A rapid, simple, and sensitive loop-mediated isothermal amplification method to detect toxigenic Vibrio cholerae in rectal swab samples

Available online at www.sciencedirect.com

Diagnostic Microbiology and Infectious Disease 66 (2010) 135 – 139 www.elsevier.com/locate/diagmicrobio

A rapid, simple, and sensitive loop-mediated isothermal amplification method to detect toxigenic Vibrio cholerae in rectal swab samples Kazuhisa Okadaa,⁎, Siriporn Chantarojb , Tooru Taniguchia , Yasuhiko Suzukic , Amonrattana Roobthaisonga , Orapim Puiproma , Takeshi Hondaa , Pathom Sawanpanyalertb a

Section of Bacterial Infections, Thailand–Japan Research Collaboration Center on Emerging and Reemerging Infections (RCC-ERI), DMSc, Ministry of Public Health, Nonthaburi 11000, Thailand b National Institute of Health, DMSc, Tiwanond Road, Nonthaburi 11000, Thailand c Department of Global Epidemiology, Hokkaido University Research Center for Zoonosis Control, N20, W10, Kita-ku, Sapporo, Hokkaido 001-0020, Japan Received 17 April 2009; accepted 2 September 2009

Abstract Loop-mediated isothermal amplification (LAMP) method was designed for clinical diagnosis of Vibrio cholerae carrying the ctxA gene. The detection limits of the method were 5 fg of purified genomic DNA/reaction and 0.54 CFU/reaction. The method was applied to rectal swab samples from cholera patients and healthy volunteers (19 subjects each) and yielded the same results as the “gold standard” culture method, while the polymerase chain reaction-based method failed to detect V. cholerae in 8 of the positive samples. Direct application of this LAMP method without precultivation enabled the rapid detection of 5 asymptomatic carriers from rectal swabs of 21 household contacts of cholera patients. This LAMP method could be a sensitive, specific, inexpensive, and rapid detection tool for V. cholerae carrying the ctxA gene in the clinical laboratory and in the field. © 2010 Elsevier Inc. All rights reserved. Keywords: Vibrio cholerae; LAMP; ctxA; PCR; Cholera

1. Introduction Toxigenic Vibrio cholerae strains belonging to the O1 and O139 serogroups cause cholera, an acute, diarrheal illness induced by cholera toxin (CT), in humans. The infection can be severe, causing profuse watery diarrhea and vomiting, potentially resulting in dehydration and death. Cholera is a highly communicable disease and has been categorized as an emerging and reemerging infection that threatens many developing countries (Satcher, 1995). Cases involving severe diarrhea are identified more readily than those that are mild or asymptomatic, but such cases should also be diagnosed quickly, because they can contribute to the dissemination of cholera infection (Kaper et al., 1995). CT, encoded by the ctxAB genes, is the major virulence factor of V. cholerae. Toxigenic V. cholerae harbors lysogens ⁎ Corresponding author. DMSc, Thailand-Japan RCC-ERI, Ministry of Public Health, Nonthaburi 11000, Thailand. Tel.: +66-2-965-9748; fax: +66-2-965-9749. E-mail address: [email protected] (K. Okada). 0732-8893/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.diagmicrobio.2009.09.004

of a filamentous bacteriophage designated CTXΦ, which carry the ctxAB genes, and the propagation of CTXΦ may be associated with the origin of novel strains of toxigenic V. cholerae from nontoxigenic progenitors (Faruque et al., 1998). The current “gold standard” for identifying toxigenic V. cholerae O1 or O139 from clinical samples is the culture method, but it is laborious and time consuming. It takes several days to confirm and complete the identification of suspicious colonies by biochemical and serologic tests. The development of a rapid, sensitive, and cost-effective method is required, not only for the quick and appropriate treatment of cholera patients, but also for the prompt control of cholera outbreaks and prevention of the disease. Loop-mediated isothermal amplification (LAMP) is a novel nucleic acid amplification technique that relies on autocycling strand-displacement DNA synthesis performed by the Bst DNA polymerase large fragment (Tomita et al., 2008). In contrast to polymerase chain reaction (PCR), LAMP occurs continuously under isothermal conditions (60– 64 °C) for about 60 min, which, in a positive sample, eventually produces a visible, white precipitate composed of

136

K. Okada et al. / Diagnostic Microbiology and Infectious Disease 66 (2010) 135–139

magnesium pyrophosphate. The presence or absence of the white precipitate allows the easy assessment of samples with the naked eye (Mori et al., 2001; Tomita et al., 2008). The LAMP method amplifies DNA with high efficiency and without significant influence from coexisting nontargeted or contaminating DNA. The detection limit is a few copies of DNA, comparable to that of PCR (Hara-Kudo et al., 2005; Notomi et al., 2000). Recently, Yamazaki et al. (2008) reported a LAMP method for detecting V. cholerae. These authors demonstrated the specificity of their method using bacterial cultures; however, they did not examine its sensitivity or its specificity using clinical specimens obtained from cholera patients. We report here another LAMP method for the sensitive and specific detection of toxigenic V. cholerae. Moreover, we performed a field study using our method that demonstrated that it reliably identified V. cholerae in clinical samples obtained during cholera outbreaks in Thailand. 2. Materials and methods 2.1. Bacterial strains A total of 66 bacterial strains (Table 1) provided by the Section of Culture Collection, Department of Medical Sciences, Ministry of Public Health, Thailand, were used for specificity testing. The classic strain V. cholerae Ogawa (ATCC 14035) was used in the LAMP sensitivity tests. All strains were grown aerobically on Luria–Bertani (LB) agar overnight at 37 °C or in LB broth overnight at 37 °C using a shaker incubator set at 200 rpm. 2.2. DNA extraction from cultured bacteria 2.2.1. DNA extraction by cetyltrimethylammonium bromide method Bacterial pellets were lysed, and proteins were removed by digestion with proteinase K. The cell wall debris, polysaccharides, and remaining proteins were removed by selective precipitation with cetyltrimethylammonium bromide, and the genomic DNA was recovered from the resulting supernatant by isopropanol precipitation (Wilson, 1997). The genomic DNA was serially diluted for sensitivity test. 2.3. DNA extraction by heating method Cultured bacterial suspensions (1 mL each) were heated at 95 °C for 10 min and centrifuged at 17 000 × g for 10 min. The supernatant was used as DNA template. This method was used to prepare samples for the sensitivity and specificity tests using serially diluted bacterial suspensions. 2.4. Specimens and preparation of DNA templates for LAMP and PCR Rectal swabs were obtained from cholera patients (19 specimens) and from family members that had household contact with cholera patients (21 specimens) in Thailand in

Table 1 Specificity of LAMP and PCR methods using 66 bacterial strains Strain Vibrio cholerae O1 Classical, Ogawa O1 El Tor, Inaba O1 El Tor, Ogawa O139 Non-O1/non-O139 Vibrio furnissii Vibrio fluvialis Vibrio alginolyticus Vibrio mimicus Vibrio parahaemolyticus Vibrio vulnificus Enterotoxigenic Escherichia coli Escherichia coli Aeromonas hydrophila Aeromonas caviae Aeromonas sobria Aeromonas urinae Plesiomonas shigelloides Providencia alcalifaciens Providencia stuartii Providencia rettgeri Listeria monocytogenes Listeria grayi Listeria ivanovii Listeria innocua Listeria murrayi a b c

No. tested

No. positivea

1 9 8 6 5 2 2 2 2 2 4 1

1 9 7b 4c 0 0 0 0 0 0 0 0

3 2 2 2 2 2 1 1 2 1 1 1 1 1

0 0 0 0 0 0 0 0 0 0 0 0 0 0

All results were identical by LAMP and PCR methods. One strain of El Tor Ogawa was found to be ctxA negative by PCR. Two strains of O139 were found to be ctxA negative by PCR.

2007 and 2008, when cholera outbreaks occurred. For comparison, 19 rectal swabs were also obtained from 19 healthy Thai volunteers. Each rectal swab was placed in a separate tube containing 2 mL of alkaline peptone water (APW) and incubated overnight at 37 °C. Aliquots (200 μL) of each sample were then heated at 95 °C for 10 min and centrifuged at 17 000 × g for 10 min. Each supernatant was used as a DNA template for LAMP and PCR. In addition, 1 loopful of swab culture in APW was streaked onto thiosulfate citrate bile salts sucrose (TCBS) agar (Eiken Chemical, Japan), incubated overnight at 37 °C, and then subjected to the “gold standard” method for detecting V. cholerae in clinical specimens (World Health Organization, 1993). Yellow, flat, shiny colonies that were 2 to 3 mm in diameter on TCBS agar plates were characterized biochemically and tested for slide agglutination with V. choleraespecific antisera (Denka Seiken, Japan). 2.5. Loop-mediated isothermal amplification A multiple alignment of sequences from the DDBJ, EMBL, and GenBank databases was performed to find nucleotide sequences specific for ctxA (X58785-1, AE004224-1, AF390572-1, X00171-1, AF463401-1, AF463400-1, AF452584-1, X58786-1). Specific LAMP

K. Okada et al. / Diagnostic Microbiology and Infectious Disease 66 (2010) 135–139 Table 2 Nucleotide sequences of LAMP primers used in this study Primer

Sequence (5′–3′)

F3 B3 FIP

TCGGGCAGATTCTAGACC (F3) GTGGGCACTTCTCAAACT (B3c) TTGAGTACCTCGGTCAAAGTACTTCCTGATGAAATAAAGCAGTCA (F1c-F2) TCAACCTTTATGATCATGCAAGAGGGGAAACATATCCATCATCGTG (B1-B2c) CCTCTTGGCATAAGACCACC AACTCAGACGGGATTTGTTAGG

BIP LF LB

primers for the detection of ctxA were designed using the PrimerExplorer V3 software, available online at http:// primerexplorer.jp/lamp3.0.0/index.html. The primer sequences used in this study are listed in Table 2. The LAMP reactions were carried out in a final volume of 25 μL containing 40 pmol of each primer FIP, BIP, LF, and LB and 5 pmol of each primer F3 and B3, 20 mmol/L Tris– HCl (pH 8.8), 10 mmol/L KCl, 8 mmol/L MgSO4, 10 mmol/ L [NH4]2SO4, 0.1% Triton X-100, 0.8 mol/L betaine, 1.4 mmol/L each deoxynucleotide triphosphate [dNTP], 1 μL of Bst DNA polymerase (New England Biolabs, Beverly, MA), and 2 μL of the DNA template of each sample. LAMP was carried out at 64 °C for 60 min, and the samples were then cooled to 4 °C. Positive and negative results were distinguished by observing the white turbidity of the reaction mixture. In some cases, the LAMP products were characterized by electrophoresis to verify a positive result (Tomita et al., 2008). The LAMP product forms a ladder-like pattern upon electrophoresis in a 2% agarose gel. The gels were stained with ethidium bromide and observed under an ultraviolet (UV) transilluminator. 2.6. Polymerase chain reaction The amplification of a 380-bp fragment of the CT gene was performed using a pair of primers specific for the ctxA gene. The sequence of the forward primer was 5′TCAAACTATATTGTCTGGTC-3′ and that of the reverse

137

primer was 5′-CGCAAGTATTACTCATCGA-3′ (Kobayashi et al., 1990). PCR was performed in a 25-μL reaction mixture containing 2 μL of the DNA template, 1 × EX Taq buffer, 0.2 mmol/L of each dNTP, 0.4 μmol/L of each PCR primer, and 0.75 U of TaKaRa EX Taq (Takara Bio, Japan). The following reaction conditions were used: 35 cycles at 94 °C for 45 sec, 55 °C for 2 min, and 72 °C for 1 min, followed by a final extension at 72 °C for 5 min. The PCR products (25 μL each) were analyzed by 2% agarose gel electrophoresis, stained with ethidium bromide, and observed under a UV transilluminator. 3. Results 3.1. Specificity and sensitivity of LAMP method using bacterial strains The specificity of LAMP method versus PCR was determined using 24 strains of O1 and O139 V. cholerae, 5 strains of non-O1/non-O139 V. cholerae, and 37 strains of 21 bacterial species other than V. cholerae (Table 1). The heatextracted DNA samples of all the ctxA-positive O1 and O139 V. cholerae strains were positive by both the LAMP and PCR methods. Three O1 and O139 V. cholerae strains lacking the ctxA gene, non-O1/non-O139 V. cholerae, and the other bacterial species were negative by both methods. Enterotoxigenic Escherichia coli containing the heat-labile enterotoxin gene (elt) was also negative. Thus, our newly developed LAMP method was highly specific for toxigenic V. cholerae. The sensitivity of LAMP method was determined using purified genomic DNA from V. cholerae to be 5 fg (Table 3), which is nearly equal to 1 copy of the genomic DNA of V. cholerae (Heidelberg et al., 2000). The positive samples were readily identifiable in the LAMP reaction by the easily seen white magnesium pyrophosphate precipitate (Fig. 1A). To confirm the positivity of these samples, we also subjected LAMP products to electrophoresis through a 2% agarose gel.

Table 3 Sensitivity tests of LAMP and PCR methods (A) Sensitivity test using purified genomic DNA of V. cholerae DNA/reaction 500 pg LAMP PCR

+ +

a

50 pg

5 pg

500 fg

50 fg

5 fg

0.5 fg

+ +

+ +

+ +

+ +

+ −

− −

(B) Sensitivity test using cultured V. cholerae CFU/reaction

LAMP PCR

5.4 × 104

5.4 × 103

5.4 × 102

5.4 × 101

5.4 × 100

5.4 × 10−1

5.4 × 10−2

+ +

+ +

+ +

+ +

+ −

± (2/3) −

− −

a + = triplicated assay showed all positive; ± = triplicated assay showed both positive and negative (positive number/test number); − = triplicated assay showed all negative.

138

K. Okada et al. / Diagnostic Microbiology and Infectious Disease 66 (2010) 135–139

3.3. Rapid diagnosis of V. cholerae carriers by LAMP method To use LAMP method for the rapid and reliable detection of V. cholerae in clinical laboratories or in the field, we tested whether we could eliminate the incubation in APW to save time. A total of 21 rectal swab samples from healthy family member(s) who had contact with cholera patients during the 2008 outbreak of cholera were examined by the LAMP method. Of these, 5 samples (24%) gave a positive reaction by both the cultivation and the LAMP methods, although the incubation step was skipped. These results indicate that our newly developed LAMP method provides a rapid and sensitive diagnostic tool for detecting toxigenic V. cholerae in rectal swab samples.

4. Discussion

Fig. 1. The sensitivity of LAMP method was determined using 0.5 fg to 500 pg of purified genomic DNA from V. cholerae. Positive LAMP reactions were detected by visually observing the turbidity from white precipitate (A) or a ladder-like pattern on a 2% agarose gel (B). Marks: + = positive result; − = negative result.

The positive LAMP reactions were verified by the appearance of a ladder-like pattern (Fig. 1B) (Tomita et al., 2008). LAMP carried out on cultured V. cholerae showed a positive reaction at 0.54 CFU/reaction, whereas 54 CFU/ reaction was needed for detection by PCR (Table 3B). Similar sensitivity results were obtained in the samples inoculated with feces, which would be a contaminant of clinical rectal swab samples (data not shown). Thus, our LAMP method was 10- to 100-fold more sensitive than the PCR method (Table 3A and B). 3.2. LAMP method using rectal swab samples from cholera patients During the 2007 outbreak of cholera in northeastern Thailand, rectal swabs from cholera patients and healthy volunteers (19 subjects each) were collected. We inoculated 2 mL of APW with these samples, incubated overnight at 37 °C, and then examined the individual by gold standard method, PCR and LAMP. V. cholerae O1 serogroup was isolated from all 19 cholera rectal swab samples. LAMP reaction successfully detected V. cholerae (all 19 heated specimens were positive), whereas only 11 of the same heated specimens (58%) were positive by the PCR method (Table 4).

Here we report the sensitivity and specificity of a newly developed LAMP method for detecting toxigenic V. cholerae, which can be used not only in the microbiology laboratory but also in hospitals or even in the field. Our LAMP method was 10 times more sensitive than the PCR method, whether we used extracted DNA (Table 3A) or bacteria (Table 3B) as the template. The LAMP method detected as little as 5 fg DNA (Table 3A), about the same as 1 copy of the genomic DNA of V. cholerae (Heidelberg et al., 2000) or 1 bacterium per reaction mixture (Table 3B). LAMP method takes about 90 min (30 min for heat extraction of DNA and 60 min for LAMP reaction at 64 °C) from obtaining the rectal swab specimen to determining the result, which is done by visual inspection of the sample. In contrast, conventional PCR requires sophisticated equipment, including a thermal cycler and electrophoresis apparatuses. It takes at least 4 h (30 min for heat extraction of DNA, 150 min for the PCR reaction, and 60 min for agarose gel electrophoresis and ethidium bromide staining). When applied to clinical specimens, the PCR method was less accurate and less sensitive than the LAMP method (Table 4). This difference may be owing to the presence of inhibitors in clinical specimens, such as stool, urine, or blood, which may interfere with PCR reaction (AI-Soud et al., 2001; Khan et al., 1991; Miyagi et al., 1999). LAMP Table 4 Comparison of the results of 3 different detection methods from rectal swab samples Detection method

Culture LAMP PCR

Cholera patients

Healthy volunteers

(n = 19)

(n = 19)

+

−

+

−

19 19 11

0 0 8

0 0 0

19 19 19

+ = positive result; − = negative result.

K. Okada et al. / Diagnostic Microbiology and Infectious Disease 66 (2010) 135–139

method is much less affected by such inhibitors (Kaneko et al., 2007). In this regard, Karanis et al. (2007) reported that their LAMP method was not affected by inhibitors in water samples, although their PCR results were affected. Thus, LAMP methods are superior to PCR when applied to clinical and environmental specimens. In fact, by applying our LAMP assay to clinical specimens, we found that 24% of the family member(s) of cholera patients were V. cholerae carriers. The quick detection of carriers will be helpful in preventing the spread of cholera. In conclusion, we developed a new LAMP method for detecting toxigenic V. cholerae that was rapid, highly sensitive, simple, and inexpensive. It was faster than PCR and more accurate for testing clinical specimens. The LAMP method enables the rapid diagnosis of infectious diseases and is applicable for on-site testing or as a diagnostic tool in the field. Our LAMP method can detect toxigenic V. cholerae from patients and carriers and may be useful for testing environmental samples. It should contribute to the development of rapid and appropriate strategies for controlling or preventing cholera outbreaks. Acknowledgments This work was supported by the Program of Founding Research Center for Emerging and Reemerging Infectious Diseases launched by a project commissioned by the Ministry of Education, Culture, Sports, Science, and Technology (MEXT) of Japan and in part by the Department of Medical Sciences, the Ministry of Public Health, Thailand. The authors would like to thank Shigeyuki Hamada and Yoshitake Nishimune for their critical reading of this manuscript. References AI-Soud WA, Radstrom P (2001) Purification and characterization of PCR-inhibitory components in blood cells. J Clin Microbiol 39:485–493. Faruque SM, Asadulghani AR, Albert MJ, Islam KM, Mekalanos JJ (1998) Induction of the lysogenic phage encoding cholera toxin in naturally occurring strains of toxigenic Vibrio cholerae O1 and O139. Infect Immun 66:3752–3757. Hara-Kudo Y, Yoshino M, Kojima T, Ikedo M (2005) Loop-mediated isothermal amplification for the rapid detection of Salmonella. FEMS Microbiol Lett 253:155–161.

139

Heidelberg JF, Eisen JA, Nelson WC, Clayton RA, Gwinn ML, Dodson RJ, Haft DH, Hickey EK, Peterson JD, Umayam L, Gill SR, Nelson KE, Read TD, Tettelin H, Richardson D, Ermolaeva MD, Vamathevan J, Bass S, Qin H, Dragoi I, Sellers P, McDonald L, Utterback T, Fleishmann RD, Nierman WC, White O, Salzberg SL, Smith HO, Colwell RR, Mekalanos JJ, Venter JC, Fraser CM (2000) DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature 406:477–483. Kaneko H, Kawana T, Fukushima E, Suzutani T (2007) Tolerance of loopmediated isothermal amplification to a culture medium and biological substances. J Biochem Biophys Methods 70:499–501. Kaper JB, Morris JG, Levine MM (1995) Cholera. Clin Microbiol Rev 8:48–86. Karanis P, Thekisoe O, Kiouptsi K, Ongerth J, Igarashi I, Inoue N (2007) Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples. J Clin Microbiol 73:5660–5662. Khan G, Kangro HO, Coates PJ, Heath RB (1991) Inhibitory effects of urine on the polymerase chain reaction for cytomegalovirus DNA. J Clin Pathol 44:360–365. Kobayashi K, Seto K, Akasaka S, Makino M (1990) Detection of toxigenic Vibrio cholerae O1 using polymerase chain reaction for amplifying the cholera enterotoxin gene. Kansenshogaku Zasshi 64: 1323–1329. Miyagi K, Sano K, Morita C, Imura S, Morimatsu S, Goto T, Nakano Y, Omura K, Matsumoto Y, Maeda K, Hashimoto S, Honda T (1999) An improved method for detecting faecal Vibrio cholerae by PCR of the toxin A gene. J Med Microbiol 48:883–889. Mori Y, Nagamine K, Tomita N, Notomi T (2001) Detection of loopmediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem Biophys Res Commun 289:150–154. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T (2000) Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 28:E63. Satcher D (1995) Emerging infection: getting ahead of the cure. Emerg Infect Dis 1:1–6. Tomita N, Mori Y, Kodama H, Notomi T (2008) Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat Protoc 3:877–882. Wilson K (1997) Preparation of genomic DNA from bacteria. In: Current protocols in molecular biology. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K, Eds. New York: Wiley, pp. 2.4.1–2.4.5. World Health Organization (1993) Isolation of Vibrio cholerae O1 in a peripheral laboratory. Guidelines for cholera control. Geneva: World Health Organization, pp. 54–61. Yamazaki W, Seto K, Taguchi M, Ishibashi M, Inoue K (2008) Sensitive and rapid detection of cholera toxin-producing Vibrio cholerae using a loop-mediated isothermal amplification. BMC Microbiol 8:94–100.