- Email: [email protected]
A rat model of changes in dural mast cells and brain histamine receptor H3 expression following traumatic brain injury
Journal of Clinical Neuroscience 19 (2012) 447–451
Contents lists available at SciVerse ScienceDirect
Journal of Clinical Neuroscience journal homepage: www.elsevier.com/locate/jocn
Laboratory Study
A rat model of changes in dural mast cells and brain histamine receptor H3 expression following traumatic brain injury Ryo Shimada ⇑, Ken-ichiro Nakao, Rui Furutani, Kazuhiko Kibayashi Department of Legal Medicine, School of Medicine, Tokyo Women’s Medical University, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666, Japan
a r t i c l e
i n f o
Article history: Received 16 March 2011 Accepted 26 June 2011
Keywords: Dura Head trauma Histamine receptor Mast cell
a b s t r a c t Mast cells can secrete histamine in response to extrinsic stimuli. Histamine plays a role in the development of brain edema and can induce histamine receptor H3 (HRH3) expression in the brain to provide protective feedback effects against histamine neurotoxicity. We investigated time-dependent changes in dural mast cell numbers and HRH3 expression in the brain for one to 14 days after traumatic brain injury in a controlled cortical impact model in the rat. The number of tryptase-immunoreactive dural mast cells at the site of impact was significantly decreased one and four days after the injury. Furthermore, immunoreactivity and messenger RNA (mRNA) expression of HRH3 at the underlying cortical contusion site were significantly increased one and four days after the injury. These data suggest that histamine released from degranulated unstainable mast cells induces a transient increase in presynaptic autoinhibitory HRH3 immunoreactivity and mRNA expression as a mechanism to counteract histamine neurotoxicity. Ó 2011 Elsevier Ltd. All rights reserved.
1. Introduction Traumatic brain injury (TBI) results in progressive cortical degeneration following blunt force trauma to the head. Post-traumatic brain edema, leading to an expansion of brain volume, is one of the causes of TBI progression, as it increases intracranial pressure, impairs cerebral perfusion and oxygenation, and contributes to additional ischemic injuries.1,2 Histamine is known to play a role in the development of brain edema.3 Previous studies have shown that histamine increases vascular permeability and water content in the brain.4 Mast cells secrete stored histamine in response to extrinsic stimuli.5,6 In TBI, a cranial blunt force impact is transmitted through the dura to the brain. Because the dura contains mast cells, it has been hypothesized that a head injury activates dural mast cells, causing them to release histamine and exacerbate the brain injury.6 Three types of histamine receptor have been identified in the brain: histamine receptor H1 (HRH1), HRH2 and HRH3.5 HRH3 is widely distributed throughout the brain and is expressed in the presynaptic terminals of histaminergic neurons.7 HRH3 is an autoreceptor that inhibits histamine release and exerts a protective effect against histamine neurotoxicity. Thus, increased release of histamine leads to HRH3 activation and HRH3-mediated inhibition of histamine release and synthesis.8 Analysis of HRH3 expression
⇑ Corresponding author. Tel./fax: +81 3 5269 7300. E-mail address: [email protected] (R. Shimada). 0967-5868/$ - see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.jocn.2011.06.033
in the brain following blunt force impact is valuable to ascertain the effect of mast cell activation on the progression of TBI. A previous study demonstrated that the activation of dural mast cells in rats and mice continued for five to 20 min after head injury.6 Because TBI deteriorates progressively later than the acute phase of head injury,1,2 we examined the time-dependent changes in dural mast cells and HRH3 expression in the brain one to 14 days after injury in a controlled cortical impact (CCI) model of TBI in rats. 2. Materials and methods 2.1. Animals and surgery The Ethical Review Committee of Animal Experiments at Tokyo Women’s Medical University approved the procedures using animals. Male Wistar rats weighing 200300 g were randomly allocated to either the injury group or sham group. Rats were anesthetized with an intraperitoneal (i.p.) injection of pentobarbital (40 mg/kg), placed in a stereotaxic frame, and had their scalps shaved and incised. A dental drill-trephine was used to perform a craniotomy of 6 mm diameter over the left parietal cortex, 7 mm posterior to the coronal suture and 7 mm lateral to the sagittal suture, taking care not to injure the dura. A CCI device (AmScien Instruments, Richmond, VA, USA) was used to induce TBI in rats in the injury group according to a previously described method.9 A pneumatic piston with a 3 mm diameter rounded metal tip was aligned at 15° vertical over the center of the craniotomy so
448
R. Shimada et al. / Journal of Clinical Neuroscience 19 (2012) 447–451
that the tip was perpendicular with the dural surface at impact. The CCI device was set at 20 psi for low pressure (for holding the pistol rod at its highest position) and 100 psi for high pressure (for rapidly moving the cylinder rod to its lowest position), resulting in a velocity of 3.54 m/s, and a deformation depth of 1 mm below the dura. Because the relationship between dural mast cell changes and brain histamine HRH3 expression was the subject of this study, we used a mild TBI model to minimize secondary brain injury. Immediately after TBI, the bone flap was adhered to a plastic plate (8 mm in diameter, 0.2 mm thick) and restored to seal the craniotomy, and the scalp was sutured closed. Rats were placed in a heat-controlled cage to maintain body temperature while recovering from anesthesia. Rats in the sham group received a craniotomy but no CCI treatment. All neurological, histological and real-time polymerase chain reaction (PCR) studies were performed blind. 2.2. Neurological evaluation Neurological deficits due to CCI were assessed before and 1, 7, 14, and 21 days after surgery by a blinded observer using a 21point sensorimotor scoring system.10 2.3. Sample preparation For histology and immunohistochemistry studies, rats were perfused transcardially with 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS, pH 7.4) under general anesthesia (100 mg/kg pentobarbital i.p.) 1, 4, 7, and 14 days after surgery (injury group, n = 8 per time point; sham group, n = 3 per time point). After the injury site of the dura was marked with Mark-It tissue marking green dye (Richard-Allan Scientific, Kalamazoo, MI, USA), the brain and the dura were removed and post-fixed in 4% PFA/PBS for three hours at 4 °C, and then in 4% PFA/PBS containing 0.1% Tween (4% PFA/PBT) overnight with continuous agitation at 4 °C. The brain and the dura were cut into coronal blocks (3 mm thickness), processed for paraffin embedding, sectioned (7 lm thickness), and mounted on siliconized slides. For total RNA and protein extraction studies, rats were perfused transcardially with PBS under general anesthesia (100 mg/kg pentobarbital i.p.) 1, 4, 7 and 14 days after surgery (injury group, n = 6 per time point; sham group, n = 3 per time point). The brain and the dura were removed, cut into coronal blocks (3 mm thickness) and immersed in RNALater (Ambion, Tokyo, Japan) at 4 °C overnight, and then stored at 80 °C until required.
histochemistry were photographed by light microscopy. Brain images were scanned and a 0.85 mm 0.65 mm (length width) section below the brain injury area was digitized for analysis by ImageJ software (National Institutes of Health, Bethesda, MD, USA). To adjust for sample variation, the density of the ipsilateral (injured) side was divided by that of contralateral (uninjured) side of the same section.
2.5. Real-time PCR A 30 mg sample was taken from the brain tissue cut from an area surrounding the cortical contusion of the brain in the injury group and from a comparable area of the brain in the sham group. Total RNA was extracted from the samples using the RNeasy fibrous tissue mini kit (Qiagen, Tokyo, Japan) according to the manufacturer’s protocol. The purity of total RNA was determined using an ultraviolet spectrophotometer at wavelengths of 260 nm and 280 nm, and by the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Tokyo, Japan). RNA quality was verified on a 3-(N-morpholino)propanesulfonic acid-formaldehyde-agarose gel. Complementary DNA (cDNA) for real-time PCR was produced using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Tokyo, Japan) according to the manufacturer’s protocol. Real-time PCR was performed on a 7500 Real-Time PCR System (Applied Biosystems) with the Power SYBR Green PCR Master Mix (Applied Biosystems). Sequences for the primers were constructed using Primer Express (Applied Biosystems) as follows: HRH3 (HRH3, NM_053506), forward primer: TACTGTGTGCCTCCTCGGTCTT, reverse primer: AGCTCGAGTGACTGACAGGAATC; and b2 microglobulin housekeeping gene (B2M, NM_012512), forward primer: ACCCACCGAGACCGATGTATAT, reverse primer: GGTTTTGGGCTCCTTCAGAGT. The cycling parameters were: thermal activation for 10 min at 95 °C and 40 cycles of PCR (denaturing for 15 secs at 95 °C, annealing and extension for 1 min at 60 °C). HRH3 messenger RNA (mRNA) expression was normalized to that of b2 microglobulin.
2.6. Statistical analysis All values were reported as the mean ± standard deviation. Two-way analysis of variance was used to assess differences between the injury group and the sham group over the different time periods and, if significant, was followed by the Bonferroni post-hoc test. Differences were considered significant at the p < 0.05 level.
2.4. Histological staining and analysis Coronal sections were stained with hematoxylin and eosin (H&E). Two primary antibodies were used: a monoclonal antibody to mast cell tryptase (clone AA1) (IMG-80250; Imgenex, San Diego, CA, USA; 1:1000)11 and a polyclonal antibody to affinity-purified HRH3 (SP4355P; Acris antibodies GmbH, Herford, Germany; 1:1500).12 Sections of the dura and brain were incubated in primary antibodies overnight at 4 °C, and then incubated at room temperature for 30 min each with the appropriate biotinylated secondary antibodies and avidin–biotin complex (DakoCytomation LSAB2 system-HRP, Dako, Carpinteria, CA, USA), followed by enzymatic development with 3,30 -diaminobenzidine.13 Tryptase-immunoreactive mast cells, in five sections of dura spaced 50 lm apart within the area of impact, and in a comparable area of contralateral dura, were counted using light microscopy at 100 magnification. Counts were expressed as the average number of mast cells in five sections. To account for inter-sample variation, ipsilateral mast cell counts were divided by contralateral counts from the same section. Brain sections stained with HRH3 immuno-
3. Results 3.1. Neurological abnormalities Neurological evaluations conducted using a 21-point sensorimotor scoring system did not identify neurological deficits in any of the animals during the study period.
3.2. Histological findings in H&E stained sections In sections from the injury group, the dura showed no distinct traumatic changes at the impact site; neither hemorrhage nor inflammatory cells were observed in the connective tissue of the dura. The brain exhibited dark and shrunken neurons which are an indication of cortical contusion in an area restricted to the region under the impact site of the dura on the ipsilateral cerebral cortex during the study period. In sections from the sham group, the dura and the brain showed no changes during the study period.
R. Shimada et al. / Journal of Clinical Neuroscience 19 (2012) 447–451
449
3.3. Mast cell counts The number of tryptase-immunoreactive mast cells in the dura significantly decreased in the injury group compared to the sham group 1and 4 days after injury (p < 0.05). At 7 and 14 days after injury, the number of dural mast cells in the injury group recovered to the level of those in the sham group (Table 1, Fig. 1). The number of dural mast cells 1 day after injury was lower than that at 4 to 14 days in the sham group, although not significantly. Mast cells were not identified in the brain sections. 3.4. HRH3 immunohistochemistry In brain sections of the injury group, immunopositive HRH3 staining was observed in neuronal cell bodies within the cerebral cortex. Analysis of staining intensities showed HRH3 immunostaining 1 and 4 days after injury was significantly increased in brain sections from the injury group relative to those from the sham group (p < 0.05). Immunostaining intensity 7 and 14 days after injury was decreased but was still higher in the injury group than in the sham group, although not significantly (Fig. 2). 3.5. HRH3 mRNA expression HRH3 mRNA expression one and four days after injury was significantly increased in brains from the injury group compared with those from the sham group (p < 0.05). At 7 and 14 days after injury, HRH3 mRNA expression in the injury group returned to the level of the sham group (Fig. 3). 4. Discussion This study examined time-dependent changes, one to 14 days after TBI, in dural mast cell levels and cerebral HRH3 expression in the rat CCI model, using histological and biochemical methods. The numbers of stainable mast cells in the dura decreased at 1 and 4 days after injury and recovered to pre-injury levels 7 and 14 days after injury. The expression of HRH3 in the brain increased 1 and 4 days after injury and returned to pre-injury levels seven and 14 days after injury. These findings indicate that changes in dural mast cells correlate with the expression of cerebral HRH3. As both mast cell numbers and HRH3 levels are associated with histamine neurotoxicity, identifying time-dependent alterations in mast cell populations and HRH3 levels may further the understanding of TBI pathophysiology. Activation of dural mast cells has been observed in an experimental grazing head injury model using rats and mice.6 Activated mast cells release cytoplasmic granules to the surrounding tissues.6 As tryptase is one of the main components of the Table 1 The number of tryptase-immunoreactive mast cells in the dura of rats with traumatic brain injury
Sham Day Day Day Day Injury Day Day Day Day
Ipsilateral
Contralateral
1 4 7 14
3.33 ± 0.58 6.67 ± 1.15 5.67 ± 0.58 4.33 ± 0.58
5.33 ± 0.58 8.67 ± 1.15 7.67 ± 1.53 5.67 ± 1.53
1 4 7 14
2.38 ± 0.92 3.00 ± 0.76 4.75 ± 1.83 4.38 ± 0.52
7.50 ± 2.27 7.00 ± 0.93 7.13 ± 2.30 5.75 ± 1.04
Data are presented as the mean ± standard deviation from five sections of each animal (n = 3 for sham group, n = 8 for injury group). Ipsilateral = injured side, contralateral = uninjured side.
Fig. 1. Dural mast cell immunohistochemistry with anti-tryptase. (A) Ipsilateral (injured) and (B) contralateral (uninjured) dura 1 day after injury. Arrowheads indicate mast cells. Scale bar = 100 lm. (C) Graph showing the ratios of dural mast cell counts (ipsilateral/contralateral) 1 to 14 days after injury. There was a significant decrease in the number of tryptase-immunoreactive mast cells in the injury group at 1 and 4 days after injury (⁄p < 0.05, n = 8 for injury group, n = 3 for sham group).
cytoplasmic granules in mast cells14, tryptase immunostaining intensity decreases in degranulated mast cells. In this study, decreased numbers of mast cells, assessed using tryptase immunohistochemistry 1 and 4 days after injury followed by recovery 7 and 14 days after injury, indicate that dural mast cells are activated in the early stages and regenerate cytoplasmic granules in the late
450
R. Shimada et al. / Journal of Clinical Neuroscience 19 (2012) 447–451
Fig. 2. Histamine receptor H3 (HRH3) immunohistochemistry. (A) Ipsilateral (injured) and (B) contralateral (uninjured) cerebral cortex 4 days after injury. Scale bar = 200 lm. (C) Time course of changes in cortical expression of HRH3 in sham and injury groups. Scale bar = 200 lm. (D) Graph showing the ratios of HRH3 densities (ipsilateral/contralateral) 1 to 14 days after injury. Densities of HRH3 were significantly increased in the cerebral cortex of injured rats 1 and 4 days after injury (⁄p < 0.05, n = 8 for injury group, n = 3 for sham group).
Fig. 3. Histamine receptor H3 (HRH3) messenger RNA (mRNA) expression in the cerebral cortex 1 to 14 days after injury. HRH3 mRNA expression was normalized to that of b2 microglobulin. HRH3 mRNA expression was significantly increased in the cerebral cortex of injured rats 1 and 4 days after injury (⁄p < 0.05, n = 6 for injury group, n = 3 for sham group).
jury to the parietal bone increases histamine in the underlying cerebral cortex over a period of 5 to 20 min after injury.6 Another study using rats showed that a stab injury to the cerebral cortex increased histamine in the cerebrum 5 hours after injury.3 These two studies suggest that the increased histamine in the brain likely originated from dural mast cells or injured brain tissues.3,6 Enhanced histamine release is known to increase the permeability of the blood–brain barrier and cause brain edema.3,4 In this study, although histamine was not measured, we found increased expressions of HRH3 in the brain 1 and 4 days after injury using a concussive experimental model with CCI, which resembles clinical contusions in patients. An increased release of histamine leads to HRH3 expression and HRH3-mediated inhibition of histamine release and synthesis.8 In our study, both HRH3 mRNA and protein expression were increased 1 and 4 days after injury, suggesting that the HRH3 increase in the brain resulted from the enhanced release of histamine. Our results also suggest that an increased release of histamine affects the brain for up to 4 days after injury. HRH3 acts as an autoreceptor that regulates the release and synthesis of histamine and is considered to be a possible drug target for the treatment of cognitive deficits.15 Studies using HRH3 agonists may elucidate the protective potential of HRH3 against histamine-induced neurotoxicity after head trauma. 5. Conclusion
stages of TBI. Reduced numbers of mast cells 1 day after craniotomy in the sham group indicates that craniotomy itself activates dural mast cells. Head injuries increase the histamine content in the brain.3,6 An experimental study using rats and mice showed that a grazing in-
Changes in dural mast cells correlated with the expression of cerebral HRH3 in a rat CCI model of TBI. Our data support the mechanism by which head trauma induces increased brain HRH3 as follows: dural mast cells are activated by trauma, resulting in
R. Shimada et al. / Journal of Clinical Neuroscience 19 (2012) 447–451
histamine release from the dura, increased blood–brain barrier permeability, and increased histamine levels in the brain. This, in turn, may lead to activation of the HRH3 autoreceptor and inhibition of histamine release and synthesis to prevent the progression of brain edema. Author disclosure statement No conflicting financial interests exist. Acknowledgments This work was supported by grants to Kazuhiko Kibayashi from the Japan Society for the Promotion of Science (no. 19390186 and 21659177). References 1. Kibayashi K, Shimada R, Nakao K. Analysis of pituitary lesions in fatal closed head injury. Am J Forensic Med Pathol, 2011 [Epub ahead of print]. 2. Unterberg AW, Stover J, Kress B, et al. Edema and brain trauma. Neuroscience 2004;129:1021–9. 3. Mohanty S, Dey PK, Sharma HS, et al. Role of histamine in traumatic brain edema. An experimental study in the rat. J Neurol Sci 1989;90:87–97. 4. Butt AM, Jones HC. Effect of histamine and antagonists on electrical resistance across the blood-brain barrier in rat brain-surface microvessels. Brain Res 1992;569:100–5.
451
5. Haas HL, Sergeeva OA, Selbach O. Histamine in the nervous system. Physiol Rev 2008;88:1183–241. 6. Stokely ME, Orr EL. Acute effects of calvarial damage on dural mast cells, pial vascular permeability, and cerebral cortical histamine levels in rats and mice. J Neurotrauma 2008;25:52–61. 7. Onodera K, Miyazaki S. The roles of histamine H3 receptors in the behavioral disorders and neuropsychopharmacological aspects of its ligands in the brain. Nippon Yakurigaku Zasshi 1999;114:89–106. 8. Arrang JM, Garbarg M, Schwartz JC. Autoinhibition of histamine synthesis mediated by presynaptic H3-receptors. Neuroscience 1987;23:149–57. 9. Brody DL, Mac Donald C, Kessens CC, et al. Electromagnetic controlled cortical impact device for precise, graded experimental traumatic brain injury. J Neurotrauma 2007;24:657–73. 10. Hyong A, Jadhav V, Lee S, et al. Rosiglitazone, a PPAR gamma agonist, attenuates inflammation after surgical brain injury in rodents. Brain Res 2008;1215:218–24. 11. Walls AF, Jones DB, Williams JH, et al. Immunohistochemical identification of mast cells in formaldehyde-fixed tissue using monoclonal antibodies specific for tryptase. J Pathol 1990;162:119–26. 12. Sander LE, Lorentz A, Sellge G, et al. Selective expression of histamine receptors H1R, H2R, and H4R, but not H3R, in the human intestinal tract. Gut 2006;55:498–504. 13. Nakao K, Kibayashi K, Taki T, et al. Changes in the brain after intracerebral implantation of a lead pellet in the rat. J Neurotrauma 2010;27:1925–34. 14. Santos PP, Nonaka CF, Pinto LP, et al. Immunohistochemical expression of mast cell tryptase in giant cell fibroma and inflammatory fibrous hyperplasia of the oral mucosa. Arch Oral Biol 2011;56:231–7. 15. Nuutinen S, Vanhanen J, Pigni MC, et al. Effects of histamine H3 receptor ligands on the rewarding, stimulant and motor-impairing effects of ethanol in DBA/2J mice. Neuropharmacology 2011;60:1193–9.
Contents lists available at SciVerse ScienceDirect
Journal of Clinical Neuroscience journal homepage: www.elsevier.com/locate/jocn
Laboratory Study
A rat model of changes in dural mast cells and brain histamine receptor H3 expression following traumatic brain injury Ryo Shimada ⇑, Ken-ichiro Nakao, Rui Furutani, Kazuhiko Kibayashi Department of Legal Medicine, School of Medicine, Tokyo Women’s Medical University, 8-1 Kawada-cho, Shinjuku-ku, Tokyo 162-8666, Japan
a r t i c l e
i n f o
Article history: Received 16 March 2011 Accepted 26 June 2011
Keywords: Dura Head trauma Histamine receptor Mast cell
a b s t r a c t Mast cells can secrete histamine in response to extrinsic stimuli. Histamine plays a role in the development of brain edema and can induce histamine receptor H3 (HRH3) expression in the brain to provide protective feedback effects against histamine neurotoxicity. We investigated time-dependent changes in dural mast cell numbers and HRH3 expression in the brain for one to 14 days after traumatic brain injury in a controlled cortical impact model in the rat. The number of tryptase-immunoreactive dural mast cells at the site of impact was significantly decreased one and four days after the injury. Furthermore, immunoreactivity and messenger RNA (mRNA) expression of HRH3 at the underlying cortical contusion site were significantly increased one and four days after the injury. These data suggest that histamine released from degranulated unstainable mast cells induces a transient increase in presynaptic autoinhibitory HRH3 immunoreactivity and mRNA expression as a mechanism to counteract histamine neurotoxicity. Ó 2011 Elsevier Ltd. All rights reserved.
1. Introduction Traumatic brain injury (TBI) results in progressive cortical degeneration following blunt force trauma to the head. Post-traumatic brain edema, leading to an expansion of brain volume, is one of the causes of TBI progression, as it increases intracranial pressure, impairs cerebral perfusion and oxygenation, and contributes to additional ischemic injuries.1,2 Histamine is known to play a role in the development of brain edema.3 Previous studies have shown that histamine increases vascular permeability and water content in the brain.4 Mast cells secrete stored histamine in response to extrinsic stimuli.5,6 In TBI, a cranial blunt force impact is transmitted through the dura to the brain. Because the dura contains mast cells, it has been hypothesized that a head injury activates dural mast cells, causing them to release histamine and exacerbate the brain injury.6 Three types of histamine receptor have been identified in the brain: histamine receptor H1 (HRH1), HRH2 and HRH3.5 HRH3 is widely distributed throughout the brain and is expressed in the presynaptic terminals of histaminergic neurons.7 HRH3 is an autoreceptor that inhibits histamine release and exerts a protective effect against histamine neurotoxicity. Thus, increased release of histamine leads to HRH3 activation and HRH3-mediated inhibition of histamine release and synthesis.8 Analysis of HRH3 expression
⇑ Corresponding author. Tel./fax: +81 3 5269 7300. E-mail address: [email protected] (R. Shimada). 0967-5868/$ - see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.jocn.2011.06.033
in the brain following blunt force impact is valuable to ascertain the effect of mast cell activation on the progression of TBI. A previous study demonstrated that the activation of dural mast cells in rats and mice continued for five to 20 min after head injury.6 Because TBI deteriorates progressively later than the acute phase of head injury,1,2 we examined the time-dependent changes in dural mast cells and HRH3 expression in the brain one to 14 days after injury in a controlled cortical impact (CCI) model of TBI in rats. 2. Materials and methods 2.1. Animals and surgery The Ethical Review Committee of Animal Experiments at Tokyo Women’s Medical University approved the procedures using animals. Male Wistar rats weighing 200300 g were randomly allocated to either the injury group or sham group. Rats were anesthetized with an intraperitoneal (i.p.) injection of pentobarbital (40 mg/kg), placed in a stereotaxic frame, and had their scalps shaved and incised. A dental drill-trephine was used to perform a craniotomy of 6 mm diameter over the left parietal cortex, 7 mm posterior to the coronal suture and 7 mm lateral to the sagittal suture, taking care not to injure the dura. A CCI device (AmScien Instruments, Richmond, VA, USA) was used to induce TBI in rats in the injury group according to a previously described method.9 A pneumatic piston with a 3 mm diameter rounded metal tip was aligned at 15° vertical over the center of the craniotomy so
448
R. Shimada et al. / Journal of Clinical Neuroscience 19 (2012) 447–451
that the tip was perpendicular with the dural surface at impact. The CCI device was set at 20 psi for low pressure (for holding the pistol rod at its highest position) and 100 psi for high pressure (for rapidly moving the cylinder rod to its lowest position), resulting in a velocity of 3.54 m/s, and a deformation depth of 1 mm below the dura. Because the relationship between dural mast cell changes and brain histamine HRH3 expression was the subject of this study, we used a mild TBI model to minimize secondary brain injury. Immediately after TBI, the bone flap was adhered to a plastic plate (8 mm in diameter, 0.2 mm thick) and restored to seal the craniotomy, and the scalp was sutured closed. Rats were placed in a heat-controlled cage to maintain body temperature while recovering from anesthesia. Rats in the sham group received a craniotomy but no CCI treatment. All neurological, histological and real-time polymerase chain reaction (PCR) studies were performed blind. 2.2. Neurological evaluation Neurological deficits due to CCI were assessed before and 1, 7, 14, and 21 days after surgery by a blinded observer using a 21point sensorimotor scoring system.10 2.3. Sample preparation For histology and immunohistochemistry studies, rats were perfused transcardially with 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS, pH 7.4) under general anesthesia (100 mg/kg pentobarbital i.p.) 1, 4, 7, and 14 days after surgery (injury group, n = 8 per time point; sham group, n = 3 per time point). After the injury site of the dura was marked with Mark-It tissue marking green dye (Richard-Allan Scientific, Kalamazoo, MI, USA), the brain and the dura were removed and post-fixed in 4% PFA/PBS for three hours at 4 °C, and then in 4% PFA/PBS containing 0.1% Tween (4% PFA/PBT) overnight with continuous agitation at 4 °C. The brain and the dura were cut into coronal blocks (3 mm thickness), processed for paraffin embedding, sectioned (7 lm thickness), and mounted on siliconized slides. For total RNA and protein extraction studies, rats were perfused transcardially with PBS under general anesthesia (100 mg/kg pentobarbital i.p.) 1, 4, 7 and 14 days after surgery (injury group, n = 6 per time point; sham group, n = 3 per time point). The brain and the dura were removed, cut into coronal blocks (3 mm thickness) and immersed in RNALater (Ambion, Tokyo, Japan) at 4 °C overnight, and then stored at 80 °C until required.
histochemistry were photographed by light microscopy. Brain images were scanned and a 0.85 mm 0.65 mm (length width) section below the brain injury area was digitized for analysis by ImageJ software (National Institutes of Health, Bethesda, MD, USA). To adjust for sample variation, the density of the ipsilateral (injured) side was divided by that of contralateral (uninjured) side of the same section.
2.5. Real-time PCR A 30 mg sample was taken from the brain tissue cut from an area surrounding the cortical contusion of the brain in the injury group and from a comparable area of the brain in the sham group. Total RNA was extracted from the samples using the RNeasy fibrous tissue mini kit (Qiagen, Tokyo, Japan) according to the manufacturer’s protocol. The purity of total RNA was determined using an ultraviolet spectrophotometer at wavelengths of 260 nm and 280 nm, and by the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Tokyo, Japan). RNA quality was verified on a 3-(N-morpholino)propanesulfonic acid-formaldehyde-agarose gel. Complementary DNA (cDNA) for real-time PCR was produced using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Tokyo, Japan) according to the manufacturer’s protocol. Real-time PCR was performed on a 7500 Real-Time PCR System (Applied Biosystems) with the Power SYBR Green PCR Master Mix (Applied Biosystems). Sequences for the primers were constructed using Primer Express (Applied Biosystems) as follows: HRH3 (HRH3, NM_053506), forward primer: TACTGTGTGCCTCCTCGGTCTT, reverse primer: AGCTCGAGTGACTGACAGGAATC; and b2 microglobulin housekeeping gene (B2M, NM_012512), forward primer: ACCCACCGAGACCGATGTATAT, reverse primer: GGTTTTGGGCTCCTTCAGAGT. The cycling parameters were: thermal activation for 10 min at 95 °C and 40 cycles of PCR (denaturing for 15 secs at 95 °C, annealing and extension for 1 min at 60 °C). HRH3 messenger RNA (mRNA) expression was normalized to that of b2 microglobulin.
2.6. Statistical analysis All values were reported as the mean ± standard deviation. Two-way analysis of variance was used to assess differences between the injury group and the sham group over the different time periods and, if significant, was followed by the Bonferroni post-hoc test. Differences were considered significant at the p < 0.05 level.
2.4. Histological staining and analysis Coronal sections were stained with hematoxylin and eosin (H&E). Two primary antibodies were used: a monoclonal antibody to mast cell tryptase (clone AA1) (IMG-80250; Imgenex, San Diego, CA, USA; 1:1000)11 and a polyclonal antibody to affinity-purified HRH3 (SP4355P; Acris antibodies GmbH, Herford, Germany; 1:1500).12 Sections of the dura and brain were incubated in primary antibodies overnight at 4 °C, and then incubated at room temperature for 30 min each with the appropriate biotinylated secondary antibodies and avidin–biotin complex (DakoCytomation LSAB2 system-HRP, Dako, Carpinteria, CA, USA), followed by enzymatic development with 3,30 -diaminobenzidine.13 Tryptase-immunoreactive mast cells, in five sections of dura spaced 50 lm apart within the area of impact, and in a comparable area of contralateral dura, were counted using light microscopy at 100 magnification. Counts were expressed as the average number of mast cells in five sections. To account for inter-sample variation, ipsilateral mast cell counts were divided by contralateral counts from the same section. Brain sections stained with HRH3 immuno-
3. Results 3.1. Neurological abnormalities Neurological evaluations conducted using a 21-point sensorimotor scoring system did not identify neurological deficits in any of the animals during the study period.
3.2. Histological findings in H&E stained sections In sections from the injury group, the dura showed no distinct traumatic changes at the impact site; neither hemorrhage nor inflammatory cells were observed in the connective tissue of the dura. The brain exhibited dark and shrunken neurons which are an indication of cortical contusion in an area restricted to the region under the impact site of the dura on the ipsilateral cerebral cortex during the study period. In sections from the sham group, the dura and the brain showed no changes during the study period.
R. Shimada et al. / Journal of Clinical Neuroscience 19 (2012) 447–451
449
3.3. Mast cell counts The number of tryptase-immunoreactive mast cells in the dura significantly decreased in the injury group compared to the sham group 1and 4 days after injury (p < 0.05). At 7 and 14 days after injury, the number of dural mast cells in the injury group recovered to the level of those in the sham group (Table 1, Fig. 1). The number of dural mast cells 1 day after injury was lower than that at 4 to 14 days in the sham group, although not significantly. Mast cells were not identified in the brain sections. 3.4. HRH3 immunohistochemistry In brain sections of the injury group, immunopositive HRH3 staining was observed in neuronal cell bodies within the cerebral cortex. Analysis of staining intensities showed HRH3 immunostaining 1 and 4 days after injury was significantly increased in brain sections from the injury group relative to those from the sham group (p < 0.05). Immunostaining intensity 7 and 14 days after injury was decreased but was still higher in the injury group than in the sham group, although not significantly (Fig. 2). 3.5. HRH3 mRNA expression HRH3 mRNA expression one and four days after injury was significantly increased in brains from the injury group compared with those from the sham group (p < 0.05). At 7 and 14 days after injury, HRH3 mRNA expression in the injury group returned to the level of the sham group (Fig. 3). 4. Discussion This study examined time-dependent changes, one to 14 days after TBI, in dural mast cell levels and cerebral HRH3 expression in the rat CCI model, using histological and biochemical methods. The numbers of stainable mast cells in the dura decreased at 1 and 4 days after injury and recovered to pre-injury levels 7 and 14 days after injury. The expression of HRH3 in the brain increased 1 and 4 days after injury and returned to pre-injury levels seven and 14 days after injury. These findings indicate that changes in dural mast cells correlate with the expression of cerebral HRH3. As both mast cell numbers and HRH3 levels are associated with histamine neurotoxicity, identifying time-dependent alterations in mast cell populations and HRH3 levels may further the understanding of TBI pathophysiology. Activation of dural mast cells has been observed in an experimental grazing head injury model using rats and mice.6 Activated mast cells release cytoplasmic granules to the surrounding tissues.6 As tryptase is one of the main components of the Table 1 The number of tryptase-immunoreactive mast cells in the dura of rats with traumatic brain injury
Sham Day Day Day Day Injury Day Day Day Day
Ipsilateral
Contralateral
1 4 7 14
3.33 ± 0.58 6.67 ± 1.15 5.67 ± 0.58 4.33 ± 0.58
5.33 ± 0.58 8.67 ± 1.15 7.67 ± 1.53 5.67 ± 1.53
1 4 7 14
2.38 ± 0.92 3.00 ± 0.76 4.75 ± 1.83 4.38 ± 0.52
7.50 ± 2.27 7.00 ± 0.93 7.13 ± 2.30 5.75 ± 1.04
Data are presented as the mean ± standard deviation from five sections of each animal (n = 3 for sham group, n = 8 for injury group). Ipsilateral = injured side, contralateral = uninjured side.
Fig. 1. Dural mast cell immunohistochemistry with anti-tryptase. (A) Ipsilateral (injured) and (B) contralateral (uninjured) dura 1 day after injury. Arrowheads indicate mast cells. Scale bar = 100 lm. (C) Graph showing the ratios of dural mast cell counts (ipsilateral/contralateral) 1 to 14 days after injury. There was a significant decrease in the number of tryptase-immunoreactive mast cells in the injury group at 1 and 4 days after injury (⁄p < 0.05, n = 8 for injury group, n = 3 for sham group).
cytoplasmic granules in mast cells14, tryptase immunostaining intensity decreases in degranulated mast cells. In this study, decreased numbers of mast cells, assessed using tryptase immunohistochemistry 1 and 4 days after injury followed by recovery 7 and 14 days after injury, indicate that dural mast cells are activated in the early stages and regenerate cytoplasmic granules in the late
450
R. Shimada et al. / Journal of Clinical Neuroscience 19 (2012) 447–451
Fig. 2. Histamine receptor H3 (HRH3) immunohistochemistry. (A) Ipsilateral (injured) and (B) contralateral (uninjured) cerebral cortex 4 days after injury. Scale bar = 200 lm. (C) Time course of changes in cortical expression of HRH3 in sham and injury groups. Scale bar = 200 lm. (D) Graph showing the ratios of HRH3 densities (ipsilateral/contralateral) 1 to 14 days after injury. Densities of HRH3 were significantly increased in the cerebral cortex of injured rats 1 and 4 days after injury (⁄p < 0.05, n = 8 for injury group, n = 3 for sham group).
Fig. 3. Histamine receptor H3 (HRH3) messenger RNA (mRNA) expression in the cerebral cortex 1 to 14 days after injury. HRH3 mRNA expression was normalized to that of b2 microglobulin. HRH3 mRNA expression was significantly increased in the cerebral cortex of injured rats 1 and 4 days after injury (⁄p < 0.05, n = 6 for injury group, n = 3 for sham group).
jury to the parietal bone increases histamine in the underlying cerebral cortex over a period of 5 to 20 min after injury.6 Another study using rats showed that a stab injury to the cerebral cortex increased histamine in the cerebrum 5 hours after injury.3 These two studies suggest that the increased histamine in the brain likely originated from dural mast cells or injured brain tissues.3,6 Enhanced histamine release is known to increase the permeability of the blood–brain barrier and cause brain edema.3,4 In this study, although histamine was not measured, we found increased expressions of HRH3 in the brain 1 and 4 days after injury using a concussive experimental model with CCI, which resembles clinical contusions in patients. An increased release of histamine leads to HRH3 expression and HRH3-mediated inhibition of histamine release and synthesis.8 In our study, both HRH3 mRNA and protein expression were increased 1 and 4 days after injury, suggesting that the HRH3 increase in the brain resulted from the enhanced release of histamine. Our results also suggest that an increased release of histamine affects the brain for up to 4 days after injury. HRH3 acts as an autoreceptor that regulates the release and synthesis of histamine and is considered to be a possible drug target for the treatment of cognitive deficits.15 Studies using HRH3 agonists may elucidate the protective potential of HRH3 against histamine-induced neurotoxicity after head trauma. 5. Conclusion
stages of TBI. Reduced numbers of mast cells 1 day after craniotomy in the sham group indicates that craniotomy itself activates dural mast cells. Head injuries increase the histamine content in the brain.3,6 An experimental study using rats and mice showed that a grazing in-
Changes in dural mast cells correlated with the expression of cerebral HRH3 in a rat CCI model of TBI. Our data support the mechanism by which head trauma induces increased brain HRH3 as follows: dural mast cells are activated by trauma, resulting in
R. Shimada et al. / Journal of Clinical Neuroscience 19 (2012) 447–451
histamine release from the dura, increased blood–brain barrier permeability, and increased histamine levels in the brain. This, in turn, may lead to activation of the HRH3 autoreceptor and inhibition of histamine release and synthesis to prevent the progression of brain edema. Author disclosure statement No conflicting financial interests exist. Acknowledgments This work was supported by grants to Kazuhiko Kibayashi from the Japan Society for the Promotion of Science (no. 19390186 and 21659177). References 1. Kibayashi K, Shimada R, Nakao K. Analysis of pituitary lesions in fatal closed head injury. Am J Forensic Med Pathol, 2011 [Epub ahead of print]. 2. Unterberg AW, Stover J, Kress B, et al. Edema and brain trauma. Neuroscience 2004;129:1021–9. 3. Mohanty S, Dey PK, Sharma HS, et al. Role of histamine in traumatic brain edema. An experimental study in the rat. J Neurol Sci 1989;90:87–97. 4. Butt AM, Jones HC. Effect of histamine and antagonists on electrical resistance across the blood-brain barrier in rat brain-surface microvessels. Brain Res 1992;569:100–5.
451
5. Haas HL, Sergeeva OA, Selbach O. Histamine in the nervous system. Physiol Rev 2008;88:1183–241. 6. Stokely ME, Orr EL. Acute effects of calvarial damage on dural mast cells, pial vascular permeability, and cerebral cortical histamine levels in rats and mice. J Neurotrauma 2008;25:52–61. 7. Onodera K, Miyazaki S. The roles of histamine H3 receptors in the behavioral disorders and neuropsychopharmacological aspects of its ligands in the brain. Nippon Yakurigaku Zasshi 1999;114:89–106. 8. Arrang JM, Garbarg M, Schwartz JC. Autoinhibition of histamine synthesis mediated by presynaptic H3-receptors. Neuroscience 1987;23:149–57. 9. Brody DL, Mac Donald C, Kessens CC, et al. Electromagnetic controlled cortical impact device for precise, graded experimental traumatic brain injury. J Neurotrauma 2007;24:657–73. 10. Hyong A, Jadhav V, Lee S, et al. Rosiglitazone, a PPAR gamma agonist, attenuates inflammation after surgical brain injury in rodents. Brain Res 2008;1215:218–24. 11. Walls AF, Jones DB, Williams JH, et al. Immunohistochemical identification of mast cells in formaldehyde-fixed tissue using monoclonal antibodies specific for tryptase. J Pathol 1990;162:119–26. 12. Sander LE, Lorentz A, Sellge G, et al. Selective expression of histamine receptors H1R, H2R, and H4R, but not H3R, in the human intestinal tract. Gut 2006;55:498–504. 13. Nakao K, Kibayashi K, Taki T, et al. Changes in the brain after intracerebral implantation of a lead pellet in the rat. J Neurotrauma 2010;27:1925–34. 14. Santos PP, Nonaka CF, Pinto LP, et al. Immunohistochemical expression of mast cell tryptase in giant cell fibroma and inflammatory fibrous hyperplasia of the oral mucosa. Arch Oral Biol 2011;56:231–7. 15. Nuutinen S, Vanhanen J, Pigni MC, et al. Effects of histamine H3 receptor ligands on the rewarding, stimulant and motor-impairing effects of ethanol in DBA/2J mice. Neuropharmacology 2011;60:1193–9.