A receptor tyrosine kinase specific to hematopoietic stem and progenitor cell-enriched populations

Cell, Vol. 65, 1143-l 152, June 26, 1991, Copyright

0 1991 by Cell Press

A Receptor Tyrosine Kinase Specific to Hematopoietic Stem and Progenitor Cell-Enriched Populations William Matthews,’ Craig T. Jordan, Gordon W. Wiegand,t Drew Pardoll,t and lhor R. Lemischka’ *Department of Molecular Biology Princeton University Princeton, New Jersey 08540 tDepartment of Medicine Johns Hopkins University Baltimore, Maryland 21205

l

Summary To elucidate the molecular biology of the hematopoietic stem cell, we have begun to isolate genes from murine cell populations enriched in stem cell activity. One such cDNA encodes a novel receptor tyrosine kinase, designated fetal liver kinase-2 or f/k-2, which is related to the W locus gene product c-&if. Expression analyses suggest an extremely restricted distribution of flk-2. It is expressed in populations enriched for stem cells and primitive uncommitted progenitors, and is absent in populations containing more mature cells. Therefore, this receptor may be a key signal transducing component in the totipotent hematopoietic stem cell and its immediate self-renewing progeny. Introduction The hallmark of the hematopoietic system is a precisely controlled production of at least eight cell lineages. At the center of this process lies the hematopoietic stem cell, which possesses both an ability to self-renew and to produce committed progenitors for all hematopoietic lineages (reviewed by Dexter and Spooncer, 1987). Most models of self-renewal and commitment are based on in vitro progenitor studies. These experiments have defined a wide range of growth factors and receptors that promote the in vitro development of colonies composed of one or more cell lineages (reviewed by Metcalf, 1984). In contrast, the molecular components that mediate the in vivo behavior of the most primitive totipotent hematopoietic stem cell are largely unknown. Recently, several laboratories, including our own, have reported procedures for the enrichment of adult bone marrow or fetal liver stem cells (Visser et al., 1984; Johnson and Nicola, 1984; Spangrude et al., 1988; Ploemacher and Brons, 1989; Szilvassy et al., 1989; Jordan et al., 1990). These enriched stem cell populations provide an opportunity to identify molecules that may be important in regulating developmental decisions and proliferation of the hematopoietic stem cell. Protein tyrosine kinases (pTKs) are thought to play an important role in cellular proliferation, as demonstrated by their frequent roles as growth factor receptors (reviewed by Pawson and Bernstein, 1990). Furthermore, their role in hematopoiesis has been demonstrated by the finding

that the Wlocus encodes the receptor tyrosine kinase c-kit (Chabot et al., 1988; Geissler et al., 1988). Mutations in this gene affect the erythroid and mast cell lineages. In addition, the CFU-S class of stem cells is severely depleted in mice homozygous for W mutations (Russell, 1979). More recently, the product of a phenotypically similar locus (Steel) has been identified as the ligand capable of binding to, and activating, c-kit (reviewed by Witte, 1990). The present study describes a direct strategy to identify stem cell-specific genes in order to provide the basis for molecular dissection of stem cell function. We placed particular emphasis on cDNA6 encoding receptor kinases since these molecules are likely to play crucial roles in stem cell development. As a result we have identified a novel receptor tyrosine kinase that appears to be expressed only in hematopoietic populations enriched in multipotential and self-renewing stem/progenitor cells. Results Isolation of a Novel Receptor Tyrosine Kinase cDNA from Stem Cell-Enriched Hematopoietic Tissue Identification of genes that are specifically expressed in hematopoietic stem cells is hampered by the low frequency of these cells in hematopoietic tissues (1 in 104105) (Boggs et al., 1982; Harrison et al., 1988). A stem cell-specific gene product would therefore go undetected in conventional screens. To circumvent this difficulty, we devised a strategy that enriches for the most primitive hematopoietic stem cells (Jordan et al., 1990). Members of specific gene families expressed in these enriched populations can then be isolated by polymerase chain reaction (PCR)-based amplification using degenerate oligonucleotide mixtures encoding conserved amino acid motifs. The overall strategy is diagrammed in Figure 1. A6 demonstrated previously, the AA4.1 monoclonal antibody segregates the entire primitive stem/progenitor cell hierarchy into the 0.5-l .O%I AA4.1+ fraction of day 14 fetal liver (McKearn et al., 1985; Jordan et al., 1990). This fraction can be further subdivided using a cocktail of antibodies (collectively called Lin), raised against specific differentiation antigens (Spangrude et al., 1988). The Lin cocktail allows three distinct subpopulations of cells to be defined and separated using flow cytometry: AA4+ Lin’” (O.Ol0.02% fraction of fetal liver), which contains the bulk of long-term reconstituting totipotent stem cells (Jordan et al., 1990); AA4’ Linbr, which is depleted of such cells but contains significant numbers of multipotential in vitro progenitors (I. R. L., unpublished data); and AA4-, which is devoid of primitiveclonogeniccells but contains less primitive progenitors such as the CFU-E (McKearn et al., 1985). These cell populations were isolated from midgestation (day 14) fetal liver as described previously (Jordan et al., 1990). RNA was purified and used in cDNA synthesis as described in the Experimental Procedures. To amplify tyrosine kinase cDNA segments we used

Cell 1144

Figure 1, Strategy for Isolation of Novel Tyrosine Midgestation 1990). RNA, primers PTKl screening of

Kinase cDNAs from Stem-Enriched

Hematopoietic

Tissue

(day 14) fetal liver cells were fractionated into AA4.1+, AA4.V, AA4.1’ Lin’“, and AA4.1 Lir?’ as described previously (Jordan et al., and subsequently, cDNA was obtained from each subpopulation (see Experimental Procedures), The degenerate oligonucfeotlde and PTKP (Wilks, 1989) were used to amplify pTK cDNAs. Novel members of this family were obtained by differential hybridization a library of individual clones (see Experimental Procedures). Totipotent hematopoietic stem cells are abbreviated THSC.

the degenerate oligonucleotides PTKl and PTK2. These primers have previously been successfully used to amplify pTKs from the factor-dependent cell line FDC-PI (Wilks, 1989). The 5’ primer (PTKl) represents the amino acid sequence IHRDL (position 392 in c-src). The 3’ primer (PTKP) represents the sequence DVWSFG (position 453 in c-src). The nucleotide sequence flanked by these two primers is 210 bp in length in all pTKs (Hanks et al., 1988). PCR amplification and cloning of the 210 bp products obtained from AA4+ populations are described in detail in the Experimental Procedures. Sequence analysis of random clones identified c-fms, c-kit, c-abl, c-lyn, and two kinases previously designated 17 and 22 (Wilks, 1989), confirming the efficacy of the overall strategy. Novel members of the pTKfamilywere isolated by using the previously described pTK clones as probes in a differential hybridization screen of approximately 1000 independent clones. Potentially novel sequences, hybridizing only at low stringency, were sequenced. An invariant DFG amino acid triplet internal to the amino acids encoded by PTKl and PTKP is present in all pTKs (Hankset al., 1988). Novel sequencescontaining this DFG triplet can be assigned to the pTK family. Furthermore, a methionine residue in the conserved internal sequence WMAPES is diagnostic for the receptor pTK subfamily (Hanks et al., 1988). Based on these criteria, and on comparison with the sequence data bases, one novel clone, designated fetal liver kinase-2 (flk-2) was likely to be a transmembrane receptor tyrosine kinase. This clone was then used to screen an amplified gtl0 cDNA library (constructed from whole day 12.5 mouse embryos) in order to obtain larger cDNAs. Only one distinct cDNA clone out of a large number of total clones screened was isolated. This low abundance suggested that flk-2 is expressed in a minor cell population. Preliminary sequence analysis indicated that this clone encompassed 90% of the pTK catalytic domain. The sequence obtained from this clone was used to design gene-specific oligonucleotides. Because initial expression experiments indicated that flk-2 was expressed in AA4+-enriched populations, we chose to focus on cDNAs obtained from AA4+ cells in all of the following experiments. Two basic approaches for cloning the full-length cDNA were employed. First, mRNA from AA4+ cells was used to

construct a cDNA library in gtl 1 (see Experimental Procedures). The AA4’ subpopulation only represents 1% of fetal liver, so it was difficult to obtain quantities of mRNA sufficient to construct a highly representative library. Nevertheless, one additional clone that extended from nucleotide 2387 to the 3’end of the flk-2 mRNA was isolated. As a second approach, we used anchored PCR (Frohman et al., 1988) to extend the S’end of the cDNA (see Experimental Procedures). Two successive rounds of anchored amplification yielded a composite cDNA of 3.4 kb, which is in accord with the mRNA size estimated by Northern analysis of AA4’ RNA (see Figure 5). This cDNA was demonstrated to represent contiguous coding sequences by PCR using several sets of overlapping primers (data not shown; see Experimental Procedures). The Sequence of f/k-Z The complete sequence of the flk-2 cDNA shown in Figure 2 extends for 3453 nucleotides. An open reading frame of 990 amino acid residues is framed by 30 nucleotides of 5’ untranslated sequence and 447 residues of 3’ untranslated sequence. A polyadenylation signal (AATAAA) is found 11 nucleotides upstream of the poly(A) sequence at the 3’ end of the cDNA. The nucleotides surrounding the first ATG codon found in this open reading frame match the consensus sequence for a translation initiation site (Kozak, 1986). The deduced 990 amino acid polypeptide contains several distinct features that are characteristic of receptor pTKs. The amino acid residues following the ATG codon are hydrophobic, and have the characteristics of a signal peptide sequence (Von Heijne, 1983; Watson, 1984). An extracellular domain of 542 amino acids terminates with a hydrophobic sequence of 20 amino acids. This putative transmembrane domain is flanked on the cytoplasmic side by a basic region suggesting the junction between the transmembrane and cytoplasmic domains. Nine consensus sequences for asparagine-linked glycosylation (NXS/T) can be found in the putative extracellular domain. This domain also contains 22 cysteine residues. The cytoplasmic domain contains the conserved protein kinase domains (I-XI) previously described (Hanks et al., 1988). These subdomains are responsible for catalytic function as part of the active site or in determining secondary structure of the kinase domain (Hanks et al., 1988). In

A Novel Receptor 1145

in Primitive Hematopoietic

Cells

1741

1

,,RALAORSDR 61

C-GCTGCTGCTTGTTGTTTTGT-MT~T~TTG

121 CTGCCTGTGAT

1001 1861

S A G K 1e1 CCATCATCGTACCGAATUGAGGATCCCCAGAAGACCTCCAGTGTACCCC-GC PSSYRMVRGSPEDLQ@TPRR 241 CAWU;TGAAGGGACGGTATAT-~-~CCGTU;RGG~ QSEGTVYEAATVEVAESGSI 301 ACC~-GTGCAGCTc~CCCACCCCPlGGCGACCITTCc GCCTCTGGGTCTT~~~~ TLQVQLATPGDLSCLWVFKH a 361 AGCTCCCTGGGC GCCAGCC-CTTTGATTTA-CAGAWTCGTTTCCATGGCC SSLGCQPHFDLQNRGIVSMA h 421

1921 1981 2041 2101 2161

481

2221

541

22Sl

601 COZGAGCCCACTGTGGAGTGGGTGCT

2341

661 C%CCCTGCTGTTGTCAGAAAGW\U;AARAGGTGGAW ACTTCATGAGTTGTTCGGACATC GPAVVRKEEKVLHELFGTDI 721 GTGCTAGAAATGCACTGGGCCGCGAA GCACCAAGCTGTTCACCATAW\TCTA ia?iA R N A L G R E&T K L F T iCCRGka 781 PS~CCAGGCTCCTUT~CC~TATTCCTG~GT~ NQAPQSTLPQLFLKVGEPLW 841 ATCAGG GTAAGGCCATCCATGTGMCCATGGATTCGGGCTCACCT~~TGGMGAC IRCKAIHVNHGFGLTWELED 6 901 -CCTCW\GWLGGGCAGCTACTTTW\GATGPIGTAcATG KALEEGSYFEMSTYST,NRGM 961 ATTCCGATTCTCTT-CTTTGTGTCTTCCC;TGGGARGG~ IRILLAFVSSVGRNDTGYYT 1021 GCXTTCCT URRGCACCCCAGCU\GTCRGCGTTU;TGAcU\TCCTAGAATT aCSSSKHPSQSALVTILEKGF 1001 ATAAACGCTACCAGCTCGCAAGAAGAGTATGAAATTGACCCGTACGAMAGTTCTGCTTC I,NA'LSSQEEYEIDPYEKF@F 1141 TCAGTCA~TTAAA~GTACC~ACGAATC~GA a GCACGTGGATCTTCTCTCAAGCCTCA SVRFKAYPRIRCTWIFSQAS 1201 TTTCCT6 GTGAA CAGAGAGGCCTU;RGGATGACA~TATCTAMTTTTGCGATCAT FPCEQRGLEDGYSISKFODH 1261 AAGAACAAGC-WTAUTATTCTAT GCAGMAATGATGACGCCCTCACCJ\AA KNKPGEYTFYILND"Z,OFTK 1321 AT~CAcGCTW\RTATAnWU\AWW\CnCARGTGCTAGC MFTLNIRKKPQVLA,NAs,ASQ 1381 GCGTCa GTTCCTCTGATGGCTACCCGCTACCCTCTTGGACCTGGMGAAGTGTTCGGAC ASCSSDGYPLPSWTWKK@SD 1414 AAATCTCCCAA GCACGGA-TCCC GTTTGGAATAAMAGGCTAACAGA KS P&&j EEIPEGVWNKKANR 1501 AAACKXTTGGCCAGTGGGTGTCGAGCAGTACTCTAMTATGAGTGA@%CGGGAAAGGG 1561

2401 2461 2521 2581 2641 2701 2761 2E21 2881 2941 3001 3061 3121 3181 3241 3301 3361 3421

TTTXGTACGAGAGTCAGCTGCAGATAGCTGCAW\TGGTGACTG FRYESQLQMIQVTGPLDNEY TTCTACGTTGACTT ‘XGCGACTATGAATATGACCTTAAGTGGGAGTTCCCGAGAGAGMC FYVDFRDYEYDLKWEFPREN TTAGAGTTTGGW\PffiTCCTU;GGTCTGGCGCTTTCGUC LEFGKVLbSGAFG,RVMNATA TATGCCATTAGTAAAACGCTCAATTCAGGTGXGGTGAAGATGCTAM.AGAGbU YGISKTGVSIDVAVKMLKEK CCTGRCAGCTGTGAAAAAGAAG&Tu\T&%AGCTCAAAATGATGACCCACCXGGA ADSCEKEALMSELKMHTHLG CACCATGAcMCATCGTGAATcTGCTGGGGGCA TGCACACTGTCAGXZCCAGTGTACTTG HHDNIVNLLGACTLSGPVYL A-T-TATTGTTGCTATGGTG~CCTCCTCCT~CCG IFEYCCYGDLLNYLRSKREK TTTCACAGGAcATGGACAGAGATTTTTM&GAAcATAATTTCAGTTC?TACCCT~TC FHRTWTEIFKEHNFSSYPTF CAGCCACATTCAMTTCCAGCATGCCTGGTTCACGAGAAGTTcAGTTACACCCGCCCTTG 9AAsNSsHPGSREVOLHPPL W\TU\GCTCTCRGGGTTCAA?GGGIU\TTCATTCATTCT JQLSGFNGNSIHSEDEIEYE AACCAGAAGAGGCTGGCAGAATTTGAACGTGCTGACGTTTGMbGAC BOKRLAEEEEEDLNVLTFED CTCClTTGCTTTGCGTACCAAGTGGCCAAAU;CRTU;AATTCCTGGAGTTCAAGTCGTGT LLCFAYQVAKGMEFLEFKSC GTCCACAGAGACCTGGCAGCCAGGAATGTGTTGGTcACCCACGGGAAGGTGGTGAAGATC IV" R D L AARNlVLVT H G K V V K I TGTGACTTXGACTGGCCCGCCTGAGCGACTCCAGCTACGTCGTCA"XXXAAC C,DFQLARDILSDSSYVVRGN GCACGGCTGCCGGTGAAGTGGGcACCCGAGAGCTTATTTGAAGGGATCTACAcAATC ARLPVK~WMAPES~LFEGIYTI AAGRGTGACGTCTGGTCCTACGGCATCCTTCTCT~GATATTTTCACT~TGTGAAC K(SDVWSYa ILLWEIFSLGVN CCTTACCCTGGChTTMGTCW\CGCTAACTTCTATAMCTGATTCAGAGTGGA-lTTAAA PYPGIPVDANFYKLIQSGFK ATGGAGCAGCCATTCTATGLXJ,CAGAAGGGATATACTTTGTAAT~TCCTGCTGGGCT HEQPFYATEGIYFVMQSCWA TTTGRCTCAAGGA%CGGCCCCTTCCCCAACCTGACTTCATTTTTAGGATGTCAGCTG FDSRKRPSFPNLTSFLGCQL GCAGAGGCAGAAGAAGCATGTATCAG~CATCCATCCATCTACCAA,,ACAGGCGGCCCCT AEAEEACIRTSIHLPKQAAP CAGCAGAGA-GGGCTCAGAGCCCAGTCGCCACAGCGCCAGGTGAAGATTCAtiGAGM

QQRGGLRAQSPQRQVKIHRE AGAKTTAGC-GGCCTTGGACCCCGCCACCCTAGCAGCCTGTAGACCGCAGAGCCA R S AGA'lTAGCCTCGCCTCTGAGGAAGCGCCCTACAGCGCGTTGCTTCGCTGGACTT'lTCTCT AGATGCTGTCTGCCATTACTCCAAAGTGACTTCTATAAAATCAMCCTCTCCTCGCACA’Z GCGGGAGAGCCAATAATGAGACTTGTTGTT~TGAGCCCGCCTACCCTGGGGGC CTTTCCACG AGC'ITGAGGGGAAAGCCATGTATCTGAAATATAGTATATTCTTGTAAATACGTGAMC~ ACCAMCCCGTTTTTTGCTAMAGCTAAATATGATTTTT~TCTATG~TT~ ~T~ATGTMCTTTTTCATCTATTTAGTGATATATTTTAT-T~~T~CTTTC

TACTGT-

KVFGQWVSSSTLNMS,EAGKG CTTCI’GGTCAAA Gc GTGCGTACAATTCTATGGGCACGTCTTGC~CCATCTTTTTA

LLVK&&AYNSMG:S@ETIFL AACTCACCAGGCCCCTTCCCTTTCATC-CAACATCTCCTTCTAT~GACCATTGGG NSPGPFPFIQDfi1S.w 1681 CTCTGTCTCCCCTTCATTGTTGTTCTCATTGATC KY K KQ I -1"

1621

Figure 2. Nucleotide

Sequence

of f/k-2

The nucleotide sequence of the flk-2 cDNA coding strand and predicted amino acid sequence are shown. Amino acids are given in single letter code. The signal peptide sequence immediately following the ATG codon is underlined. Extracellular cysteine residues are circled. Asparaginalinked glycosylation sites (NXS/T) are indicated by brackets. The transmembrane coding region, beginning at nucleotide 1663, is boxed. In the intracellular domain the following are boxed: GSGAFG, the ATP-binding site: DLAARN, the sequence motif indicative of tyrosine kinases; WMAPES, the motif that indicates a transmembrane kinase; DFG, the invariant input in all tyrosine kinases. Also boxed are VHRDL and SDVWSYG, the amino acids encoded by the degenerate oligonucleotide mixtures PTKl and PTW.

brief, subdomain I (GXGXXG) encodes the ATP-binding site, while subdomain VI (DLAARN) distinguishes tyrosine as opposed to serine-threonine kinases. Subdomain VIII (WMAPES) contains the methionine residue indicative of transmembrane tyrosine kinases. The tyrosine kinase domain of flk-2 is divided into two distinct regions (residues 1855-2154 and 2388-2888) separated by a 77 amino acid sequence that is mostly hydrophilic. This kinase insert domain is unique for each member of subclass III and IV pTKs (Ullrich and Schlessinger, 1990) and is thought to play a role in the specificity of kinase substrate binding (Yarden et al., 1988; Cantley et al., 1991). Comparison of flk-2 Protein Sequence with the c-klt, c-fms Subfamily of Receptor Tyroslne Kinases The predicted amino acid sequence of flk-2 indicates that

it is a member of the c-kit, c-fms, and Pdgfr subgroup of receptor pTKs. On the basis of conserved cysteine residues and other sequence motifs, this group is included in the immunoglobulin superfamily of proteins involved in cell-surface recognition (Williams and Barclay, 1988). A complete comparison of the predicted amino acid sequence of flk-2 with c-kit and c-fms is shown in Figure 3A. The extracellular domains of flk-2, c-kit, and c-fms are 542,518, and 510 amino acids in length, respectively. The overall homology of flk-2 with other family members is approximately 30% based on consensus amino acids and conservative amino acid substitutions (Figure 3A). Nine of the ten conserved cysteine residues of the receptor family aresimilarlyconsewed in flk-2. Strikingly, the extracellular domain of flk-2 contains an additional 12 cysteines not present in either c-kit or c-fms. Interestingly, flk-2 contains two regions of intragenic homology characterized by a consenred spacing of cysteine residues (Figure 3B). This

Cell 1146

Figure 3. Comparison

of the flk-2 Predicted

Amino Acid Sequence

with c-kit and c-fms

(A) flk-2, c-kit, and c-fms amino acid sequences were compared using the GAP program from Genetics Computer Group sequence analysis software package. Consensus amino acids between the genes are shown. An amino acid is included in the consensus if it is identical in at least two of the three sequences. The conserved signal peptide sequences are shown in the stippled box. Conserved cysteine residues in the extracellular domain are marked by asterisks. The transmembrane regions are also boxed. The intracellular domains of the three genes are highly homologous except for the kinase insert regions beginning at approximately amino acid 690. (8) The intragenic extracellular amino acid homologies of flk-2 are compared with homologous regions in c-kit and c-fms. The flk-2 homologous regions extend from amino acid 140 to 249 and 415 to 532. The homologous region of c-kit is from 390 to 510, and in c-fms. from 374 to 500. Conserved cysteine residues in these regions are marked by asterisks.

duplicated region shares significant homology with the region adjacent to the transmembrane domain in both c-kit and c-fms and contains four conserved cysteines. This homology suggests that the flk-2 extracellular domain may have arisen by an ancient duplication event of highly conserved immunoglobulin-like domains. The intracellular domains of flk-2, c-kit, and c-fms are 436,461, and 440 amino acids in length, respectively. The kinase insert domains are, as expected, unique, but the two.flanking kinase subdomains are highly homologous at the amino acid level (Figure 3A). Interestingly, the kinase insert domains of c-kit, c-fms, and also Pdgfrb, contain the consensus sequence( ~~~~~YVMPMXX) for tyrosine kinase autophosphorylation sites that bind phosphatidylinositol 3-kinase, whereas flk-2 does not (Cantley et al., 1991). The C-terminal segments of the kinases are dissimilar. Neither flk-2 nor c-kit possesses the additional tyrosine phosphory-

lation sites found in the C-termini of Pdgfra/b and c-fms. These sites have been implicated in negative regulation of kinase activity (reviewed in Cantley et al., 1991). Expression of flk-2 mRNA in Fetal Liver Hematopoietic Cells Our stem cell enrichment procedure delineates four fetal liver subpopulations AA4+, AA4-, AA4’ Lint”, and AA4+ Lir?‘. Because of the small amounts of RNA obtained from the AA4+ Lin sorted cells, PCR analysis was used to determine the expression of flk-2 mRNA in these subpopulations (see Experimental Procedures). Using oligonucleotide primers designed specifically against the kinase insert domain, flk-2 was found to be expressed in AA4+, AA4+ Lit?“, and AA4+ Linb’but not in AA4- cells. (Figure 4A). The amplifications consisted of 50 cycles and were repeated on three separate sets of samples derived from three inde-

A Novel Receptor 1147

in Primitive Hematopoietic

Cells

Figure 4. Expression

of flk-2 in Fetal Liver Subpopulations

(A) The righthand half of (A) shows the expression of flk-2 in AA4+, AA4-, AA4+ Lin’“, and AA4+ Lir?‘cell populations analyzed by PCR (see Experimental Procedures). The lanes are labeled accordingly. Control lanes include all components of the PCR reactions except cDNA template. The lefthand lanes represent the same cDNA templates amplified with oligonucleotides specific for a second receptor tyrosine kinase, designated flk-1 , which is expressed in all fetal liver subpopulations. These lanes are included as a positive control demonstrating that the flk-2 negative AA4- cell cDNA templates contain amplifiable molecules. Below the ethidium bromide-stained panel is a Southern blot of the same gel hybridized with a flk-2 probe (see Experimental Procedures). This blot underscores the absence of flk-2 amplification products in the AA4- cDNA. Note also the absence of hybridization in the flk-I lanes. (6) flk-2 amplification using templates from AA4+ fetal liver cells further fractionated on the basis of Sea-1 antigen expression as well as Lin and Sea-1 expression. The lanes are labeled accordingly. The righthand set of AA4’ Linb’ Sea’ and AA4’ Lin” Scam samples was cocultivated with retroviral marker producer cells as described (Jordan et al., 1990). All other samples were obtained from fresh fetal liver. In all our fetal liver subpopulations, cocultivation of samples with retroviral markers does not alter the expression of flk-2 as compared with fresh liver.

pendent cell purifications. Failure todetect any flk-2 mRNA in three independent AA4- samples further underscores its restricted expression in fetal liver. We had previously demonstrated that most, if not all, totipotent hematopoietic stem cells are present in the AA4+ Lin’Ofraction. The AA4+ Lir? fraction appears to be devoid of totipotent stem cells, but contains significant numbers of CFU-S and other progenitor cells (Jordan et al., 1990; unpublished data). The presence of flk-2 both in AA4+ Lin’” and Lin& RNAs indicates that flk-2 is expressed in enriched stem/progenitor cell populations but not in the AA4- fraction that is lacking in stem cells and primitive progenitor cells. Adult murine bone marrow and day 14 midgestation fetal liver stem cell populations have been shown to express the Sea-1 antigen (Ly6A) (Spangrude et al., 1986; lkuta et al., 1990). In agreement with this, recent studies in our laboratory (C. T. J. et al., unpublished data) have determined that the phenotype of the fetal liver stem cell is AA4+ Sea+. Therefore, we have analyzed the expression of Flk-2 mRNA in AA4+ Sea’ and AA4+ Sea- populations (Figure 48). Also shown in the figure is an analysis of flk-2 expression in AA4+ cells separated into Sea’ Link and Sea+ Link subpopulations. Based on previous and ongoing studies, the Sea’ Lin’O cells represent the most highly enriched stem cell population. Flk-2 is expressed in all of these subpopulations, but its expression in AA4+ Sea+ and AA4+ Sea+ Linb underscores its presence in the most primitive hematopoietic subpopulations.

tlk-2 mRNA Expression in Fetal and Adult Tissues The expression of flk-2 was analyzed in a variety of midgestation fetal and adult tissues by Northern blots. The difficulty in obtaining a full-length cDNA, and the number of cycles required to detect expression using PCR, suggested that it would be difficult to detect flk-2 mRNA in nonhematopoietic tissue samples. At day 14 of gestation, flk-2 expression could not be detected using 20 ug of total heart, stomach, intestine, lung, brain, or liver RNA. When poly(A)+ RNAs from brain and fetal liver were analyzed, expression of flk-2 was detected (Figure 5A). The fetal liver mRNA migrated at approximately 3.5 kb, while the brain message was considerably larger. In one experiment sufficient RNA was produced to load 10 ug of total AA4+ cell RNAfor Northern analysis. A predominant RNAof approximately 3.5 kb was detected. In confirmation of our PCR analysis, no expression of flk-2 was observed in AA4RNA. The finding that we could not detect flk-2 mRNA in 20 ug of total fetal liver RNA, or in 10 ug of total AA4RNA, but detected an intense signal in AA4+ RNA, further illustrates the specificity of expression of flk-2 in enriched stem cell populations. In adult tissues, flk-2 RNA was detected in brain and bone marrow (Figure 58). In these tissues the flk-2 message migrated at approximately 3.5 kb. Very recently, Rosnet et al. (1991) have reported the isolation of a cDNA from mouse testis, which encodes for a fragment of 143 putative amino acids. This fragment is nearly identical to amino acids 803 to 945 of flk-2. We have also detected an approximately 1 .O kb unabundant

Cell 1148

Figure 5. Northern Tissues

Analysis

of flk-2 Expression

in Fetal and Adult

(A) flk-2 expression in fetal trssues and fetal liver subpopulations. Poly(A)’ RNAs from fetal liver and fetal brain and 10 ug of AA4’ and AJW total RNA were analyzed (see Experimental Procedures). The membrane was hybridized with a probe fragment encompassing amino sod positions 635 to 895. Ethidium-stained 28s and 18s ribosomal bands from the formaldehyde-agarose gel are shown in the lower panel. Note the size difference in the fetal liver and brain RNA. No detectable hybridization was observed in any other fetal tissue. (6) flk-2 expression in adult tissues. Twenty micrograms of total RNA was analyzed as described above. The ti
transcript in testis RNA (W. M., unpublished data). The relationship of this RNA to the full-length flk-2 mRNA remains to be determined.

sion is restricted to primitive stem/progenitor ulations.

cell pop-

Discussion Expression of flk-2 in Primitive Thymocyte Precursors In one Northern blot experiment (not shown) flk-2 mRNA was detected in day 14 thymus. At this point in development the thymocyte population is highly enriched in primitive precursors (reviewed in Fowlkes and Pardoll, 1989). Totipotent hematopoietic stem cells or their progeny enter the fetal thymic rudiment at approximately day 10 or 11 of gestation. The fetal thymus becomes a developmental system in which fetal progenitor cells undergo a series of synchronous differentiation and selection events. These events give rise to mature T cells of both helper and cytolytic classes. At least to a first approximation, all discrete stages occurring sequentially in fetal thymocyte development are represented simultaneously in the young adult thymus (Fowlkes and Pardoll, 1989). Accordingly, flk-2 expression was investigated in purified cell populations from this organ. The cell surface markers CD4 and CD8 can be used to divide adult thymocytes into four distinct populations: CD4-8-, CD48, CD4-8+, and CD4’8’. The CD4-8- cells can be further subdivided to give a population that is CD4-8- Thy-l’“/IL-2R-. This population represents the most immature thymocytes and constitutes approximately 0.3% of the adult thymus. CD4+8+ cells make up the bulk of the thymocyte population. CD48 and CD8+4- constitute approximately 15% and include the most mature thymic T lymphocytes (reviewed in Fowlkes and Pardoll, 1989). Expression analysis (Figure 6) of the various thymocyte populations indicated that flk-2 mRNA was expressed in the most immature T lymphocyte population CD4-8- Thyl”/lL-2R-. This result is further evidence that flk-2 expres-

The central concept of hematopoietic development is that the totipotent stem cell can self-renew or commit to a path-

Figure 6. Expression

of flk-2 in Adult Thymocyte

Subpopulations

Thymocyte subpopulations CD4-8., CD4-6. Thp, CD4-6. ILR-, CD4+ CD8+, CD4-8’, CD4+8- were prepared as described in the Experimental Procedures. Expression of flk-2 in these populations was analyzed using PCR as described in the Experimental Procedures and in Figure 4. Above each lane are the template cDNAs. Additional samples include:adultthymus(AT),day 16 thymus(d16T),day13 thymus(dl3T) newborn thymus (NET), fetal liver (FL), and fetal brain (FE). As in Figure 4, the control included all PCR components except template. Below the ethidium bromide-stained panel is a Southern blot of the same gel hybridized as in (Figure 4). Lack of hybridization signal in the negative lanes further underscores the absence of flk-2 in these populations. It is important to note that all thymocyte subpopulations gave amplified products when the degenerate oligonucleotide mixtures PTKl and PTK2 were used as primers (data not shown), thus demonstrating the presence of amplifiable cDNA in each sample.

A Novel Receptor 1149

in Primitive Hematopoietic

Cells

way(s) of differentiation. An understanding of hematopoietic development will require homogeneous populationsof stem cells and the identification of molecules that govern self-renewal and commitment. Previously, we had established a purification strategy that yielded 509 to 1 OOO-fold enrichment of fetal liver totipotent hematopoietic stem cells. The present experiments represent the next logical step in the attempt to elucidate hematopoietic development. We used our enriched stem cell population to pursue the isolation of genes encoding molecular components of stem cell signal transduction pathways. Because our strategy is based solely on intragene family sequence homologies, the cloning of candidate molecules is independent of any prior knowledge of function. However, in choosing to target the pTK gene family we are supported by a wealth of evidence that indicates the importance of these molecules in development and cellular differentiation. This general strategy has led to the identification of a novel transmembrane receptor tyrosine kinase that shows closest similarity to subgroup III receptor pTKs, which includesc-kit, c-fms, and Pdgfralb (Ullrich and Schlessinger, 1990). A central role for receptor kinases in differentiation has been established in both vertebrate and invertebrate systems. In Drosophila, the genetically defined receptor tyrosine kinases, torso, f/b, and sevenless are all involved in cell differentiation or cell-cell communication (reviewed by Pawson and Bernstein, 1990). In mammals, c-fms is the receptor for colony-stimulating factor 1 (CSF-l), a factor required for proliferation and differentiation of monocytemacrophages (Sacca et al., 1988). The well-characterized murine developmental mutations W and Patch, both of which have pleiotropic effects on mouse development, have been shown to involve receptor pTKs. The murine W mutations are lesions in the c-kit gene (Chabot et al., 1988; Geissler et al., 1988; Tan et al., 1990; Nockaet al., 1990) and the Pdgffa gene is deleted in Patch mutant mice (Stephenson et al., 1991). We have demonstrated that flk-2 mRNA is expressed in populations enriched for primitive stem/progenitor cells. One such population defined as AA4+ Lin’” is 500- to 1 O O O fold enriched in totipotent stem cell activity (Jordan et al., 1990). Expression of flk-2 is also evident in AA4+ Sea+ and in AA4+ Sea+ Linb cells. This latter population is likely to represent the most highly enriched stem cells. In vivo engraftment experiments, currently in progress, will directly address this issue. Expression is also observed in AA4+ Lin& and AA4+ Sea-. These populations, while depleted of long-term repopulating cells, nonetheless contain multipotential progenitors. It has been suggested that these progenitors are the products of commitment decisions occurring early in the proliferation of the totipotent cell (Ogawa et al., 1983). Indeed, replating studies have demonstrated that multipotential progenitor cells are endowed with significant self-renewal potential (Pharr and Ogawa, 1988). Preliminary experiments suggest that flk-2 is expressed in individual multipotential CFU-Blast colonies capable of generating numerous multilineage colonies upon replating (I. Ft. L. et al., unpublished data). It is likely, therefore, that flk-2 is ex-

!=l.m!d c.fms

. -

c-kit *

flk-2

II f$ SCA+

CSF-1 KL(SCF) ?

l-I AA4 + L~~lo/hi

AAC

SCA+‘-

Figure 7. Multiple Receptor Tyrosine Kinases Are Expressed ous Stages of Hematopoietic Development

at Vari-

Several distinct compartments of the hematopoietic hierarchy are shown with respect to expression of three tyrosine kinase receptors. On the left is the totipotent hematopoietic stem cell (THSC). These cells clonally expand (designated by the stippled triangle) into populations of committed stem and progenitor cells that can be assayed in vitro. Primitive cells such as the CFU-S, or thymocyte precursor, represent cellular populations that overlap with in vitro progenitor populations, such as CFU-Blast and CFU-GEMM. This in indicated by intersecting circles. The early progenitors further expand to yield larger populations of more mature progenitors such as the CFU-E and CFU-Mast. As this hematopoietic hierarchy progresses, the cellular entities are characterized by a decreasing ability to self-renew (designated by circular arrows). The suggested antigenic features of the various cell populations are indicated below each compartment. The expression patterns of c-fms. c-kit, and flk-2 are shown above the hierarchy (dashed lines indicate where expression is undetermined). The expression of c-fms is well established in myeloid-macrophage lineages; however, we do not mean to imply that it is expressed in CFU-E.

pressed in the entire primitive (i.e., self-renewing) portion of the hematopoietic hierarchy. A further speculation would be that flk-2 may be important in transducing putative self-renewal signals from the environment. Of particular interest is the expression of flk-2 mRNA in the most primitive thymocyte subset. Strikingly, even in two closely linked immature subsets, differing in expression of the IL-2 receptor, flk-2 expression segregates to the more primitive IL-2 receptor-negative population. It has been suggested that the earliest thymocyte subset is uncommitted (Butcher and Weissman, 1989), and therefore the flk-e-expressing thymocytes may be multipotential. To our knowledge this is the first receptor tyrosine kinase known to be expressed in the T-lymphoid lineage. Thus, the flk-2 receptor may begin to define a previously unknown mode of cell proliferation in early thymocyte development. The expression patterns of three receptor pTKs in various compartments of the hematopoietic hierarchy are shown in Figure 7. c-kit is expressed in primitive cells and in more mature progenitors of at least two lineages (CFU-E and CFU-Mast; Nocka et al., 1990). The CSF-1 receptor, c-fms, appears to be confined to more mature myeloid progenitors. In contrast, flk-2 appears to be expressed only in primitive cells. It seems likely, therefore, that at least

Cdl 1150

two receptor tyrosine kinases play important and possibly very different roles in primitive hematopoietic stemlprogenitor cells. Taken together, the data suggest that flk-2 is a receptor present on the surface of the most primitive hematopoietic stem cell. Given the transmembrane nature of flk-2 we should be able to generate antibodies reactive with intact cells. These, used in combination with genetic marking and in vivo engraftment into irradiated hosts, will directly demonstrate if this molecule is indeed expressed on the surface of hematopoietic stem cells. If flk-2 is expressed in totipotent stem cells, then the identification of its ligand may provide a means to expand these cells in culture. Clearly this has profound implications for hematopoietic developmental biology as well as clinical transplantation therapy. Experimental

Procedures

Antibodies and Cell Purification Midgestation fetal liver cells from C3HIHeJ or C57BU6 mice were fractionated into AA4.1 positive and negative subsets as described previously (McKearn et al., 1985). The AA4- fraction was depleted of residual AA4’ cells by two additional cycles of “immune-panning” (Wysocki and Sato, 1978). The Lin cocktail contains the following antibodies: GFl, RA682, 14.8, RB8C5, and Mac1 AA4+ Linb’ and AA4+ Lin” subpopulations were obtained exactly as described (Jordan et al., 1990). The AA4’cells were fractionated into Sca’and Sea- subpopulations using the El3 161-17 monoclonal antibody (Aihara et al., 1986), with a phycoerythrinconjugated goat anti-rat secondary antibody (Biomeda). Stained cells were separated on an Epics 753 flow cytometer (Coulter Electronics, Hialeah, Florida). Generally, 20%30% of AA4’ cells were designated Lin”, and 70%-80% were Lir?‘. Sea’ and Scam cells represented 20% and 80%, respectively, in the AA4’ population. Thymocyte subsets were purified as follows. CD4+8-, CD4+8’, CD4-8’ isolation: Thymocytes from C57BU6 mice were stained with fluorescein isothiocyanate (FITC)-labeled 5.3-6.7 (rat anti-mouse CD8, Beckton-Dickinson). followed by biotinylated H129.19 (rat anti-mouse CD4, Pierres et al., 1984). followed by phycoerythrin-labeled avidin (Caltag). Cells were sorted using a single laser excitation on a BectonDickinson Facstar-Plus. CD4-8- isolation: Thymocytes from C57BU6 mice were treated with the IgM MAbs RL172 (rat anti-CD4, Ceredig et al., 1985) and 3-155 (rat anti-CD8, Sarmiento et al., 1980) plus complement aspreviouslydescribed (Levitskyet al., 1991). ForCDCBsubsets, IL-2R+CD4-8. and IL-2R-CD4-8- subsets were separated by staining CD4-8. cells with FITC-labeled 7D4 (rat anti-mouse IL-2R antibody, Malek et al., 1983) and sorted as above. For separation of the Thy-i’ and Thy-l”’ subsets, CD4-8. thymocytes were stained with 30H12 (rat anti-mouse Thy-l .2; Ledbetter and Herzenberg, 1979). RNA Isolations and cDNA Synthesis Because of the sensitivity of the PCR, RNA and cDNA procedures were performed in a separate room. All reagents and supplies were designated specifically for this purpose. Total RNAs were obtained from purified cells exactly as described (Belyavsky et al., 1989). In some cases small-scale poly(A) selection was performed (Van De Rijn et al., 1989). Synthesis and purification of cDNA for the initial cloning were done according to a published protocol (Belyavsky et al., 1989) using avian myeloblastosis reverse transcriptase (Promega). All cDNAs were primed at the mRNA poly(A) tail. Purified cDNAs were amplified using the PTKl and PTKP degenerate primers (Wilks, 1989), Perkin-Elmer Cetus reagents, and a Perkin-Elmer Thermal cycler. The cycling parameters were 95OC for 1.5 min, 37OC for 2.0 min, and 63OC for 3.0 min. In general, 50 to 60 cycles of amplification with the addition of fresh primers and other components at midpoint were carried out. Amplified products were analyzed on 8% polyacrylamide gels. Preparative electrophoretic iSolation of the predicted 210 bp kinase-specific fragmentwasalsobypolyactylamideelectrophoresis. Fragmentswere eluted by agitation at 37°C for several hours to overnight. Ethanolprecipitated fragments were ligated into pGem vectors (Promega)

through EcoRl and BamHl sites incorporated into the oligonucleotides (Wilks, 1989) or by blunt ligation. All restriction and modifying enzymes were purchased (except where noted) from New England Biolabs or Boehringer Mannheim. All cloning and analytical procedures were carried out according to standard protocols (Maniatis et al., 1982 or Ausubel et al., 1987) and reagent manufacturers instructions. Modifications to existing protocols are described. In some cases the PCR products were blunted with DNA polymerase I Klenow fragment. Bacterial transformants were screened for the presence of the appropriately sized insert, Random clones were chosen and sequenced (US6 Sequenase kit) using T7 and Sp6 primers. Sequences were compared with the GenBank data base. Individual clones corresponding to known kinases were pooled and used as probes for screening a much larger collection of clones. Low versus high stringency differential hybridizations were performed on several hundred to one thousand transformants. The criterion for encoding potentially novel kinase cDNAs was hybridization at low stringency and disappearance of signal after a high stringency wash. Sequence analysis of one such clone confirmed its membership in the kinase family by the presence of internal conserved amino acid motifs (see Results). A data base search did not show identity to any previously isolated kinase sequences. Double-Stranded cDNA Synthesis and Library Construction and Screening An initial cDNA clone (see Results) was obtained by screening a gtl0 whole embryo cDNA library (a gift of Dr. Craig Hauser, La Jolla Cancer Research Foundation) using the 210 bp flk-2 PCR fragment as a probe. Fetal liver AA4’ cells were obtained from a large number (approximately 100) day 14 fetuses. RNA from these cells was purified by theguanidinium-thiocyanate-CsCI gradient method. Poly(A)t RNAwas obtained by standard column protocols. A Notl site oligo(dT) primer (Promega) was used in conjunction with the Moloney murine leukemia virus superscript reverse transcriptase (Bethesda Research Laboratories) as follows: the template mRNA together with primer (200 ng) was denatured in methyl-mercury hydroxide (20 mM) for 10 min at room temperature in a volume of 20 ~1. Denaturation was stopped by the addition of 2-mercaptoethanol to 34 mM. Additional reaction components were added according to the Bethesda Research Laboratories protocol to a final volume of 40 ~1. Superscript (400 U) was added, and the reaction was incubated at 37OC for 1 hr. Second strand synthesis was performed using the RNAase H method (Gubler and Hoffman, 1983, superscript protocol). The reaction (0.3 ml final volume) proceeded for 20 hr at 14’C. Appropriate amounts of enzymes and incubation conditions were calculated based on pilot reactions. T4 DNA polymerase was not included. Both first and second strand syntheses were monitored by alkaline-agarose gel electrophoresis of [32]phosphorus-labeled pilot reactions incubated in parallel with the preparative samples. Following extraction and precipitation the cDNA was phosphorylated with T4-polynucleotide kinase and ligated to EcoRI-Xmnl adaptors (NEB) overnight at 15°C using T4 DNA ligase in a volume of 100 ~1. As with the cDNA synthesis the adaptor ligations were carried out on a pilot scale using labeled adaptors. The adaptormodified cDNAs were digested with an excess of Notl and size fractionated on potassium acetate gradients as described (Maniatis et al.. 1982). Fractionated cDNA contained labeled tracer (label in adaptor). Gradient fractions were analyzed on alkaline-agarose gels. Two pools averaging 3.5 kb and 2 kb were collected and precipitated. Aliquots of each were ligated into gtll Sfi-Not (Promega) and packaged using Stratagene Giga-pack gold extracts. Unamplified phage were plated on strain Y1090 (Stratagene) and screened with a probe encompassing most of the catalytic domain-encoding sequences. One cDNA clone encompassing amino acid positions 779 to 992 (see Figure 2) and extending to the 3’ end of the mRNA was isolated. Anchored PCR Antisense oligonucleotides corresponding to nucleotide positions 864 to 846 and 1911 to 1893 (see Figure 2) were used as gene-specific primers in anchored PCR to extend the cloned cDNA in the B’direction (Frohman et al., 1988). The nonspecific 5’anchor oligonucleotide was the longer (16-mer) strand of the EcoRI-Xmml adaptor (NEB). Template for the amplification was the RI-adaptor ligated cDNA aliquots of both size selected pools, described above. Cycling parameters were usually 30 s at 94OC, l-2 min at 55OC, and 4 min at 72OC for a total

A Novel Receptor 1151

in Primitive Hematopoietic

Cells

of 3540 cycles. A portion of the product was electrophoresed and analyzed by Southern blot. The sizes of the largest hybridizing products were noted and DNAfragments of similar size were gel purified as described (Vogelstein and Gillespie, 1979) and cloned into PGem7Zf+ (Promega). Clones were screened by hybridization. Positive recombinants were analyzed for insert size and orientation by PCR using the gene-specific primer and either the Sp6 or T7 flanking plasmid primer. Adistribution of clones representing progressively longer S’extensions was obtained. Representative members of this nested set of “deletions” were sequenced and a preliminary contiguous sequence of 2669 bp was obtained. This sequence was used to design further oligonucleotides (see list and positions of all oligonucleotides used in the following section). One antisense oligonucleotide located at positions corresponding to amino acids 278 to 272 and located approximately 170 bp internal to the longest clone was used in a subsequent anchored PCR amplification. In this case, hybridization revealed a discrete band of approximately 600 bp (several other smaller fragments were also da tected). The largest hybridizing fragment was cloned into the plasmid pSport (Bethesda Research Laboratories). Five individual clones corresponding in size to this fragment were further analyzed and sequenced. Colinearity of all overlapping clones was demonstrated as follows: nested oligonucleotide pairs at positions 156 sense (s) and 2343 antisense (as), 156 (s) and 2144 (as), 1505 (s) and 2935 (as), and 1752 (s) and 2935 (as) (as well as others), all yielded fragments of the predicted sizes in amplifications. DNA Sequencing All sequences were obtained by the chain termination method @anger et al., 1977) using the Sequenase Version II kit (US Biochemicals) and protocol, occasionally substituted with T7 DNA polymerase (Pharmacia). The following primers were used to sequence the flk-2 cDNA: In the sense direction beginning at nucleotide number 158; 212; 525; 836; 1266; 1505; 1752; 2184; 2506; 2844; 3046. In the antisense direction beginning at nucleotide number 391; 441; 542; 664; 1413; 1666; 2133; 2305; 2665; 2935. All primers were 18 bases in length. Sequences obtained from individual clones were confirmed by direct sequencing of PCR fragments obtained from the uncloned AA4+ cDNA population using standard cycling parameters. Gel-purified DNA fragments were used to generate complementary single-stranded templates by asymmetric PCR (see lnnis et al., 1990). The gel systems generally used were 6% Sequagel with sodium acetate gradients (National Diagnostics) or 5% Long-Ranger (AT Biochem.). The radioactive label was [“jsulphur deoxyadenosine. Sequences were analyzed using the Genetics Computer Group software package (Devereux et al., 1984). One hundred percent of coding region sequence was confirmed on both strands. Expression Analysis Fetal (day 14) or adult tissue RNA from C3HIHeJ mice was purified by the guanidinium-isothiocyanate protocol followed by cesium chloride centrifugation. Generally, 20 pg of total RNA was fractionated on formaldehyde-agarose gels and transferred to nylon membranes (Zeta Bind, AMF-Cuno). Amounts of RNA loaded per lane were normalized by the intensities of the ethidium bromide-stained 285 and 18s ribosomal RNA bands. Cross-linking, probing, hybridization, and autoradiography were carried out as described (Jordan et al., 1990). The probe fragment encompassed amino acid positions 635 to 695. Mouse testis RNA was the kind gift of Dr. Stephen Pilder (DNX Corporation, Princeton, New Jersey). For PCR analysis of RNA transcripts, a previously described protocol (Belyavsky et al., 1989) was used for cDNA synthesis. Approximate starting cell numbers ranged from 40,000 to 100,000. Oligonucleotide primers were designed specifically against the kinase insert domain of flk-2 and correspond to nucleotide positions 2164 to 2184 (sense strand) and 2287 to 2305 (antisense strand). Amplifications were carried out on cDNA samples representing approximately equivalent cell numbers (in general 1000). Cycling parameters were 30 sat 94OC, 1 min at 50°C and 2 min at 72°C for 50 cycles. Each experiment included a negative control sample containing all components except template. In general, amplification reactions were assembled under a laminar flow hood using positive displacement pipettes. In experiments involving Sea+ and Sea- cells as well as thymocyte subsets the RNA samples were further selected with oligo(dT) cellu-

lose. cDNA was synthesized with superscript reverse transcriptase (Bethesda Research Laboratories) and purified as described above. Amplifications were performed as described above. Acknowledgments We wish to thank Drs. Jean Schwarzbauer. Thomas Shenk, and Philip Sharp for critical comments on the manuscript. We also gratefully acknowledge Jerome Zawadzki for expert flow cytometry and Mark Flocco for excellent oligonucleotide production. The patient and expert assistance of Bernice Sikorski and Diane Vail in preparing the manuscript is greatly appreciated. We also gratefully acknowledge the help of Andrea Sirak and Marc Gavin in the initial stages of this work. The work was supported by National Institutes of Health grants CA45339 and DK42Q89. William Matthews is the recipient of a postdoctoral fellowship from NIH. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked ‘advertisement” in accordance with 16 USC Section 1734 solely to indicate this fact. Received April 10, 1991 References Aihara, Y., Buhring, H. J., Aihara, M., and Klein, J. (1986). An attempt to produce ‘pm-T” cell hybridomas and to identify their antigens. Eur. J. Immunol. 76, 1391-1399. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Smith, J. A., Seidman, J. G., and Struhl, K. (1967). Current Protocols in Molecular Biology (New York: Wiley and Sons). Belyavsky, A., Vinogradova, T., and Rajewsky, K. (1989). PCR-based cDNA library construction: general cDNA libraries at the level of a few cells. Nucl. Acids Res. 17, 2919-2932. Boggs, D. R., Boggs, S. S.. Saxe, D. F., Gress, L. A., and Canfield. D. R. (1982). Hematopoieticstem cellswith high proliferative potential. Assay of their concentration in marrow by the frequency and duration of cure of W m mice. J. Clin. Invest. 70, 242-252. Butcher, E. C., and Weissman, I. L. (1989). Lymphoid tissues and organs. Fundamental Immunology, 2nd Edition, W. E. Paul, ed. (New York: Raven Press). Cantley, L. C., Auger, K. R., Carpenter, C.. Duckworth, B., Graziani, A., Kapeller, R., and Soltoff, S. (1991). Oncogenes and signal transduction. Cell 64, 281302. Ceredig. R., Lowenthal, J., Nabholr, M., and MacDonald, R. (1985). Expression of interleukin-2 receptors as a differentiation marker on intrathymic stem cells. Nature 314, 89-102. Chabot, B., Stephenson, D. A., Chapman, V. M., Besmer. P., and Bernstein, A. (1988). The proto-oncogene c-kit encoding a transmembrane tyrosine kinase receptor maps to the mouse W locus. Nature 335.88-89. Devereux, J., Haeberlin, P., and Smithies, 0. (1984). Acomprehensive set of sequence analysis programs for the VAX. Nucl. Acids Res. 12, 387-395. Dexter, T. M., and Spooncer, E. (1987). Growth and differentiation the hematopoietic system. Annu. Rev. Cell Biol. 3, 423-441.

in

Fowlkes, B. J., and Pardoll, D. M. (1989). Molecular and cellular events of T cell development. Adv. Immunol. 44207-264. Frohman, M. A., Dush, M. K., and Martin, 0. R. (lQ88). Rapid production of full-length cDNAs from rare transcripts: amplification using a singlegene-specificoligonucleotide primer. Proc. Natl. Acad. Sci. USA 85, 8998-9002. Geissler, E. N.. Ryan, M. A., and Housman, D. E. (1988). The dominant-white spotting (w) locus of the mouse encodes the c-&it proto-oncogene. Cell 55, 185-192. Gubler, U., and Hoffman, B. J. (1983). A simple and very efficient method for generating cDNA libraries. Gene 25, 263-268. Hanks, S. K., Quinn, A. M., and Hunter, T. (1988). The protein kinase family conserved features and deduced phylogeny of the catalytic do mains. Science 241, 42-52.

Cell 1152

Harrison, D. E.,Astle, C. M., and Lerner. C. (1988). Numberand continuous proliferative pattern of transplanted primitive immunohematopoietic stem cells. Proc. Natl. Acad. Sci. USA 85, 822-828.

Sanger, F., Niklen, S., and Coulson, A. Ft. (1977). DNA sequencrng with chain terminating inhibitors. Proc. Natl. Acad. SCI. USA 74,54635487.

Ikuta, K., Kina, T.. MacNeil, I., Uchida, N., Peault, 8.. Chien, Y., and Weissman, I. L. (1990). A developmental switch in thymic lymphocyte maturation potential occurs at the level of hematopoietic stem cells. Cell 62. 883-874.

Sarmiento, M., Glasebrook, A., and Fitch, monoclonal antibodies reactive with different lecular complex bearing Lyt-2 antigen block in the absence of complement. J. Immunol.

Innis, M. A., Gelfand, D. H.. Sninsky, J. J., and White, T. J. (1990). PCR Protocols: A Guide to Methods and Applications (San Diego: Academic Press).

Spangrude. G. J.. Heimfeld, S., and Weissman, tion and characteristics of mouse hematopioetic 241, 58-62.

Johnson, G. Ft., and Nicola, N. A. (1984). Characterization of two populations of CFU-S fractionated from mouse fetal liver by fluorescence activated cell sorting. J. Cell. Physiol. 718, 45-52.

Stephenson, D. A., Mercola, M., Anderson, E., Wang, C., Stiles, C. D., Bowen-Pope, D. F., andchapman, V. M. (1991). Platelet-derived growth factor receptor-subunit gene (Pdgfra) is deleted in the mouse patch (Ph) mutation. Proc. Natl. Acad. Sci. USA 88, 6-10.

Jordan, C. T., McKearn, J. P.. and Lemischka, I. R. (1990). Cellular and developmental properties of fetal hematopoietic stem cells. Cell 61, 953-983. Kozak, M. (1988). Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44, 283-292. Ledbetter, J. A., and Herzenberg, L. A. (1979). Xenogeneic monoclonal antibodies to mouse lymphoid differentiations antigens. Immunol. Rev. 47, 63-90. Levitsky, H. I., Golumbek, P. T., and Pardoll, D. M. (1991). The fate of CD4-8. T cell receptor ab’ thymocytes. J. Immunol. 746, 1113-l 117. Malek, T. R., Robb. R. J., and Shevach, E. M. (1983). Identification and initial characterization of a rat monoclonal antibody reactive with the murine interleukin 2 receptor-ligand complex. Proc. Natl. Acad. Sci. USA 80, 5894-5698. Maniatis, T., Fritsch, E. F., and Sambrook. J. (1982). Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, New York: Cold Spring Harbor Press). McKearn, J. P., McCubrey, J., and Fagg, B. (1985). Enrichment of the hematopoietic precursor cells and cloning of multipotential B-lymphocyte precursors. Proc. Natl. Acad. Sci. USA 82, 7414-7418. Metcalf, D. (1984). The Hematopoietic (New York: Elsevier).

Colony Stimulating

Factors

Nocka, K., Majumder, S.. Chabot, B., Ray, P., Cervone, M.. Bernstein, A., and Besmer, P. (1990). Expression of c-/&gene products in known cellular targets of W mutations in normal and W mutant mice-evidence for an impaired c-kit kinase in mutant mice. Genes Dev. 3,816826. Ogawa, M., Porter, P. N., and Nakahata, T. (1983). Renewal and commitment to differentiation of hematopoietic stem cells; an interpretive review. Blood 61, 823-829. Pawson, T., and Bernstein, A. (1990). Receptor tyrosine kinases, genetic evidence for their role in Drosophila and mouse development. Trends Genet. 6, 350-358. Pharr, P. N., and Ogawa, M. (1988). Fetal liver blast cell colonies-a source of erythroid progenitors. Exp. Hematol. 76. 748-751. Pierres, A., Naquet, P., Van-Agthaven, A., Bekklouche, F., Denizot, F., Mishal, Z., Schmitt-Verhuist, A. M., and Pierre% M. (1984). A rat anti-mouseT4monoclonal antibody(H129.19)inhibits the proliferation of la-reactive T cell clones and delineates two phenotypically distinct (T4+, Lyt-23, and T4-, Lyt-2,3+) subsets among anti-la cytolytic T cell clones. J. Immunol. 732, 2775-2781. Ploemacher, R. E., and Brons, R. H. C. (1989). Separation of CFU-S from primitive cells responsible for reconstitution of the bone marrow hematopoietic stem cell compartment following irradiation-evidence for a pre CFU-S cell. Exp. Hematol. 77, 263-266. Rosnet, O., Mattei, M. G., Marchetto, S., and Birnbaum, D. (1991). Isolation and chromosomal localization of a novel fms-like tyrosine kinase gene. Genomics 9. 380-385. Russell, E. S. (1979). Hereditary anemias of the mouse, a review for geneticists. Adv. Genet. 20, 257-459. Sacca, R., Stanley, E. R., Sherr, C. J., and Rettenmier, C. W. (1986). Specific binding of the mononuclear phagocyte colony-stimulating factor CSF-1 to the product of the v-fms oncogene. Proc. Natl. Acad. Sci. USA 83, 3331-3335.

F. W. (1980). IgG or IgM determinants on the moT cell-mediated cytolysis 125, 2885-2877. I. L. (1988). Purificastem cells. Science

Szilvassy. S. J., Lansdorp. P. M., Humphries, R. K., Eaves, A. C., and Eaves, C. J. (1989). Isolation in a single step of a highly enriched murine hematopoietic stem cell population with competitive long-term repopulating ability. Blood 74, 930-939. Tan, J. C., Nocka, K., Ray, P., Traktman, P.. and Besmer. P. (1990). The dominant W4* spotting phenotype results from a missense mutation in the c-kit receptor kinase. Science 247, 209-212. Ullrich, A., and Schlessinger, J. (1990). Signal transduction tors with tyrosine kinase activity. Cell 61, 203-212.

by recep-

Van De Rijn, M. V., Heimfeld. S.. Spangrude, G. J., and Weissman, I. L. (1989). Mouse hematopoietic stem cell antigen Sea-1 is a member of the Ly-6 antigen family. Proc. Natl. Acad. Sci. USA 86, 4634-4638. Visser, J. W. M., Bauman, J. G. J.. Mulder, A. H.. Eliason, J. F., and DeLeeuw, A. M. (1984). Isolation of murine pluripotent hematopoietic stem cells. J. Exp. Med. 59, 1576-1590. Vogelstein, B., and Gillespie, D. (1979). Preparative and analytical purification of DNA from agarose. Proc. Natl. Acad. Sci. USA 76, 815619. Von Heijne, G. (1983). Patterns of amino acids near signal-sequence cleavage sites. Eur. J. Biochem. 733, 17-21. Watson, M. E. E. (1984). Compilation Nucl. Acids Res. 12, 5145-5164.

of published signal sequences.

Wilks, A. F. (1989). Two putative protein-tyrosine kinases identified by application of the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 86. 1603-l 607. Williams, A. F., and Barclay, A. N. (1988). The immunoglobulin super family-domains for cell surface recognition. Annu. Rev. Immunol. 6, 381-405. Witte. 0. N. (1990). Steel locus defines new multipotent Cell 63, 5-6.

growth factor.

Wysocki, L. J., and Sato, V. L. (1978). Panning for lymphocytes, a method for cell selection. Proc. Natl. Acad. Sci. USA 75, 2844-2848. Yarden, Y.. Escobedo, J. A.. Kuang, W. J., Yang-Feng. T. L.. Daniel, T. O., Tremble, P. M., Chen, E. Y., Ando, M. E., Harkins, R. N., Francke, U., Fried, V. A., Ullrich. A., and Williams, L. T. (1986). Structure of the receptor for platelet-derived growth factor helps define a family of closely related growth factor receptors. Nature 323,226-232. GenBank

Accession

The accession M84689.

Number

number

for the sequence

reported

in this paper is