichia coli. J. Mol. Biol. 41 (1969) 459-479. Hanahan, D.: Studies on transformation ofI.?. coli with plasmids. J. Mol. Biol. 166 (1983) 557-580. Kunkel, T.A.: Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82 (1985) 488-492. Locht, C. and Keith, J.M.: Pertussis toxin gene: nucleotide sequence and generic organization. Science 232 (1986) 1258-1264. Mandecki, W.: Oiigonuc~eotide-directed double-strand break repair in plasmids of E. coli: a method for site-specific mutagenesis. Proc. Natl. Acad. Sci. USA 83 (1986) 7177-7181. Maniatis,T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Maxam, A. and Gilbert, W.: Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 65 (1980) 499-560. Mural, R.J. and Foote, R.S.: ‘Bandaid’ mutagenesis: a novel technique for oligonucleotide-directed site-specific mutagenesis. DNA 5 (1986) 84. Nicosia, A., Perugini, M., Franzini, C., Casagli, MC., Borri, M.G., Antoni, G., Almoni, M., Neri, P., Ratti, G. and Rappuoli, R.: Cloning and sequencing of the pertussis toxin genes: operon, structure and gene duplication. Proc. Natl. Acad. Sci. USA 83 (1986) 4631-4635. Taylor, J.W., Ott, J. and Eckstein, C.: The rapid generation of oligonucieotide-directed mutations at high frequency using phosphoro~ioate-modified DNA. Nucleic Acids Res. 13 (1985) 8765-8785. Walder, R.Y. and Walder, J.A.: Oligonucleotide-directed mutagenesis using the yeast transformation system. Gene 42 (1986) 133-139. Waye, M.M.Y., Verhoeyen, M.E., Jones, P.T. and Winter, G.: EcoK selection vectors for shotgun cloning into Ml3 and deletion mutagenesis. Nucleic Acids Res. 13 (1985) 8561-8571. Communicated by J.A. Hoch.