- Email: [email protected]
A rapid loop-mediated isothermal amplification method for detection of the modified GM cry1A gene in transgenic insect-resistant cotton and rice
Food Control 62 (2016) 357e364
Contents lists available at ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
A rapid loop-mediated isothermal amplification method for detection of the modified GM cry1A gene in transgenic insect-resistant cotton and rice Peili Shen a, 1, Fengzhen Geng b, 1, Yan Yu a, 1, Yunzhe Zhang a, Zhixin Wang a, Zhihui Li a, Wei Zhang a, Changlong Shu c, Yongjun Zhang c, **, Jianxin Tan a, * a College of Food Science, Agricultural Products Processing Engineering Technology Center of Hebei, Agricultural University of Hebei, Baoding 071001, PR China b Department of Clinic Laboratory, Affiliated Hospital of Hebei University, Baoding 071001, PR China c Institute of Plant Protection, Chinese Academy of Agricultural Sciences, State Key Laboratory of Biology for Plant Disease and Insect Pests, Beijing 100193, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 June 2015 Received in revised form 16 September 2015 Accepted 26 October 2015 Available online 29 October 2015
Among the commercial genetically modified (GM) crops, the insect-resistant GM crops are the major cultivars that cry gene is introduced into. A cry1Ab/1Ac GM fusion gene (GFM cry1A) and a GM truncated cry1Ac gene (cry1Ac-Mon) is the key foreign gene employed for construction of GM crops by China researchers and Monsanto Technology LLC respectively. Here these two genes are entitled “GM cry1A” gene and a rapid visual loop-mediated isothermal amplification (LAMP) assay method for detection of GM cry1A in transgenic insect-resistant crops was established. The LAMP assay was performed at an optimal temperature of 65 C for 60 min in the presence of a set of four specific primers recognized six distinct sequences of the GM cry1A gene. The rough detection limit to the GM cry1A in samples is as low as 0.01% (a weight ratio of transgenic insect-resistant rice/cotton to non-transgenic rice/cotton). Comparatively, the sensitivity of this LAMP method is 10 times over that of the conventional PCR method. Fifteen cultivars/events and five Bt strains with or without cry1A gene were analyzed using the LAMP method as well as PCR method. The results demonstrate that this LAMP method shows a distinct specificity to the GM cry1A gene comparing with PCR analysis. Therefore, this LAMP method will be a potential effective tool for screening the GM cry1A gene in GM crops which are widely plant in China and other developing countries. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Insect-resistant GM crop GM cry1A gene Loop-mediated isothermal amplification PCR
1. Introduction Bacillus thuringiensis (Bt) is a gram positive bacterium that has been practically applied to insect pest control because of its insecticidal crystal proteins (ICPs, d-endotoxins) formed during sporulation. Since ICPs encoded by cry genes are highly specific toxin against a wide variety of insect pests of dipteran, coleopteran €fte & Whiteley, 1989), cry genes have been and lepidopteron (Ho considering as the main candidates to be introduced into crops for agricultural pest control. Fischhoff et al. (1987) reported that the
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (Y. Zhang), [email protected] (J. Tan). 1 The first three authors should be regarded as joint First Authors. http://dx.doi.org/10.1016/j.foodcont.2015.10.035 0956-7135/© 2015 Elsevier Ltd. All rights reserved.
truncated cry gene from Bt var. kurstaki HD-1 was transformed into tobacco and tomato generating the GM tobacco and tomato. After that, a variety of cry genes (cry1Ac, cry1Ab, cry2Aa, cry2Ab, cry2Ac, cry1F and vip-3A) were introduced into different plants producing n, 2011; many GM crops (Bravo, Likitvivatanavong, Gill, & Sobero Jouanin, Bottino, Girard, Morrot, & Giband, 1988; Kumar, Chandra, & Pandey, 2008). Guo, Ni, and Xu (1996) artificially synthesized an 1824 bp long GFM cry1A gene consisting of domain I (1e286 residues) of cry1Ab and domain II and III (287e608 residues) of cry1Ac which were all optimized with plant-preferred codon. Then the GFM cry1A was transformed into a number of main cotton cultivars in China resulting in the first generation of GM cotton. Up to now in China, many insect-resistant GM crops including commercialized ones are still using GFM cry1A or its derivatives as the foreign genes (Liu & Wang, 2003; Zhang, Guo, & Zhang, 2013,
358
P. Shen et al. / Food Control 62 (2016) 357e364
chap. 14; Chhabra, Randhawa, Bhoge, & Singh, 2014). Meanwhile, a series of commercial insect-resistant transgenic cottons such as events DP33B and DP99B, namely Genuity Bloogard™, were generated by Monsanto Technology LLC and have been widely planted in China and many other countries. These GM cottons contain a synthetic truncated cry1Ac gene (cry1Ac-Mon) which is from B. thuringiensis subsp. Kustaki HD73 and has been optimized with plant-preferred codon (Fischhoff & Perlak, 1995). Nowadays, pest resistant or/and herbicide tolerant GM crops (e. g. GM soybean, cotton, maize and rapeseed) have been permitted to be planted in both developed and developing countries and the area of GM crops has markedly increased all over the world (James, 2008, 2011). This fact will be a two-edged sword. On the one hand, the commercialization of GM crops will alleviate or overcome the crisis of global food security in a certain extent. On the other hand, it will simultaneously bring about the issues of food safety, environmental risk, ecology security and social ethics morals. Hence, the best strategy for governments and administrators is to enact and improve policies and regulations. To do so, establishment and development of the new practicable and accurate analysis method for detecting and screening the foreign gene in GM crops appears to be of essence and should be strengthened. Besides bioassay method, which is a primary, low cost but time consuming method for detecting the GM crops, the other efficient types of methods with higher specificity and sensitivity are developed based on the detection of the foreign gene (DNA) or its expression product (protein). For protein based detection methods, ELISA is the basic and standard approach. This method has been applied to detection of the introduced ICPs including Cry1Ac (Shan, Embrey, & Schaffer, 2007), Cry1Ab (Ermolli et al., 2006; Zhu et al., 2011), and Cry2Ab (Kamle, Ojha, & Kumar, 2011) expressed in GM crops (e.g. GM cotton and GM maize). Because the ELISA method is costly and complicated comparing to the DNA based method, the latter one has been developed rapidly and used extensively in detection of the foreign genes in GM crops. Conventional PCR (Cheng et al., 2007) and nest PCR (Pan & Shih, 2003) are employed for detecting a single cry gene in GM crops. Multiple PCR (Kamle, Kumar, & Bhatnagar, 2011; Randhawa, Singh, Chhabra, & Sharma, 2010) are applied to identifying two or more cry genes simultaneously. Real time PCR can not only identify the foreign genes, but also determine the copies of the target genes in GM crops (Babekova, Funk, Pecoraro, Engel, & Busch, 2009; Chhabra et al., 2014; Dinon et al., 2011). Furthermore, a method combining PCR with ELISA, namely Immuno-PCR, has also been used to detect the cry genes in GM crops with higher sensitivity and specificity (Allen, Rogelj, Cordova, & Kieft. 2006; Zhang & Guo, 2011). The indispensability of a thermocycler or a microplate reader for performing the DNA or protein based method limits their employment in a certain degree. Thus, a simple time-saved and cost-effective assay method is needed to complement current PCR or ELISA methods for the detection of GM crops. Loop-mediated isothermal amplification (LAMP) method is first reported in 2000 for the amplification of DNA with high specificity, efficiency and rapidity under isothermal conditions (Notomi et al., 2000). LAMP technology has already been recognized as a powerful diagnostic tool for detecting a specific sequence from a gene (e.g. a cry gene in GM crops), infectious pathogens (including bacteria, viruses and fungi) or human diseases (e. g. cancer) (Asiello & Baeumner, 2011; Biswas & Sakai, 2014). The sensitive LAMP methods employed for the detection of three GM rice events (Chen et al., 2012) and GM soybean (Wang, Teng, Guan, Tian, & Wang, 2013) have been reported recently. In the present study, we report a new visual LAMP method for rapid detection of both the GFM cry1A gene which is widely used as the foreign gene in construction of GM crops in China and the cry1AcMon gene in Genuity Bloogard™ cottons.
2. Materials and methods 2.1. Cultivars and Bt strains Insect-resistant rice Huahui-1 (HH-1, containing GFM cry1A gene) and insect-resistant cottons DPH37B, DP33B, DP99B (containing cry1Ac-Mon gene, belong to MON531 event (Genuity Bloogard™)), were from Dr. Yong-jun Zhang's Lab, State key Laboratory of Biology for Plant Disease and Insect Pests, Chinese Academy of Agricultural Sciences (CAAS), China. Non-GM rices 4021-P6, 9311 and TP309-P6 were provided by professor Li-juan Liu, Agricultural University of Hebei (AUH), Baoding, China. Non-GM cottons TM-1 and Jimian-11 (JM-11) were provided by Dr. Xing-fen Wang, AUH, Baoding, China. The insect-resistant cotton Lumian-17 (LM-17), non-GM cotton YXM-4, non-GM soybean Zhonghuang-13 (ZH-13), Zhonghuang-55 (ZH-55), non-GM tomato Baiguoqiangfeng (BGQF) and Guifeiyingtao (GFYT) were purchased from a farm market in Baoding, China. Bt subsp. Kustaki HD73 (containing genes cry1Ac1, cry1Ac7 and cry1Ac8), Bt HD12 (containing a cry1Ab24 gene, http://www.lifesci.sussex.ac.uk/home/Neil_ Crickmore/Bt/toxins2.htmlhttp://www.lifesci.sussex.ac.uk/home/ Neil_Crickmore/Bt/toxins2.html), Bt 46A (containing a cry1Ac gene), Bt 173A (containing two cry8 genes) and Bt 160C (contain a cry8 gene) were from this lab. 2.2. DNA extraction DNAs of GM crops and non-GM crops were extracted from the mixed powdered leaf samples (totally 200 mg) with CTAB method (Tiwari, Jadhav, & Gupta, 2012). The DNA samples were qualified by agarose gel electrophoresis and evaluated with Nanodrop 2000 spectrophotometer (Thermo scientific). DNA concentration of each sample was adjusted to a final concentration of 50 ng/mL and stored at 80 C for further experiments. Plasmids containing cry genes from Bt strains were extracted according to the plasmid-extraction protocol (Shu et al., 2009). 2.3. Primer design for LAMP and conventional PCR A set of primers of LAMP assay (Table 1) was designed using LAMP primer designing software Primer Explorer version 4 (http:// primerexplorer.jp/elamp4.0.0/index.html) according to sequence of the GFM cry1A gene (Guo et al., 1996). The primers which included a pair of inner primers (FIP and BIP) and a pair of outer primers (F3 and B3) located on the region from 327 bp to 545 bp of the GFM cry1A gene (Fig. 1) in the insect-resistant rice or cotton. Primers F3 and B3 at two ends of this region were designed for PCR assay. Primers F3 and B3 were employed for detection of the GM cry1A gene (Tables 1 and 2). Two pairs of primers (SPS-F1/SPS-R1 and sad I-F1/sad I-R1) for amplifying the endogenous reference gene SPS of rice (Genbank No. U33175) and sad1 of cotton (Genbank No. AJ132636) were designed with software Primer Premier 5.0 based on their sequence (Table 2). The size of each amplified PCR fragment was listed in the last column of Table 2. All the PCR and LAMP primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China). 2.4. LAMP assay LAMP assay was performed in 0.2 mL vials containing 25 mL reaction mixture which included 1.2 mM primer FIP and BIP, 0.2 mM primer F3 and B3 (Ri/o: 1:5, 1:6, 1:7, 1:8 and 1:9), 2 mM dNTPs (0.4, 0.8, 1.2, 1.6, 2.0, 2.4 and 2.8 mM), 0.5e1.0 mM MgSO4 (0, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 mM), 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, 20 mM TirseHCl, pH 8.8, 5.6e8U Bst (0.5, 0.7, 0.9, 1.1, 1.3, 1.5 mL) DNA
P. Shen et al. / Food Control 62 (2016) 357e364
359
Table 1 Primer sequences of LAMP and PCR assay in detection of the GFM cry1A gene of GM rice and cotton. Primer
Component
Sequence (50 -30 )
FIP BIP F3 B3
F1c þ F2 B1c þ B2 F3 B3
GCTGTGGTCAAGGCGCTGTT-AGCTCTCCGCGAGGAAAT TGTCCGTGTACGTTCAAGCAGC-CCCAAACACGCTAACGTCTC GTGGGAAGCCGATCCTACT TGGTTGCAGCATCGAATCC
Fig. 1. Partial sequence of the GFM cry1A gene which is for designing the primers of LAMP and PCR. The LAMP primers included a pair of outer primers (F3/B3) and two inner primers, the forward inner primer (FIP) which contains a complementary sequence alignment to F1 (F1c) linked with a F2 sequence (F2) and the backward inner primer which includes a B2 sequence (B2) linked with a complementary sequence to B1 (B1c). The PCR primers are F3 and B3. The locations of all primers are labeled with boxes.
polymerase large fragment (New England Biolabs), 1 mL of template DNA, 0.5 mL SYBR® Green I dye (Sigma Aldrich) and sterilized double-distilled water. The reaction mixture was incubated at 65 C for 60 min. To check whether the reaction occurred, LAMP products were directly visualized under the UV light and observed through naked eye. A change from orange to green color indicates that LAMP amplification is positive, whereas no color change means negative. To further confirm the LAMP results, 5 mL of the LAMP product was analyzed in 2.0% agarose gel stained with ethidium bromide and visualized by UV light.
assay, GM crop (GMC) samples and non-GM crop (non-GMC) samples were mixed at ratios (GMC mass to non-GMC mass) of 10%, 5%, 2%, 1%, 0.5%, 0.1%, 0.01%, 0.005%, 0.0%. DNA was extracted from the mixed samples using protocol described at section of 2.2 and LAMP or PCR assay was performed according to the description of 2.4 and 2.5. 3. Results and discussions 3.1. Setting up and optimization of a LAMP reaction system for detection of the GM cry1A gene in GM rice and GM cotton
2.5. Conventional PCR To detect the GM cry1A gene in GM rice or GM cotton and the endogenous reference gene SPS of rice or sad I gene of cotton, PCR amplification was performed in a 25 mL reaction mixture, containing 2 Es Taq Master Mix with Dyes (CoWin Bioscience Co., Ltd.), 10 mM of primers (Table 2) and 1 mL of DNA template in a thermal cycler (Biometra Co. Ltd., Goettingen, Germany) under the conditions as follows: denaturation at 94 C for 5 min, annealing at 54 C for 30 s and extension at 72 C for 30 s, for a total of 35 cycles; a final extension at 72 C for 6 min. Subsequently, 5 mL of PCR products were separated in 2.0% agarose gel and visualized by UV light after EB staining. 2.6. Limit of detection To determine the limit of detection (LOD) of LAMP assay and PCR
As a genetic marker of a certain species, the endogenous reference gene is usually used to differentiate the target species from the other species when they are identified with PCR or real-time PCR. It also can be employed as an internal positive control during detection of the genetic modified organisms and their products. Before setting up LAMP reaction system, it is necessary to identify the genomic DNA extracted from rice and cotton cultivars, GM or non-GM respectively by detecting firstly the rice-specific gene (sucrose phosphate synthase gene, SPS) (Ding et al., 2004) and the cotton-specific gene (Sad1) (Yang et al., 2005) using PCR approach. As shown in Fig. 2, no target PCR products were detected in blank samples (Fig. 2, lanes 1 and 5). whereas a 277 bp-long DNA band was detected in both GM rice (lane 2) and non-GM rice (lane 3) that demonstrated the genomic DNA extracted from rice cultivars were qualified as templates to develop the LAMP assay method for detection of the GM cry1A gene in GM rice. So did the DNA samples
Table 2 Primer sequence for PCR and the size of the PCR products. Gene name
Primer name
Sequence (50 -30 )
PCR product (bp)
SPS
SPS-F1 SPS-R1 Sad I-F1 Sad I-R1 F3 B3
TTGCGCCTGAACGGATAT GGAGAAGCACTGGACGAGG CCAAAGGAGGTGCCTGTTCA TTGAGGTGAGTCAGAATGTTGTTC GTGGGAAGCCGATCCTACT TGGTTGCAGCATCGAATCC
277
Sad1 cry1A
107 218
360
P. Shen et al. / Food Control 62 (2016) 357e364
Fig. 2. Identification of SPS gene of rice and Sad1 gene of cotton by PCR. 1. Blank (w/o template), 2. GM rice, 3. Non-GM rice, 4. 100 bp DNA ladder, 5. Blank (w/o template), 6. GM cotton, 7. Non-GM cotton.
extracted from cotton cultivars because the target bands were also detected in both GM cotton (lane 6) and non-GM cotton (lane 7). Using these genomic DNA samples as templates, we tried to set up the reaction system via optimizing the conditions of LAMP assay including amplification temperature, Mg2þ, dNTP, Bst DNA polymerase (Bst) and the ratio of the outer primer to the inner primer (Ri/o) for detection of the GM cry1A gene in GM crops. Under the following conditions, 60.0e66.0 C, 0e3.0 mM Mg2þ, 0.8e2.8 mM dNTP, 0.5e1.5 mL of Bst (8 U/mL) and Ri/o at 1:5e1:9, all reactions of LAMP displayed the LAMP-specific ladder-pattern bands on agarose gel (data not shown), indicating that the LAMP reactions were positive. By evaluating the quantity of each LAMP product amplified under the different conditions, the optimal concentrations and conditions of LAMP assay were as follows: 1.0 mM Mg2þ, 2.0 mM dNTP, 0.7 mL Bst, Ri/o at 1:6 and the temperature at 65 C. Fig. 3A displayed the standard ladder-pattern bands amplified from GM rice and GM cotton (lane 3 and 4) under the optimized conditions. These results indicated that the GM cry1A could be detected with the LAMP assay in both GM rice and GM cotton. The green fluorescence color in tube 2 and 3 (GM rice and GM cotton) of Fig. 3C confirmed the positive results of Fig. 3A. We also verified the presence of the GM cry1A gene in the DNA samples of GM rice and GM cotton by PCR assay (Fig. 3B). All the evidences above demonstrated that we established a LAMP reaction system for detection of the GM cry1A gene in GM rice and GM cotton.
3.2. Determination of the limit of detection (LOD) of LAMP assay method for detecting the GM cry1A gene in GM rice and GM cotton After the LAMP reaction system was set up, we next wanted to determine the LOD of the LAMP assay method and make a comparison with that of PCR assay method. As shown in the top panel of Fig. 4, when the weight ratios of GMC to the non-GMC were in a range from 10% to 0.01%, the LAMP reactions were all positive, both in GM rice and GM cotton samples. While no amplified products of LAMP either in GM rice or GM cotton samples were found if the ratio was as low as to 0.005%. These results were confirmed by the observation of visible green color in each corresponding tube excited by UV light (Fig. 4 bottom panel). Therefore, the evidence
above demonstrated that the limit of weight ratio of GMCs to the non-GMCs for detection of the GM cry1A gene in GM rice and GM cotton was 0.01%. Comparing to the LAMP assay method, the LOD in the PCR assay was 0.1% which was 10 times higher than that of the LAMP assay (Fig. 4, middle panel). Since determination of an exact LOD need more repetitions, e.g. 10 repetitions or more, 0.01% and 0.1% could be respectively considered as a rough LOD for the LAMP assay and PCR assay in the present study. Anyway, these results indicated that the sensitivity of PCR assay was much lower than that of the LAMP assay method. Fukuta et al. (2004) reported that LOD of GMO content was 0.5% when the CaMV35S promoter was detected in Roundup-Ready soybean using LAMP assay approach. Li et al. (2013) developed a LAMP method for detection of the exogenous cry1Ab gene in GM rice and revealed that the detection limit of this method was as low as 300 copies of plasmid with a detection limiting rate of 0.5%. By using ten-fold serial dilutions of plasmid 1Ac0229 and genomic DNA of GM sugarcane as templates, the sensitivities of the LAMP assay and conventional PCR were compared and the results revealed that the detection limit of the LAMP method was 43.1 copies of plasmid and 1.0 ng/mL sugarcane genomic DNA, while that of the conventional PCR method was 431 copies and 10.0 ng/ mL, respectively (Zhou et al., 2014). These facts unambiguously confirmed our conclusion that the sensitivity of LAMP was around 10 times higher than that of conventional PCR. The sensitivity of LAMP assay and real-time PCR assay usually is close to each other and much higher than that of the conventional PCR assay. Anthony Johnson, Dasgupta, and Sai Gopal (2014) developed a LAMP and SYBR green real-time PCR method for the detection of citrus yellow mosaic badnavirus in citrus species. The minimum detected amount of DNA sample of LAMP and SYBR green real-time PCR was 10 ng and 1 ng, separately. This result was also confirmed by Lin et al., (2012) through the detection of a 529bp repeat element for diagnosis of toxoplasmosis using LAMP assay and real-time PCR assay. While, Zhang et al. (2014) demonstrated that both the SYBR green I-based real-time RT-PCR and reversetranscription LAMP assay have the same lowest detection threshold, 10 copies of target DNA of bovine viral diarrhea virus (BVDV). Siljo and Bhat (2014) compared the performance of reverse transcription LAMP assay and reverse transcription PCR assay for detection of banana bract mosaic virus in cardamom (Elettaria cardamomum) and found that the detection limit for RT-LAMP was up to 100 times that for conventional RT-PCR and on a par with that for real-time RT-PCR. Based on these evidences, the sensitivity of LAMP is generally equal to or slightly lower than that of real-time PCR, although comparison of these two methods is complicated and need to find an adapted metric (Nixon et al., 2014). In spite of this, LAMP assay may offer potential advantages over real-time PCR such as simplicity, speed and resistance to inhibitors and low cost for quantitative molecular analysis. 3.3. The specificity of the LAMP assay method for detection of the GM cry1A gene in GM rice and GM cotton In order to verify the result that the LAMP assay method has a high specificity for the detection of the GM cry1A gene in GMCs, fifteen cultivars/events and five Bt strains were subjected to analysis using the LAMP assay method and the PCR assay method. The top panel and the middle panel of Fig. 5 showed the results of LAMP assay. As shown in top panel of Fig. 5, tube 1 and tube 23 indicated the negative and the positive result, respectively. Five GMCs rice (HH1, cotton LM-17, cotton DPH37B, cotton DP99B and cotton DP33B) were screened and demonstrated to be GM cry1A-positive (tubes 3 and 7e10, top panel of Fig. 5). The other cultivars including three rice cultivars (4021-P6, 9311 and TP309-P6), three non-GM
P. Shen et al. / Food Control 62 (2016) 357e364
361
Fig. 3. Agarose gel analysis of the LAMP products (A) and PCR products (B) amplified from the GM cry1A gene in GM rice (HH-1) and GM cotton (DPH37B) and the visual inspection of the LAMP products using SYBR Green I dye (C). 1. 100 bp DNA ladder, 2. Negative control, 3. HH-1, 4. DPH37B.
cotton cultivars (TM-1 and JM-11, YXM-4), two soybean cultivars (ZH-13, ZH-55) and two tomato cultivars (BGQF, GFYT) were demonstrated to be GM cry1A-negative because there were no florescence signal in the corresponding tubes (tubes 4e6 and 11e17, top panel, Fig. 5). As for the five Bt strains, the results showed absence of the green fluorescence signal in the corresponding tubes (tubes 18e22, top panel of Fig. 5). These results were confirmed by the DNA gel analysis (middle panel of Fig. 5). In order to further compare PCR assay method with LAMP assay method, the DNA region used as the template of LAMP assay was amplified by PCR using the out primers F3/B3 of LAMP and the results showed in the bottom panel of Fig. 5. With regard to the crops, the PCR results were in accord with the LAMP results. These facts indicated that both LAMP assay method and PCR method were highly specific for detection of GM rice and GM cotton which containing the foreign GM cry1A gene. As for Bt strains, beyond our expectation, a 218 bp long DNA band presented in the lanes 18, 19 and 20 when PCR products were analyzed with agarose gel. These results indicated that Bt strains HD73, 46A and HD12 contained cry1Ab/cry1Ac gene. In contrast, the other two Bt strains, 173A and 160C were all cry1Ab/ cry1Ac-negative. These facts implied that the primers F3/B3 is able
to distinguish the sequences of cry1Ab/cry1Ac gene from cry8 gene. In other words, PCR assay with primers F3/B3 show highly specificity to the cry1Ab/cry1Ac genes since their sequences region covered by PCR assay in this study were almost the same (Fig. 6 top panel). Fig. 6 showed the different bases (letters w/o background or with gray background) and the same bases (with black background) in the LAMP and PCR testing region of GM cry1A and cry1Ab/cry1Ac genes and their encoding amino acid sequences. Because the GM cry1A gene has been modified according to the plant preferred codon, as shown in top panel of Fig. 6, 55 bases of the original cry1Ab/cry1Ac gene have been replaced with the different bases, resulting in the generation of the GM cry1A gene. Therefore, as results shown in Fig. 5, all GM crops were verified as positive samples rather than any Bt strains harboring cry1Ab/cry1Ac genes when tested with LAMP assay. On the contrary, both GM crop samples and Bt strains harboring cry1Ab/cry1Ac genes were all positive when tested by PCR assay. It was the different bases that contribute to high specificity of LAMP assay in comparison with PCR assay which couldn't distinguish the GM cry1A gene from the native cry1Ab/cry1Ac genes. These results obviously indicated that the
362
P. Shen et al. / Food Control 62 (2016) 357e364
Fig. 4. Comparison of the LOD of LAMP assay with PCR assay in detection of the GM cry1A gene of the GM cotton (DPH37B, left panel) and GM rice (HH-1, right panel). Left panel: 1. 100 DNA ladder, 2e10. the weight ratio of the GM cotton to the non-GM cotton are 10%, 5%, 2%, 1%, 0.5%, 0.1%, 0.01%, 0.005%, 0.0%. Right panel: 1. 100 DNA ladder, 2e10. the weight ratio of the GM rice to the Non-GM rice are 10%, 5%, 2%, 1%, 0.5%, 0.1%, 0.01%, 0.005%, 0.0%.
Fig. 5. Comparison of the specificity of LAMP assay (top and middle panel) with PCR assay (bottom panel) in detection of the GM cry1A gene of the GMCs (cotton and rice), nonGMCs (rice, cotton, soybean and tomato) and Bt strains. 1. negative control, 2 and 23. 100 bp DNA ladder, 3. GM rice HH-1, 4. rice 4021-P6, 5. rice 9311, 6. rice TP309-P6, 7. GM cotton DPH37B, 8. GM cotton DP99B, 9. GM cotton DP33B, 10. LM-17, 11. YXM-4, 12. TM-1, 13. JM-11, 14. soybean ZH-13, 15. soybean ZH-55, 16. tomato BGQF, 17. tomato GFYT, 18. Bt HD73, 19. Bt HD12, 20. Bt 46A, 21. Bt173, 22. Bt160C, 23. positive control (top panel).
P. Shen et al. / Food Control 62 (2016) 357e364
363
Fig. 6. Alignment of DNA (top panel) and protein (bottom panel) sequences of GM cry1A (GM crops) with cry1Ac (Bt HD73 and Bt 46A), cry1Ab (Bt HD12). The black, gray and white backgrounds indicate the consensus in the sequences form high to low.
LAMP assay has much more specificity than PCR assay. If carefully comparing the sequence of the GFM cry1A gene and cry1A-Mon gene (the first two lines, top panel of Fig. 6), there still one different base exists (195C to G) between them. However, because this mutant just right locates between primer B2 and primer B3 (Fig. 1), we predicted it should not affect the LAMP result for detecting the GM cry1A in GM crops. The results that all the GM crops were tested as GM cry1A-positive demonstrated this expectation. The commercialization of GM crops has raised the issues of food safety, environmental risk and social ethics morals. The practicable and accurate measurement method for detecting and screening the foreign gene in GM crops will facilitate regulating the commercialization of GMCs and monitoring the situation of gene flow from GM crop to non-GM crop by timely detecting the presence of the foreign gene in crops or environment. To monitor the cry gene as well as other foreign genes in the GM crops, different methods based on PCR system have been developed (Cheng et al., 2007; Kamle, Kumar, et al., 2011; Pan & Shih, 2003; Randhawa et al., 2010). Real time PCR will provide more details about the foreign genes in GM crops (Chhabra et al., 2014; Dinon et al., 2011). In contrast to the LAMP assay method, primer design should be careful, as sometimes the PCR and real-time PCR assay was not able to differentiate the modified cry gene from the native cry gene, as we reported above. If the situation occurs, you may not explicitly tell where the cry genes you testing come from GM crops or Bt strain attached to the surface of non-GM crops or both. On the contrary, with high specificity, LAMP assay method can overcome this problem. Currently, the LAMP methods for the detection of GM rice (Chen et al., 2012) and GM soybean (Wang et al., 2013) have been developed, although the detecting target genes are different. By carefully selecting the detection region of GM cry1A gene, we developed the LAMP assay with high sensitivity and specificity for rapid detection GM cry1A gene which is widely used as the foreign
gene in construction of GM crops. 4. Conclusions A novel LAMP assay method for detection of GM cry1A gene in GM crops has been established by performing DNA amplification at 65 C for 60 min using Bst polymerase. The rough detection limit to the GM cry1A gene in transgenic insect-resistant rice/cotton is 0.01% (ratio of GM/non-GM) which is 10 times of the conventional PCR method. The specificity of this method is better than the conventional PCR method because LAMP assay method rather than the PCR method can distinguish the GM cry1A gene from the native cry1Ab/cry1Ac genes. Therefore, this LAMP method will be a potential effective tool for identification of the GM cry1A gene containing GM crops which are widely plant in China and other developing countries. Acknowledgment This research was supported by grants of Major Cultivation Projects of Genetically Modified New Varieties of Organism, PR China (2008ZX09004-004 and 2013ZX08012001), the National Natural Science Foundation of China (31071494 and 31371772) and the Hebei Provincial Foundation for Returned Scholars, China (No. 2010-195). References Allen, R. C., Rogelj, S., Cordova, S. E., & Kieft, T. L. (2006). An immuno-PCR method for detecting Bacillus thuringiensis Cry1Ac toxin. Journal of Immunological Methods, 308, 109e115. Anthony Johnson, A. M., Dasgupta, I., & Sai Gopal, D. V. R. (2014). Development of loop-mediated isothermal amplification and SYBR green real-time PCR methods for the detection of citrus yellow mosaic badnavirus in citrus species. Journal of Virological Methods, 203, 9e14. Asiello, P. J., & Baeumner, A. J. (2011). Miniaturized isothermal nucleic acid
364
P. Shen et al. / Food Control 62 (2016) 357e364
amplification, a review. Lab on a Chip, 11(8), 1420e1430. http://dx.doi.org/ 10.1039/c0lc00666a. Babekova, R., Funk, T., Pecoraro, S., Engel, K., & Busch, U. (2009). Development of an event-specific real-time PCR detection method for the transgenic Bt rice line KMD1. European Food Research and Technology, 228(3), 707e716. Biswas, G., & Sakai, M. (2014). Loop-mediated isothermal amplification (LAMP) assays for detection and identification of aquaculture pathogens: current state and perspectives. Applied Microbiology and Biotechnology, 98(7), 2881e2895. http://dx.doi.org/10.1007/s00253-014-5531-z. n, M. (2011). Bacillus thuringiensis: Bravo, A., Likitvivatanavong, S., Gill, S. S., & Sobero a story of a successful bioinsecticide. Insect Biochemistry and Insect Molecular Biology, 41(7), 423e431. http://dx.doi.org/10.1016/j.ibmb.2011.02.006. Cheng, H., Jin, W., Wu, H., Wang, F., You, C., Peng, Y., et al. (2007). Isolation and PCR detection of foreign DNA sequences in bee honey raised on genetically modified Bt (Cry1Ac) cotton. Food and Bioproducts Processing, 85, 141e145. Chen, X., Wang, X., Jin, N., Zhou, Y., Huang, S., & Miao, Q. (2012). End point visual detection of three genetically modified rice events by loop mediated isothermal amplification. International Journal of Molecular Sciences, 13, 14421e14433. Chhabra, R., Randhawa, G. J., Bhoge, R. K., & Singh, M. (2014). Qualitative and quantitative PCR-based detection methods for authorized genetically modified cotton events in India. Journal of AOAC International, 97, 1299e1309. Ding, J., Jia, J., Yang, L., Wen, H., Zhang, C., Liu, W., et al. (2004). Validation of a rice specific gene, sucrose phosphate synthase, used as the engodenous reference gene for qualitative and real-time quantitative PCR detction of transgenes. Journal of Agricultural and Food Chemistry, 52(11), 3372e3377. Dinon, A. Z., Prins, T. W., van Dijk, J. P., Arisi, A. C., Scholtens, I. M. J., & Kok, E. J. (2011). Development and validation of real-time PCR screening methods for detection of cry1A.105 and cry2Ab2 genes in genetically modified organisms. Analytical and Bioanalytical Chemistry, 400(5), 1433e1442. http://dx.doi.org/ 10.1007/s00216-011-4875-9. Ermolli, M., Prospero, A., Balla, B., Querci, M., Mazzeo, A., & Van Den Eede, G. (2006). Development of an innovative immunoassay for CP4EPSPS and Cry1Ab genetically modified protein detection and quantification. Food Additives and Contaminants, 23(9), 876e882. Fischhoff, D. A., Bowdish, K. S., Perlak, F. J., Marrone, P. G., McCormick, S. M., Niedermeyer, J. G., et al. (1987). Insect tolerant transgenic tomato plants. Nature Biotechnology, 5, 807e813. http://dx.doi.org/10.1038/nbt0887-807. Fischhoff, D. A., & Perlak F. J. (1995). Synthetic plant genes and method for preparation. US, US7741118B1, Application Number 08/434105, May 3, 1995; Patent date: June-22, 2010. Fukuta, S., Mizukami, Y., Ishida, A., Ueda, J., Hasegawa, M., Hayashi, I., et al. (2004). Real-time loop-mediated isothermal amplification for the CaMV-35S promoter as a screening method for genetically modified organisms. European Food Research and Technology, 218, 496e500. Guo, S., Ni, W., & Xu, Q. (November 5, 1996). Expressive Carrier With Coded Insectkilling Protein Fusion Gene, and Transfer Gene Plant. CN95119563. Application Number: 95119563; Publication Number: 1134981. (in Chinese). €fte, H., & Whiteley, H. R. (1989). Insecticidal crystal proteins of Bacillus thurHo ingiensis. Microbiological Review, 53, 242e255. James, C. (2008). Global status of commercialized biotech/GM crops: 2007, ISAAA brief 37e2007, International Service for the Acquisition of Agri-biotech Applications (ISAAA). James, C. (2011). Global status of commercialized biotech/GM crops. Ithaca, NY: ISAAA. No. 43: ISAAA http//www.isaaa.org/resources/publications/briefs/43/. Accession 01.05.12. Jouanin, L., Bottino, M. B., Girard, C., Morrot, G., & Giband, M. (1988). Transgenic plants for insect resistance. Plant Science, 131(1), 1e11. http://dx.doi.org/10.1016/ S0168-9452(97)00239-2. Kamle, S., Kumar, A., & Bhatnagar, R. (2011). Development of multiplex and construct specific PCR assay for detection of cry2Ab transgene in genetically modified crops and product. GM Crops & Food, 2, 74e81. Kamle, S., Ojha, A., & Kumar, A. (2011). Development of an enzyme linked immunosorbant assay for the detection of Cry2Ab protein in transgenic plants. GM Crops & Food, 2, 125e132. Kumar, S., Chandra, A., & Pandey, K. C. (2008). Bacillus thuringiensis (Bt) transgenic crop: an environment friendly insect-pest management strategy. Journal of
Environmental Biology, 29(5), 641e653. Li, Q., Fang, J., Liu, X., Xi, X., Li, M., Gong, Y., et al. (2013). Loop-mediated isothermal amplification (LAMP) method for rapid detection of cry1Ab gene in transgenic rice (Oryza sativa L.). European Food Research and Technology, 236, 589e598. Lin, Z., Zhang, Y., Zhang, H., Zhou, Y., Cao, J., & Zhou, J. (2012). Comparison of loopmediated isothermal amplification (LAMP) and real-time PCR method targeting a 529-bp repeat element for diagnosis of toxoplasmosis. Veterinary Parasitology, 185, 296e300. Liu, Y. J., & Wang, G. Y. (2003). The inheritance and expression of cry1A gene in transgenic maize. Acta Botanica Sinica, 3, 253e256. Nixon, G. J., Svenstrup, H. F., Donald, C. E., Carder, C., Stephenson, J. M., MorrisJones, S., et al. (2014). A novel approach for evaluating the performance of real time quantitative loop-mediated isothermal amplification-based methods. Biomolecular Detection and Quantification, 2, 4e10. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., et al. (2000). Loop-mediated isothermal amplification of DNA. Nucleic Acids Research, 28(12), 63e68. Pan, T. M., & Shih, T. W. (2003). Detection of genetically modified soybeans in miso by polymerase chain reaction and nested polymerase chain reaction. Journal of Food and Drug Analysis, 11(2), 154e158. Randhawa, G. J., Singh, M., Chhabra, R., & Sharma, R. (2010). Qualitative and quantitative molecular testing methodologies and traceability systems for commercialized Bt cotton events and other Bt crops under field trials in India. Food Analytical Methods, 3(4), 295e303. http://dx.doi.org/10.1007/s12161-0109126-8. Shan, G., Embrey, S. K., & Schaffer, B. W. (2007). A highly specific enzyme-linked immunosorbent assay for the detection of Cry1Ac insecticidal crystal protein in transgenic WideStrike cotton. Journal of Agricultural and Food Chemistry, 55, 5974e5979. Shu, C., Yan, G., Wang, R., Zhang, J., Feng, S., Huang, D., et al. (2009). Characterization of a novel cry8 gene specific to Melolonthidae pests: Holotrichia oblita and Holotrichia parallela. Applied Microbiology Biotechnology, 84, 701e707. Siljo, A., & Bhat, A. I. (2014). Reverse transcription loop-mediated isothermal amplification assay for rapid and sensitive detection of banana bract mosaic virus in cardamom (Elettaria cardamomum). European Journal of Plant Pathology, 138, 209e214. Tiwari, K. L., Jadhav, S. K., & Gupta, S. (2012). Modified CTAB technique for isolation of DNA from some medicinal plants. Journal of Medicinal Plants Research, 6, 65e73. Wang, X., Teng, D., Guan, Q., Tian, F., & Wang, J. (2013). Detection of roundup ready soybean by loop-mediated isothermal amplification combined with a lateralflow dipstick. Food Control, 29, 213e220. Yang, L., Chen, J., Huang, C., Liu, Y., Jia, S., Pan, L., et al. (2005). Validation of a cottonspecific gene Sad1, used as an endogenous reference gene in qualitative and real-time quantitative PCR detection of transgenic cottons. Plant Cell Reports, 24(4), 237e245. Zhang, D., & Guo, J. (2011). The development and standardization of testing methods for GMO and their derived products. Journal of Integrative Plant Biology, 3, 539e551. Zhang, B., Guo, W., & Zhang, T. (2013). Inheritance of transgenes in transgenic Bt lines resistance to Helicoerpa armigera in upland cotton. In , 958. Transgenic cotton: Methods and protocols, methods in molecular biology (pp. 165e176). New York: Springer ScienceþBisiness Media. http://dx.doi.org/10.1007/978-162703-212-4_14. Zhang, S., Tan, B., Li, P., Wang, F., Guo, Li, Yang, Y., et al. (2014). Comparison of conventional RT-PCR, reverse-transcription loop-mediated isothermal amplification, and SYBR green I-based real-time RT-PCR in the rapid detection of bovine viral diarrhea virus nucleotide in contaminated commercial bovine sera batches. Journal of Virological Methods, 207, 204e209. Zhou, D., Guo, J., Xu, L., Gao, S., Lin, Q., Wu, Q., et al. (2014). Establishment and application of a loop-mediated isothermal amplification (LAMP) system for detection of cry1Ac transgenic sugarcane. Scientific Reports, 4, 4912. http:// dx.doi.org/10.1038/srep04912. Zhu, X., Chen, L., Shen, P., Jia, J., Zhang, D., & Yang, L. (2011). High sensitive detection of Cry1Ab protein using a quanti-dot based fluorescence-linked immunosorbant assay. Journal of Agricultural and Food Chemistry, 23, 2184e2189.
Contents lists available at ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
A rapid loop-mediated isothermal amplification method for detection of the modified GM cry1A gene in transgenic insect-resistant cotton and rice Peili Shen a, 1, Fengzhen Geng b, 1, Yan Yu a, 1, Yunzhe Zhang a, Zhixin Wang a, Zhihui Li a, Wei Zhang a, Changlong Shu c, Yongjun Zhang c, **, Jianxin Tan a, * a College of Food Science, Agricultural Products Processing Engineering Technology Center of Hebei, Agricultural University of Hebei, Baoding 071001, PR China b Department of Clinic Laboratory, Affiliated Hospital of Hebei University, Baoding 071001, PR China c Institute of Plant Protection, Chinese Academy of Agricultural Sciences, State Key Laboratory of Biology for Plant Disease and Insect Pests, Beijing 100193, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 June 2015 Received in revised form 16 September 2015 Accepted 26 October 2015 Available online 29 October 2015
Among the commercial genetically modified (GM) crops, the insect-resistant GM crops are the major cultivars that cry gene is introduced into. A cry1Ab/1Ac GM fusion gene (GFM cry1A) and a GM truncated cry1Ac gene (cry1Ac-Mon) is the key foreign gene employed for construction of GM crops by China researchers and Monsanto Technology LLC respectively. Here these two genes are entitled “GM cry1A” gene and a rapid visual loop-mediated isothermal amplification (LAMP) assay method for detection of GM cry1A in transgenic insect-resistant crops was established. The LAMP assay was performed at an optimal temperature of 65 C for 60 min in the presence of a set of four specific primers recognized six distinct sequences of the GM cry1A gene. The rough detection limit to the GM cry1A in samples is as low as 0.01% (a weight ratio of transgenic insect-resistant rice/cotton to non-transgenic rice/cotton). Comparatively, the sensitivity of this LAMP method is 10 times over that of the conventional PCR method. Fifteen cultivars/events and five Bt strains with or without cry1A gene were analyzed using the LAMP method as well as PCR method. The results demonstrate that this LAMP method shows a distinct specificity to the GM cry1A gene comparing with PCR analysis. Therefore, this LAMP method will be a potential effective tool for screening the GM cry1A gene in GM crops which are widely plant in China and other developing countries. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Insect-resistant GM crop GM cry1A gene Loop-mediated isothermal amplification PCR
1. Introduction Bacillus thuringiensis (Bt) is a gram positive bacterium that has been practically applied to insect pest control because of its insecticidal crystal proteins (ICPs, d-endotoxins) formed during sporulation. Since ICPs encoded by cry genes are highly specific toxin against a wide variety of insect pests of dipteran, coleopteran €fte & Whiteley, 1989), cry genes have been and lepidopteron (Ho considering as the main candidates to be introduced into crops for agricultural pest control. Fischhoff et al. (1987) reported that the
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (Y. Zhang), [email protected] (J. Tan). 1 The first three authors should be regarded as joint First Authors. http://dx.doi.org/10.1016/j.foodcont.2015.10.035 0956-7135/© 2015 Elsevier Ltd. All rights reserved.
truncated cry gene from Bt var. kurstaki HD-1 was transformed into tobacco and tomato generating the GM tobacco and tomato. After that, a variety of cry genes (cry1Ac, cry1Ab, cry2Aa, cry2Ab, cry2Ac, cry1F and vip-3A) were introduced into different plants producing n, 2011; many GM crops (Bravo, Likitvivatanavong, Gill, & Sobero Jouanin, Bottino, Girard, Morrot, & Giband, 1988; Kumar, Chandra, & Pandey, 2008). Guo, Ni, and Xu (1996) artificially synthesized an 1824 bp long GFM cry1A gene consisting of domain I (1e286 residues) of cry1Ab and domain II and III (287e608 residues) of cry1Ac which were all optimized with plant-preferred codon. Then the GFM cry1A was transformed into a number of main cotton cultivars in China resulting in the first generation of GM cotton. Up to now in China, many insect-resistant GM crops including commercialized ones are still using GFM cry1A or its derivatives as the foreign genes (Liu & Wang, 2003; Zhang, Guo, & Zhang, 2013,
358
P. Shen et al. / Food Control 62 (2016) 357e364
chap. 14; Chhabra, Randhawa, Bhoge, & Singh, 2014). Meanwhile, a series of commercial insect-resistant transgenic cottons such as events DP33B and DP99B, namely Genuity Bloogard™, were generated by Monsanto Technology LLC and have been widely planted in China and many other countries. These GM cottons contain a synthetic truncated cry1Ac gene (cry1Ac-Mon) which is from B. thuringiensis subsp. Kustaki HD73 and has been optimized with plant-preferred codon (Fischhoff & Perlak, 1995). Nowadays, pest resistant or/and herbicide tolerant GM crops (e. g. GM soybean, cotton, maize and rapeseed) have been permitted to be planted in both developed and developing countries and the area of GM crops has markedly increased all over the world (James, 2008, 2011). This fact will be a two-edged sword. On the one hand, the commercialization of GM crops will alleviate or overcome the crisis of global food security in a certain extent. On the other hand, it will simultaneously bring about the issues of food safety, environmental risk, ecology security and social ethics morals. Hence, the best strategy for governments and administrators is to enact and improve policies and regulations. To do so, establishment and development of the new practicable and accurate analysis method for detecting and screening the foreign gene in GM crops appears to be of essence and should be strengthened. Besides bioassay method, which is a primary, low cost but time consuming method for detecting the GM crops, the other efficient types of methods with higher specificity and sensitivity are developed based on the detection of the foreign gene (DNA) or its expression product (protein). For protein based detection methods, ELISA is the basic and standard approach. This method has been applied to detection of the introduced ICPs including Cry1Ac (Shan, Embrey, & Schaffer, 2007), Cry1Ab (Ermolli et al., 2006; Zhu et al., 2011), and Cry2Ab (Kamle, Ojha, & Kumar, 2011) expressed in GM crops (e.g. GM cotton and GM maize). Because the ELISA method is costly and complicated comparing to the DNA based method, the latter one has been developed rapidly and used extensively in detection of the foreign genes in GM crops. Conventional PCR (Cheng et al., 2007) and nest PCR (Pan & Shih, 2003) are employed for detecting a single cry gene in GM crops. Multiple PCR (Kamle, Kumar, & Bhatnagar, 2011; Randhawa, Singh, Chhabra, & Sharma, 2010) are applied to identifying two or more cry genes simultaneously. Real time PCR can not only identify the foreign genes, but also determine the copies of the target genes in GM crops (Babekova, Funk, Pecoraro, Engel, & Busch, 2009; Chhabra et al., 2014; Dinon et al., 2011). Furthermore, a method combining PCR with ELISA, namely Immuno-PCR, has also been used to detect the cry genes in GM crops with higher sensitivity and specificity (Allen, Rogelj, Cordova, & Kieft. 2006; Zhang & Guo, 2011). The indispensability of a thermocycler or a microplate reader for performing the DNA or protein based method limits their employment in a certain degree. Thus, a simple time-saved and cost-effective assay method is needed to complement current PCR or ELISA methods for the detection of GM crops. Loop-mediated isothermal amplification (LAMP) method is first reported in 2000 for the amplification of DNA with high specificity, efficiency and rapidity under isothermal conditions (Notomi et al., 2000). LAMP technology has already been recognized as a powerful diagnostic tool for detecting a specific sequence from a gene (e.g. a cry gene in GM crops), infectious pathogens (including bacteria, viruses and fungi) or human diseases (e. g. cancer) (Asiello & Baeumner, 2011; Biswas & Sakai, 2014). The sensitive LAMP methods employed for the detection of three GM rice events (Chen et al., 2012) and GM soybean (Wang, Teng, Guan, Tian, & Wang, 2013) have been reported recently. In the present study, we report a new visual LAMP method for rapid detection of both the GFM cry1A gene which is widely used as the foreign gene in construction of GM crops in China and the cry1AcMon gene in Genuity Bloogard™ cottons.
2. Materials and methods 2.1. Cultivars and Bt strains Insect-resistant rice Huahui-1 (HH-1, containing GFM cry1A gene) and insect-resistant cottons DPH37B, DP33B, DP99B (containing cry1Ac-Mon gene, belong to MON531 event (Genuity Bloogard™)), were from Dr. Yong-jun Zhang's Lab, State key Laboratory of Biology for Plant Disease and Insect Pests, Chinese Academy of Agricultural Sciences (CAAS), China. Non-GM rices 4021-P6, 9311 and TP309-P6 were provided by professor Li-juan Liu, Agricultural University of Hebei (AUH), Baoding, China. Non-GM cottons TM-1 and Jimian-11 (JM-11) were provided by Dr. Xing-fen Wang, AUH, Baoding, China. The insect-resistant cotton Lumian-17 (LM-17), non-GM cotton YXM-4, non-GM soybean Zhonghuang-13 (ZH-13), Zhonghuang-55 (ZH-55), non-GM tomato Baiguoqiangfeng (BGQF) and Guifeiyingtao (GFYT) were purchased from a farm market in Baoding, China. Bt subsp. Kustaki HD73 (containing genes cry1Ac1, cry1Ac7 and cry1Ac8), Bt HD12 (containing a cry1Ab24 gene, http://www.lifesci.sussex.ac.uk/home/Neil_ Crickmore/Bt/toxins2.htmlhttp://www.lifesci.sussex.ac.uk/home/ Neil_Crickmore/Bt/toxins2.html), Bt 46A (containing a cry1Ac gene), Bt 173A (containing two cry8 genes) and Bt 160C (contain a cry8 gene) were from this lab. 2.2. DNA extraction DNAs of GM crops and non-GM crops were extracted from the mixed powdered leaf samples (totally 200 mg) with CTAB method (Tiwari, Jadhav, & Gupta, 2012). The DNA samples were qualified by agarose gel electrophoresis and evaluated with Nanodrop 2000 spectrophotometer (Thermo scientific). DNA concentration of each sample was adjusted to a final concentration of 50 ng/mL and stored at 80 C for further experiments. Plasmids containing cry genes from Bt strains were extracted according to the plasmid-extraction protocol (Shu et al., 2009). 2.3. Primer design for LAMP and conventional PCR A set of primers of LAMP assay (Table 1) was designed using LAMP primer designing software Primer Explorer version 4 (http:// primerexplorer.jp/elamp4.0.0/index.html) according to sequence of the GFM cry1A gene (Guo et al., 1996). The primers which included a pair of inner primers (FIP and BIP) and a pair of outer primers (F3 and B3) located on the region from 327 bp to 545 bp of the GFM cry1A gene (Fig. 1) in the insect-resistant rice or cotton. Primers F3 and B3 at two ends of this region were designed for PCR assay. Primers F3 and B3 were employed for detection of the GM cry1A gene (Tables 1 and 2). Two pairs of primers (SPS-F1/SPS-R1 and sad I-F1/sad I-R1) for amplifying the endogenous reference gene SPS of rice (Genbank No. U33175) and sad1 of cotton (Genbank No. AJ132636) were designed with software Primer Premier 5.0 based on their sequence (Table 2). The size of each amplified PCR fragment was listed in the last column of Table 2. All the PCR and LAMP primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China). 2.4. LAMP assay LAMP assay was performed in 0.2 mL vials containing 25 mL reaction mixture which included 1.2 mM primer FIP and BIP, 0.2 mM primer F3 and B3 (Ri/o: 1:5, 1:6, 1:7, 1:8 and 1:9), 2 mM dNTPs (0.4, 0.8, 1.2, 1.6, 2.0, 2.4 and 2.8 mM), 0.5e1.0 mM MgSO4 (0, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 mM), 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, 20 mM TirseHCl, pH 8.8, 5.6e8U Bst (0.5, 0.7, 0.9, 1.1, 1.3, 1.5 mL) DNA
P. Shen et al. / Food Control 62 (2016) 357e364
359
Table 1 Primer sequences of LAMP and PCR assay in detection of the GFM cry1A gene of GM rice and cotton. Primer
Component
Sequence (50 -30 )
FIP BIP F3 B3
F1c þ F2 B1c þ B2 F3 B3
GCTGTGGTCAAGGCGCTGTT-AGCTCTCCGCGAGGAAAT TGTCCGTGTACGTTCAAGCAGC-CCCAAACACGCTAACGTCTC GTGGGAAGCCGATCCTACT TGGTTGCAGCATCGAATCC
Fig. 1. Partial sequence of the GFM cry1A gene which is for designing the primers of LAMP and PCR. The LAMP primers included a pair of outer primers (F3/B3) and two inner primers, the forward inner primer (FIP) which contains a complementary sequence alignment to F1 (F1c) linked with a F2 sequence (F2) and the backward inner primer which includes a B2 sequence (B2) linked with a complementary sequence to B1 (B1c). The PCR primers are F3 and B3. The locations of all primers are labeled with boxes.
polymerase large fragment (New England Biolabs), 1 mL of template DNA, 0.5 mL SYBR® Green I dye (Sigma Aldrich) and sterilized double-distilled water. The reaction mixture was incubated at 65 C for 60 min. To check whether the reaction occurred, LAMP products were directly visualized under the UV light and observed through naked eye. A change from orange to green color indicates that LAMP amplification is positive, whereas no color change means negative. To further confirm the LAMP results, 5 mL of the LAMP product was analyzed in 2.0% agarose gel stained with ethidium bromide and visualized by UV light.
assay, GM crop (GMC) samples and non-GM crop (non-GMC) samples were mixed at ratios (GMC mass to non-GMC mass) of 10%, 5%, 2%, 1%, 0.5%, 0.1%, 0.01%, 0.005%, 0.0%. DNA was extracted from the mixed samples using protocol described at section of 2.2 and LAMP or PCR assay was performed according to the description of 2.4 and 2.5. 3. Results and discussions 3.1. Setting up and optimization of a LAMP reaction system for detection of the GM cry1A gene in GM rice and GM cotton
2.5. Conventional PCR To detect the GM cry1A gene in GM rice or GM cotton and the endogenous reference gene SPS of rice or sad I gene of cotton, PCR amplification was performed in a 25 mL reaction mixture, containing 2 Es Taq Master Mix with Dyes (CoWin Bioscience Co., Ltd.), 10 mM of primers (Table 2) and 1 mL of DNA template in a thermal cycler (Biometra Co. Ltd., Goettingen, Germany) under the conditions as follows: denaturation at 94 C for 5 min, annealing at 54 C for 30 s and extension at 72 C for 30 s, for a total of 35 cycles; a final extension at 72 C for 6 min. Subsequently, 5 mL of PCR products were separated in 2.0% agarose gel and visualized by UV light after EB staining. 2.6. Limit of detection To determine the limit of detection (LOD) of LAMP assay and PCR
As a genetic marker of a certain species, the endogenous reference gene is usually used to differentiate the target species from the other species when they are identified with PCR or real-time PCR. It also can be employed as an internal positive control during detection of the genetic modified organisms and their products. Before setting up LAMP reaction system, it is necessary to identify the genomic DNA extracted from rice and cotton cultivars, GM or non-GM respectively by detecting firstly the rice-specific gene (sucrose phosphate synthase gene, SPS) (Ding et al., 2004) and the cotton-specific gene (Sad1) (Yang et al., 2005) using PCR approach. As shown in Fig. 2, no target PCR products were detected in blank samples (Fig. 2, lanes 1 and 5). whereas a 277 bp-long DNA band was detected in both GM rice (lane 2) and non-GM rice (lane 3) that demonstrated the genomic DNA extracted from rice cultivars were qualified as templates to develop the LAMP assay method for detection of the GM cry1A gene in GM rice. So did the DNA samples
Table 2 Primer sequence for PCR and the size of the PCR products. Gene name
Primer name
Sequence (50 -30 )
PCR product (bp)
SPS
SPS-F1 SPS-R1 Sad I-F1 Sad I-R1 F3 B3
TTGCGCCTGAACGGATAT GGAGAAGCACTGGACGAGG CCAAAGGAGGTGCCTGTTCA TTGAGGTGAGTCAGAATGTTGTTC GTGGGAAGCCGATCCTACT TGGTTGCAGCATCGAATCC
277
Sad1 cry1A
107 218
360
P. Shen et al. / Food Control 62 (2016) 357e364
Fig. 2. Identification of SPS gene of rice and Sad1 gene of cotton by PCR. 1. Blank (w/o template), 2. GM rice, 3. Non-GM rice, 4. 100 bp DNA ladder, 5. Blank (w/o template), 6. GM cotton, 7. Non-GM cotton.
extracted from cotton cultivars because the target bands were also detected in both GM cotton (lane 6) and non-GM cotton (lane 7). Using these genomic DNA samples as templates, we tried to set up the reaction system via optimizing the conditions of LAMP assay including amplification temperature, Mg2þ, dNTP, Bst DNA polymerase (Bst) and the ratio of the outer primer to the inner primer (Ri/o) for detection of the GM cry1A gene in GM crops. Under the following conditions, 60.0e66.0 C, 0e3.0 mM Mg2þ, 0.8e2.8 mM dNTP, 0.5e1.5 mL of Bst (8 U/mL) and Ri/o at 1:5e1:9, all reactions of LAMP displayed the LAMP-specific ladder-pattern bands on agarose gel (data not shown), indicating that the LAMP reactions were positive. By evaluating the quantity of each LAMP product amplified under the different conditions, the optimal concentrations and conditions of LAMP assay were as follows: 1.0 mM Mg2þ, 2.0 mM dNTP, 0.7 mL Bst, Ri/o at 1:6 and the temperature at 65 C. Fig. 3A displayed the standard ladder-pattern bands amplified from GM rice and GM cotton (lane 3 and 4) under the optimized conditions. These results indicated that the GM cry1A could be detected with the LAMP assay in both GM rice and GM cotton. The green fluorescence color in tube 2 and 3 (GM rice and GM cotton) of Fig. 3C confirmed the positive results of Fig. 3A. We also verified the presence of the GM cry1A gene in the DNA samples of GM rice and GM cotton by PCR assay (Fig. 3B). All the evidences above demonstrated that we established a LAMP reaction system for detection of the GM cry1A gene in GM rice and GM cotton.
3.2. Determination of the limit of detection (LOD) of LAMP assay method for detecting the GM cry1A gene in GM rice and GM cotton After the LAMP reaction system was set up, we next wanted to determine the LOD of the LAMP assay method and make a comparison with that of PCR assay method. As shown in the top panel of Fig. 4, when the weight ratios of GMC to the non-GMC were in a range from 10% to 0.01%, the LAMP reactions were all positive, both in GM rice and GM cotton samples. While no amplified products of LAMP either in GM rice or GM cotton samples were found if the ratio was as low as to 0.005%. These results were confirmed by the observation of visible green color in each corresponding tube excited by UV light (Fig. 4 bottom panel). Therefore, the evidence
above demonstrated that the limit of weight ratio of GMCs to the non-GMCs for detection of the GM cry1A gene in GM rice and GM cotton was 0.01%. Comparing to the LAMP assay method, the LOD in the PCR assay was 0.1% which was 10 times higher than that of the LAMP assay (Fig. 4, middle panel). Since determination of an exact LOD need more repetitions, e.g. 10 repetitions or more, 0.01% and 0.1% could be respectively considered as a rough LOD for the LAMP assay and PCR assay in the present study. Anyway, these results indicated that the sensitivity of PCR assay was much lower than that of the LAMP assay method. Fukuta et al. (2004) reported that LOD of GMO content was 0.5% when the CaMV35S promoter was detected in Roundup-Ready soybean using LAMP assay approach. Li et al. (2013) developed a LAMP method for detection of the exogenous cry1Ab gene in GM rice and revealed that the detection limit of this method was as low as 300 copies of plasmid with a detection limiting rate of 0.5%. By using ten-fold serial dilutions of plasmid 1Ac0229 and genomic DNA of GM sugarcane as templates, the sensitivities of the LAMP assay and conventional PCR were compared and the results revealed that the detection limit of the LAMP method was 43.1 copies of plasmid and 1.0 ng/mL sugarcane genomic DNA, while that of the conventional PCR method was 431 copies and 10.0 ng/ mL, respectively (Zhou et al., 2014). These facts unambiguously confirmed our conclusion that the sensitivity of LAMP was around 10 times higher than that of conventional PCR. The sensitivity of LAMP assay and real-time PCR assay usually is close to each other and much higher than that of the conventional PCR assay. Anthony Johnson, Dasgupta, and Sai Gopal (2014) developed a LAMP and SYBR green real-time PCR method for the detection of citrus yellow mosaic badnavirus in citrus species. The minimum detected amount of DNA sample of LAMP and SYBR green real-time PCR was 10 ng and 1 ng, separately. This result was also confirmed by Lin et al., (2012) through the detection of a 529bp repeat element for diagnosis of toxoplasmosis using LAMP assay and real-time PCR assay. While, Zhang et al. (2014) demonstrated that both the SYBR green I-based real-time RT-PCR and reversetranscription LAMP assay have the same lowest detection threshold, 10 copies of target DNA of bovine viral diarrhea virus (BVDV). Siljo and Bhat (2014) compared the performance of reverse transcription LAMP assay and reverse transcription PCR assay for detection of banana bract mosaic virus in cardamom (Elettaria cardamomum) and found that the detection limit for RT-LAMP was up to 100 times that for conventional RT-PCR and on a par with that for real-time RT-PCR. Based on these evidences, the sensitivity of LAMP is generally equal to or slightly lower than that of real-time PCR, although comparison of these two methods is complicated and need to find an adapted metric (Nixon et al., 2014). In spite of this, LAMP assay may offer potential advantages over real-time PCR such as simplicity, speed and resistance to inhibitors and low cost for quantitative molecular analysis. 3.3. The specificity of the LAMP assay method for detection of the GM cry1A gene in GM rice and GM cotton In order to verify the result that the LAMP assay method has a high specificity for the detection of the GM cry1A gene in GMCs, fifteen cultivars/events and five Bt strains were subjected to analysis using the LAMP assay method and the PCR assay method. The top panel and the middle panel of Fig. 5 showed the results of LAMP assay. As shown in top panel of Fig. 5, tube 1 and tube 23 indicated the negative and the positive result, respectively. Five GMCs rice (HH1, cotton LM-17, cotton DPH37B, cotton DP99B and cotton DP33B) were screened and demonstrated to be GM cry1A-positive (tubes 3 and 7e10, top panel of Fig. 5). The other cultivars including three rice cultivars (4021-P6, 9311 and TP309-P6), three non-GM
P. Shen et al. / Food Control 62 (2016) 357e364
361
Fig. 3. Agarose gel analysis of the LAMP products (A) and PCR products (B) amplified from the GM cry1A gene in GM rice (HH-1) and GM cotton (DPH37B) and the visual inspection of the LAMP products using SYBR Green I dye (C). 1. 100 bp DNA ladder, 2. Negative control, 3. HH-1, 4. DPH37B.
cotton cultivars (TM-1 and JM-11, YXM-4), two soybean cultivars (ZH-13, ZH-55) and two tomato cultivars (BGQF, GFYT) were demonstrated to be GM cry1A-negative because there were no florescence signal in the corresponding tubes (tubes 4e6 and 11e17, top panel, Fig. 5). As for the five Bt strains, the results showed absence of the green fluorescence signal in the corresponding tubes (tubes 18e22, top panel of Fig. 5). These results were confirmed by the DNA gel analysis (middle panel of Fig. 5). In order to further compare PCR assay method with LAMP assay method, the DNA region used as the template of LAMP assay was amplified by PCR using the out primers F3/B3 of LAMP and the results showed in the bottom panel of Fig. 5. With regard to the crops, the PCR results were in accord with the LAMP results. These facts indicated that both LAMP assay method and PCR method were highly specific for detection of GM rice and GM cotton which containing the foreign GM cry1A gene. As for Bt strains, beyond our expectation, a 218 bp long DNA band presented in the lanes 18, 19 and 20 when PCR products were analyzed with agarose gel. These results indicated that Bt strains HD73, 46A and HD12 contained cry1Ab/cry1Ac gene. In contrast, the other two Bt strains, 173A and 160C were all cry1Ab/ cry1Ac-negative. These facts implied that the primers F3/B3 is able
to distinguish the sequences of cry1Ab/cry1Ac gene from cry8 gene. In other words, PCR assay with primers F3/B3 show highly specificity to the cry1Ab/cry1Ac genes since their sequences region covered by PCR assay in this study were almost the same (Fig. 6 top panel). Fig. 6 showed the different bases (letters w/o background or with gray background) and the same bases (with black background) in the LAMP and PCR testing region of GM cry1A and cry1Ab/cry1Ac genes and their encoding amino acid sequences. Because the GM cry1A gene has been modified according to the plant preferred codon, as shown in top panel of Fig. 6, 55 bases of the original cry1Ab/cry1Ac gene have been replaced with the different bases, resulting in the generation of the GM cry1A gene. Therefore, as results shown in Fig. 5, all GM crops were verified as positive samples rather than any Bt strains harboring cry1Ab/cry1Ac genes when tested with LAMP assay. On the contrary, both GM crop samples and Bt strains harboring cry1Ab/cry1Ac genes were all positive when tested by PCR assay. It was the different bases that contribute to high specificity of LAMP assay in comparison with PCR assay which couldn't distinguish the GM cry1A gene from the native cry1Ab/cry1Ac genes. These results obviously indicated that the
362
P. Shen et al. / Food Control 62 (2016) 357e364
Fig. 4. Comparison of the LOD of LAMP assay with PCR assay in detection of the GM cry1A gene of the GM cotton (DPH37B, left panel) and GM rice (HH-1, right panel). Left panel: 1. 100 DNA ladder, 2e10. the weight ratio of the GM cotton to the non-GM cotton are 10%, 5%, 2%, 1%, 0.5%, 0.1%, 0.01%, 0.005%, 0.0%. Right panel: 1. 100 DNA ladder, 2e10. the weight ratio of the GM rice to the Non-GM rice are 10%, 5%, 2%, 1%, 0.5%, 0.1%, 0.01%, 0.005%, 0.0%.
Fig. 5. Comparison of the specificity of LAMP assay (top and middle panel) with PCR assay (bottom panel) in detection of the GM cry1A gene of the GMCs (cotton and rice), nonGMCs (rice, cotton, soybean and tomato) and Bt strains. 1. negative control, 2 and 23. 100 bp DNA ladder, 3. GM rice HH-1, 4. rice 4021-P6, 5. rice 9311, 6. rice TP309-P6, 7. GM cotton DPH37B, 8. GM cotton DP99B, 9. GM cotton DP33B, 10. LM-17, 11. YXM-4, 12. TM-1, 13. JM-11, 14. soybean ZH-13, 15. soybean ZH-55, 16. tomato BGQF, 17. tomato GFYT, 18. Bt HD73, 19. Bt HD12, 20. Bt 46A, 21. Bt173, 22. Bt160C, 23. positive control (top panel).
P. Shen et al. / Food Control 62 (2016) 357e364
363
Fig. 6. Alignment of DNA (top panel) and protein (bottom panel) sequences of GM cry1A (GM crops) with cry1Ac (Bt HD73 and Bt 46A), cry1Ab (Bt HD12). The black, gray and white backgrounds indicate the consensus in the sequences form high to low.
LAMP assay has much more specificity than PCR assay. If carefully comparing the sequence of the GFM cry1A gene and cry1A-Mon gene (the first two lines, top panel of Fig. 6), there still one different base exists (195C to G) between them. However, because this mutant just right locates between primer B2 and primer B3 (Fig. 1), we predicted it should not affect the LAMP result for detecting the GM cry1A in GM crops. The results that all the GM crops were tested as GM cry1A-positive demonstrated this expectation. The commercialization of GM crops has raised the issues of food safety, environmental risk and social ethics morals. The practicable and accurate measurement method for detecting and screening the foreign gene in GM crops will facilitate regulating the commercialization of GMCs and monitoring the situation of gene flow from GM crop to non-GM crop by timely detecting the presence of the foreign gene in crops or environment. To monitor the cry gene as well as other foreign genes in the GM crops, different methods based on PCR system have been developed (Cheng et al., 2007; Kamle, Kumar, et al., 2011; Pan & Shih, 2003; Randhawa et al., 2010). Real time PCR will provide more details about the foreign genes in GM crops (Chhabra et al., 2014; Dinon et al., 2011). In contrast to the LAMP assay method, primer design should be careful, as sometimes the PCR and real-time PCR assay was not able to differentiate the modified cry gene from the native cry gene, as we reported above. If the situation occurs, you may not explicitly tell where the cry genes you testing come from GM crops or Bt strain attached to the surface of non-GM crops or both. On the contrary, with high specificity, LAMP assay method can overcome this problem. Currently, the LAMP methods for the detection of GM rice (Chen et al., 2012) and GM soybean (Wang et al., 2013) have been developed, although the detecting target genes are different. By carefully selecting the detection region of GM cry1A gene, we developed the LAMP assay with high sensitivity and specificity for rapid detection GM cry1A gene which is widely used as the foreign
gene in construction of GM crops. 4. Conclusions A novel LAMP assay method for detection of GM cry1A gene in GM crops has been established by performing DNA amplification at 65 C for 60 min using Bst polymerase. The rough detection limit to the GM cry1A gene in transgenic insect-resistant rice/cotton is 0.01% (ratio of GM/non-GM) which is 10 times of the conventional PCR method. The specificity of this method is better than the conventional PCR method because LAMP assay method rather than the PCR method can distinguish the GM cry1A gene from the native cry1Ab/cry1Ac genes. Therefore, this LAMP method will be a potential effective tool for identification of the GM cry1A gene containing GM crops which are widely plant in China and other developing countries. Acknowledgment This research was supported by grants of Major Cultivation Projects of Genetically Modified New Varieties of Organism, PR China (2008ZX09004-004 and 2013ZX08012001), the National Natural Science Foundation of China (31071494 and 31371772) and the Hebei Provincial Foundation for Returned Scholars, China (No. 2010-195). References Allen, R. C., Rogelj, S., Cordova, S. E., & Kieft, T. L. (2006). An immuno-PCR method for detecting Bacillus thuringiensis Cry1Ac toxin. Journal of Immunological Methods, 308, 109e115. Anthony Johnson, A. M., Dasgupta, I., & Sai Gopal, D. V. R. (2014). Development of loop-mediated isothermal amplification and SYBR green real-time PCR methods for the detection of citrus yellow mosaic badnavirus in citrus species. Journal of Virological Methods, 203, 9e14. Asiello, P. J., & Baeumner, A. J. (2011). Miniaturized isothermal nucleic acid
364
P. Shen et al. / Food Control 62 (2016) 357e364
amplification, a review. Lab on a Chip, 11(8), 1420e1430. http://dx.doi.org/ 10.1039/c0lc00666a. Babekova, R., Funk, T., Pecoraro, S., Engel, K., & Busch, U. (2009). Development of an event-specific real-time PCR detection method for the transgenic Bt rice line KMD1. European Food Research and Technology, 228(3), 707e716. Biswas, G., & Sakai, M. (2014). Loop-mediated isothermal amplification (LAMP) assays for detection and identification of aquaculture pathogens: current state and perspectives. Applied Microbiology and Biotechnology, 98(7), 2881e2895. http://dx.doi.org/10.1007/s00253-014-5531-z. n, M. (2011). Bacillus thuringiensis: Bravo, A., Likitvivatanavong, S., Gill, S. S., & Sobero a story of a successful bioinsecticide. Insect Biochemistry and Insect Molecular Biology, 41(7), 423e431. http://dx.doi.org/10.1016/j.ibmb.2011.02.006. Cheng, H., Jin, W., Wu, H., Wang, F., You, C., Peng, Y., et al. (2007). Isolation and PCR detection of foreign DNA sequences in bee honey raised on genetically modified Bt (Cry1Ac) cotton. Food and Bioproducts Processing, 85, 141e145. Chen, X., Wang, X., Jin, N., Zhou, Y., Huang, S., & Miao, Q. (2012). End point visual detection of three genetically modified rice events by loop mediated isothermal amplification. International Journal of Molecular Sciences, 13, 14421e14433. Chhabra, R., Randhawa, G. J., Bhoge, R. K., & Singh, M. (2014). Qualitative and quantitative PCR-based detection methods for authorized genetically modified cotton events in India. Journal of AOAC International, 97, 1299e1309. Ding, J., Jia, J., Yang, L., Wen, H., Zhang, C., Liu, W., et al. (2004). Validation of a rice specific gene, sucrose phosphate synthase, used as the engodenous reference gene for qualitative and real-time quantitative PCR detction of transgenes. Journal of Agricultural and Food Chemistry, 52(11), 3372e3377. Dinon, A. Z., Prins, T. W., van Dijk, J. P., Arisi, A. C., Scholtens, I. M. J., & Kok, E. J. (2011). Development and validation of real-time PCR screening methods for detection of cry1A.105 and cry2Ab2 genes in genetically modified organisms. Analytical and Bioanalytical Chemistry, 400(5), 1433e1442. http://dx.doi.org/ 10.1007/s00216-011-4875-9. Ermolli, M., Prospero, A., Balla, B., Querci, M., Mazzeo, A., & Van Den Eede, G. (2006). Development of an innovative immunoassay for CP4EPSPS and Cry1Ab genetically modified protein detection and quantification. Food Additives and Contaminants, 23(9), 876e882. Fischhoff, D. A., Bowdish, K. S., Perlak, F. J., Marrone, P. G., McCormick, S. M., Niedermeyer, J. G., et al. (1987). Insect tolerant transgenic tomato plants. Nature Biotechnology, 5, 807e813. http://dx.doi.org/10.1038/nbt0887-807. Fischhoff, D. A., & Perlak F. J. (1995). Synthetic plant genes and method for preparation. US, US7741118B1, Application Number 08/434105, May 3, 1995; Patent date: June-22, 2010. Fukuta, S., Mizukami, Y., Ishida, A., Ueda, J., Hasegawa, M., Hayashi, I., et al. (2004). Real-time loop-mediated isothermal amplification for the CaMV-35S promoter as a screening method for genetically modified organisms. European Food Research and Technology, 218, 496e500. Guo, S., Ni, W., & Xu, Q. (November 5, 1996). Expressive Carrier With Coded Insectkilling Protein Fusion Gene, and Transfer Gene Plant. CN95119563. Application Number: 95119563; Publication Number: 1134981. (in Chinese). €fte, H., & Whiteley, H. R. (1989). Insecticidal crystal proteins of Bacillus thurHo ingiensis. Microbiological Review, 53, 242e255. James, C. (2008). Global status of commercialized biotech/GM crops: 2007, ISAAA brief 37e2007, International Service for the Acquisition of Agri-biotech Applications (ISAAA). James, C. (2011). Global status of commercialized biotech/GM crops. Ithaca, NY: ISAAA. No. 43: ISAAA http//www.isaaa.org/resources/publications/briefs/43/. Accession 01.05.12. Jouanin, L., Bottino, M. B., Girard, C., Morrot, G., & Giband, M. (1988). Transgenic plants for insect resistance. Plant Science, 131(1), 1e11. http://dx.doi.org/10.1016/ S0168-9452(97)00239-2. Kamle, S., Kumar, A., & Bhatnagar, R. (2011). Development of multiplex and construct specific PCR assay for detection of cry2Ab transgene in genetically modified crops and product. GM Crops & Food, 2, 74e81. Kamle, S., Ojha, A., & Kumar, A. (2011). Development of an enzyme linked immunosorbant assay for the detection of Cry2Ab protein in transgenic plants. GM Crops & Food, 2, 125e132. Kumar, S., Chandra, A., & Pandey, K. C. (2008). Bacillus thuringiensis (Bt) transgenic crop: an environment friendly insect-pest management strategy. Journal of
Environmental Biology, 29(5), 641e653. Li, Q., Fang, J., Liu, X., Xi, X., Li, M., Gong, Y., et al. (2013). Loop-mediated isothermal amplification (LAMP) method for rapid detection of cry1Ab gene in transgenic rice (Oryza sativa L.). European Food Research and Technology, 236, 589e598. Lin, Z., Zhang, Y., Zhang, H., Zhou, Y., Cao, J., & Zhou, J. (2012). Comparison of loopmediated isothermal amplification (LAMP) and real-time PCR method targeting a 529-bp repeat element for diagnosis of toxoplasmosis. Veterinary Parasitology, 185, 296e300. Liu, Y. J., & Wang, G. Y. (2003). The inheritance and expression of cry1A gene in transgenic maize. Acta Botanica Sinica, 3, 253e256. Nixon, G. J., Svenstrup, H. F., Donald, C. E., Carder, C., Stephenson, J. M., MorrisJones, S., et al. (2014). A novel approach for evaluating the performance of real time quantitative loop-mediated isothermal amplification-based methods. Biomolecular Detection and Quantification, 2, 4e10. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., et al. (2000). Loop-mediated isothermal amplification of DNA. Nucleic Acids Research, 28(12), 63e68. Pan, T. M., & Shih, T. W. (2003). Detection of genetically modified soybeans in miso by polymerase chain reaction and nested polymerase chain reaction. Journal of Food and Drug Analysis, 11(2), 154e158. Randhawa, G. J., Singh, M., Chhabra, R., & Sharma, R. (2010). Qualitative and quantitative molecular testing methodologies and traceability systems for commercialized Bt cotton events and other Bt crops under field trials in India. Food Analytical Methods, 3(4), 295e303. http://dx.doi.org/10.1007/s12161-0109126-8. Shan, G., Embrey, S. K., & Schaffer, B. W. (2007). A highly specific enzyme-linked immunosorbent assay for the detection of Cry1Ac insecticidal crystal protein in transgenic WideStrike cotton. Journal of Agricultural and Food Chemistry, 55, 5974e5979. Shu, C., Yan, G., Wang, R., Zhang, J., Feng, S., Huang, D., et al. (2009). Characterization of a novel cry8 gene specific to Melolonthidae pests: Holotrichia oblita and Holotrichia parallela. Applied Microbiology Biotechnology, 84, 701e707. Siljo, A., & Bhat, A. I. (2014). Reverse transcription loop-mediated isothermal amplification assay for rapid and sensitive detection of banana bract mosaic virus in cardamom (Elettaria cardamomum). European Journal of Plant Pathology, 138, 209e214. Tiwari, K. L., Jadhav, S. K., & Gupta, S. (2012). Modified CTAB technique for isolation of DNA from some medicinal plants. Journal of Medicinal Plants Research, 6, 65e73. Wang, X., Teng, D., Guan, Q., Tian, F., & Wang, J. (2013). Detection of roundup ready soybean by loop-mediated isothermal amplification combined with a lateralflow dipstick. Food Control, 29, 213e220. Yang, L., Chen, J., Huang, C., Liu, Y., Jia, S., Pan, L., et al. (2005). Validation of a cottonspecific gene Sad1, used as an endogenous reference gene in qualitative and real-time quantitative PCR detection of transgenic cottons. Plant Cell Reports, 24(4), 237e245. Zhang, D., & Guo, J. (2011). The development and standardization of testing methods for GMO and their derived products. Journal of Integrative Plant Biology, 3, 539e551. Zhang, B., Guo, W., & Zhang, T. (2013). Inheritance of transgenes in transgenic Bt lines resistance to Helicoerpa armigera in upland cotton. In , 958. Transgenic cotton: Methods and protocols, methods in molecular biology (pp. 165e176). New York: Springer ScienceþBisiness Media. http://dx.doi.org/10.1007/978-162703-212-4_14. Zhang, S., Tan, B., Li, P., Wang, F., Guo, Li, Yang, Y., et al. (2014). Comparison of conventional RT-PCR, reverse-transcription loop-mediated isothermal amplification, and SYBR green I-based real-time RT-PCR in the rapid detection of bovine viral diarrhea virus nucleotide in contaminated commercial bovine sera batches. Journal of Virological Methods, 207, 204e209. Zhou, D., Guo, J., Xu, L., Gao, S., Lin, Q., Wu, Q., et al. (2014). Establishment and application of a loop-mediated isothermal amplification (LAMP) system for detection of cry1Ac transgenic sugarcane. Scientific Reports, 4, 4912. http:// dx.doi.org/10.1038/srep04912. Zhu, X., Chen, L., Shen, P., Jia, J., Zhang, D., & Yang, L. (2011). High sensitive detection of Cry1Ab protein using a quanti-dot based fluorescence-linked immunosorbant assay. Journal of Agricultural and Food Chemistry, 23, 2184e2189.