- Email: [email protected]
A recombinant envelope protein vaccine against West Nile virus
Vaccine 23 (2005) 3915–3924
A recombinant envelope protein vaccine against West Nile virus Michel Ledizet a,∗ , Kalipada Kar a , Harald G. Foellmer b , Tian Wang b , Sandra L. Bushmich c , John F. Anderson d , Erol Fikrig b , Raymond A. Koski a a L2 Diagnostics, LLC, 300 George Street, New Haven, CT 06511, USA Yale University School of Medicine, Section of Rheumatology, Box 208031, New Haven, CT 06520, USA University of Connecticut, Department of Pathobiology, 61 North Eagleville Road, Unit 3089, Storrs, CT 06269-3089, USA d Connecticut Agricultural Experiment Station, 123 Huntington Street, New Haven, CT 06504, USA b
c
Received 15 November 2004; received in revised form 25 February 2005; accepted 3 March 2005 Available online 6 April 2005
Abstract West Nile (WN) virus is a flavivirus that first appeared in North America in 1999. Since then, more than 600 human deaths and 22,000 equine infections have been attributed to the virus in the United States. We expressed a truncated form of WN virus envelope (E) protein in Drosophila S2 cells. This soluble recombinant E protein was recognized by antibodies from naturally infected horses, indicating that it contains native epitopes. Mice and horses produced high-titer antibodies when immunized with recombinant E protein combined with aluminum hydroxide. Immunized mice were resistant to challenge with a lethal viral dose. Sera from immunized horses, administered to na¨ıve mice, conferred resistance against a lethal WN viral challenge. In addition, sera of immunized horses neutralized West Nile virus in vitro, as demonstrated by plaque reduction assays. This recombinant form of E protein, combined with aluminum hydroxide, is a candidate vaccine that may protect humans and horses against WN virus infections. © 2005 Elsevier Ltd. All rights reserved. Keywords: West Nile virus; Vaccine; Envelope protein
1. Introduction West Nile (WN) virus, a member of the Flaviviridae family, was first identified in 1937 in Uganda [1,2]. WN virus primarily infects birds, but also horses and humans. Most human WN virus infections are unrecognised, only 20% of infected patients develop a mild febrile illness called West Nile fever [3,4]. Approximately one patient in 150 develops life-threatening meningoencephalitis. Following its introduction to North America in 1999, WN virus has caused more than 600 human deaths in the United States, and 22,000 equine cases. Fatality rate in unvaccinated horses is approximately 30% (reviewed in [5]). There is currently no specific therapy against WN virus. Recent anecdotal reports documented a clinical benefit from administering human immunoglobulins from donors living ∗
Corresponding author. Tel.: +1 203 503 0383; fax: +1 203 503 0384. E-mail address: [email protected] (M. Ledizet).
0264-410X/$ – see front matter © 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.vaccine.2005.03.006
in areas endemic for WN virus [6,7]. Clinical trials are now underway to evaluate this treatment in a larger patient population. Several groups are developing vaccines against WN virus. Two veterinary vaccines are now approved for use in the United States. One, manufactured by Fort Dodge Animal Health, consists of a killed virus preparation [8]. The other, a recombinant canarypox virus, is marketed by Merial [9]. Other vaccine development strategies are based on naked plasmid DNA, attenuated WN strains, non-infectious RNA vaccines and chimeric viruses [10–19]. A recent review presents the various strategies followed to develop vaccines against WN virus and other flaviviruses [20]. Our efforts are focused on developing a recombinant subunit vaccine against WN virus, using the viral envelope (E) protein as a target antigen [21]. Previous studies with flaviviruses have shown that most virus-neutralizing antibodies are directed against viral E proteins [1]. Antibodies against the structural M protein and the non-structural NS-1 protein may also
3916
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
provide protection to the animal host. We have previously demonstrated that immunization with recombinant WN virus envelope protein produced in bacteria protects mice against lethal WN infection [21]. It has been shown that truncated envelope protein from dengue virus, when expressed in Drosophila S2 cells, folds into a conformation resembling that of native envelope protein [22]. Here we show the results of experiments with a truncated form of WN virus envelope protein produced in Drosophila S2 cells. Mice vaccinated with this antigen were protected against a lethal challenge with WN virus. Vaccination of horses elicited neutralizing antibodies. The antigen was immunogenic when administered with aluminum hydroxide, the only adjuvant currently approved for human use. We propose that this form of truncated E protein is a candidate antigen for further development as equine and human vaccines to protect against WN virus infection.
2.2. Production and purification of recombinant E proteins
2. Materials and methods
2.3. Immunization of animals with rWNV-ET
2.1. Expression of rWNV-ET in Drosophila cells
Four to five-week-old C57Bl/6 mice were immunized intraperitoneally with 20 g of rWNV-ET adsorbed to Alhydrogel adjuvant (Accurate) at a ratio of 1 g protein/l of 1.3% aluminum hydroxide suspension. Alternatively, mice were immunized intraperitoneally with 20 g of rWNV-ET in 100 l complete Freund’s adjuvant. The mice were boosted 3 weeks later by intraperitoneal injection of 20 g of rWNV-ET bound to aluminum hydroxide or with Freund’s incomplete adjuvant. Control mice received injections of an equivalent amount of Alhydrogel adjuvant. Mice were challenged 2 weeks after the booster injection as described in Section 2.6. For this study, we selected horses of different breeds, ages, and gender, without a documented history of WN virus vaccination or infection. Serum samples were collected prior to the first injection, and analyzed for antibodies recognizing WN virus E or NS-5 proteins. These antibodies were detected by ELISA or by using a previously described fluorescent microsphere immunoassay [25,26]. Horses with antibodies against WN virus E or NS-5 proteins were presumably previously exposed to viral antigens and were excluded from this study. Horses were immunized intramuscularly with 50 or 100 g of rWNV-ET adsorbed to aluminum hydroxide at a ratio of 1 g protein/l of 1.3% aluminum hydroxide suspension. Thus, each vaccine dose contained 0.34 or 0.68 mg of elemental aluminum. FDA regulations limit the aluminum content of human vaccines to 0.85 mg per dose. A second identical injection was administered 25 days later. Horses were examined for signs of adverse reactions for several hours following each injection. The injections appeared to be safe and well tolerated. Horses were maintained on pasture or in barns. Anti-E protein antibody titers only increased following immunizations, thus ruling out natural exposure to WN virus. Horses were tested multiple times throughout the study for anti-NS5
The isolation of WN virus strain 2741 was previously described [23,24]. The DNA encoding amino acids 1–406 of WN envelope protein was amplified by PCR from strain 2741 viral cDNA using the primers AAAAAGATCTTTCAACTGCCTTGGAATGAGC and AAAATCTAGATTATTTGCCAATGCTGCTTCC. The PCR product was purified, digested with XbaI and BglII and ligated into the corresponding restriction sites of plasmid pMTBiP/V5-HisA (Invitrogen). The recombinant plasmid directs the synthesis of a fusion protein consisting of the 18-amino acid Drosophila BiP secretory signal sequence, two amino acids encoded by the multiple cloning site, followed by residues 1–406 of WN virus E protein. The secreted recombinant protein, after removal of the signal sequence, was named rWNV-ET . E protein codon 406 is immediately followed by a stop codon, and therefore, rWNV-ET does not contain the V5 epitope or polyhistidine tag encoded by the plasmid vector. The recombinant expression plasmid and a hygromycinresistance plasmid, pCoHygro, were co-transfected into Drosophila S2 cells by the calcium phosphate procedure as recommended by the manufacturer of the Drosophila Expression System kit (Invitrogen). Transfected S2 cells were grown at room temperature (20–25 ◦ C) in Schneider’s Drosophila medium (Invitrogen) supplemented with 10% fetal calf serum, penicillin, streptomycin, and fungizone. Stably transfected cells were selected with hygromycin over several weeks and then transferred to Drosophila Serum-Free Medium (Invitrogen) supplemented with 4 mM l-glutamine, penicillin, streptomycin, and fungizone. Cells were passaged every week in serum-free medium for over a year. No decrease in cell viability or yield of recombinant protein was noted during that time.
Cultured S2 cells expressing rWNV-ET were diluted 10-fold with fresh serum-free culture medium into 175 cm2 tissue culture flasks. After 6 days, CuSO4 was added to a final concentration of 500 M to induce synthesis of the recombinant protein. The cell culture supernatant was collected 7 days later. Recombinant rWNV-ET was purified from the cell culture supernatant by ion-exchange column chromatography with Sepharose Q-XL (Amersham) followed by size-exclusion chromatography. The fusion protein Maltose Binding Protein-E (MBP-E) was expressed in E. coli and purified as previously described [21]. Analysis of purified rWNV-ET by MALDI and electrospray mass spectrometry was performed by the W.M. Keck Foundation Biotechnology Resource Laboratory at Yale University. The same facility also performed a mass spectrometric analysis of tryptic fragments to identify rWNV-ET .
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
antibodies. All samples were found to be negative, further suggesting that WN viral infection did not occur (data not shown). Horse immunizations with Fort Dodge Animal Health InnovatorTM killed virus vaccine were performed as recommended [8]. Two identical injections were administered intramuscularly 30 days apart. 2.4. Detection of antibodies specific for rWNV-ET Ninety-six-well ELISA plates were coated with rWNVET in carbonate buffer at a concentration of 100 ng per well, and blocked with PBS containing 0.1% Tween-20 and 1% fat-free dry milk (PBS-TM). Mouse and horse antisera were applied after dilution in PBS-TM. After a 1-h incubation at room temperature, unbound proteins were removed by washing with PBS containing 0.1% Tween-20 (PBS-T). Alkaline phosphatase-conjugated goat anti-mouse IgG or anti-horse IgG (Sigma) was applied at a 1–3000 dilution. After a 1h incubation at room temperature, unbound proteins were removed by washing with PBS-T. Bound antibody was detected by incubation with the colorimetric substrate paranitrophenyl phosphate (pNPP, Sigma). The optical density at 405 nm was read on a 96-well plate reader (Multiskan LS, Labsystems). Positive control horse sera were included in each plate to standardize color development. This allowed comparison of results from plate to plate. All samples were analyzed in triplicate. To determine endpoint ELISA titers, sera were serially diluted and applied to the plate at two-fold dilutions ranging from 400 to 51,200. The endpoint titers represent the reciprocal of the highest dilution generating a significant signal over background. For the calculation of geometric means, endpoint titers of less than 400 and greater than 51,200 were assumed to be 200 and 102,400, respectively. 2.5. In vitro plaque reduction neutralization tests Plaque reduction neutralization tests were used to evaluate the ability of serum samples to inhibit WN virus replication in cultured Vero cells. Serum samples were heat-inactivated by incubation in a 56 ◦ C water bath for 30 min, and serially diluted in PBS with 0.5% gelatin (PBS-G). Samples were initially tested at 1:10, 1:20, and 1:40 dilutions, and were retested at higher dilutions if required. WN virus strain 2741 was diluted in PBS-G so that the final concentration was 100 plaque-forming units (pfu) per 75 l. Seventy-five microlitres of virus was mixed with 75 l of diluted serum at 37 ◦ C for 1 h and then inoculated onto confluent monolayers of Vero cells in 6-well tissue culture plates. The plates were incubated at 37 ◦ C for 1 h and were shaken every 15 min. Cells were then covered with a 1% agarose overlay containing 1 × minimal essential medium (Invitrogen). The cells were incubated for 4 days at 37 ◦ C in a humidified 5% CO2 -in-air mixture. A second agarose overlay containing 4% neutral red was added on day 4. Virus plaques were counted 12 h later. Serum titers
3917
that led to 80 and 95% reduction in viral plaque numbers (PRNT80 and PRNT95 ) were recorded. 2.6. Mouse passive immunization and West Nile viral challenge Four to five-week-old C57Bl/6 mice were used for these experiments. For passive immunization, each mouse was injected intraperitoneally with 65 l of horse serum diluted to 100 l with PBS. Twenty-four hour later, the mice were challenged with approximately 1000 pfu of WN virus isolate 2741 administered intraperitoneally. Morbidity and mortality were assessed twice daily for 21 days or longer. Mice vaccinated with rWNV-ET were challenged 2 weeks after the booster injection using the same challenge procedure.
3. Results 3.1. Production of a soluble, recombinant, truncated WN virus envelope protein (rWNV-ET ) in Drosophila S2 cells We previously demonstrated that immunization with a bacterially-expressed, truncated form of WN virus E protein protected mice against a lethal viral challenge [21]. The 87 kDa recombinant maltose binding protein (MBP)-E antigen used in that study consisted of amino acids 1–406 of WN virus envelope protein fused to the C-terminus of MBP. We were unable to separate the E protein antigen from its MBP fusion partner by protease cleavage (not shown). We, therefore, sought to express WN virus envelope protein antigens without a fusion partner or affinity purification tags in Drosophila S2 cells. Insect cells carry out various post-translational modifications, including glycosylation, on recombinant proteins. In addition, the secretion pathway in insect cells is similar to that of mammalian cells. As a result, antigens produced in insect cells may more closely resemble their mammalian native counterparts. We expressed the recombinant WN virus E protein in Drosophila S2 cells, using the Drosophila Expression System (Invitrogen). The coding sequence was placed in-frame with a BiP signal sequence, which directs the recombinant protein to the secretion pathway. In preliminary experiments, we found that the full-length E protein was not produced efficiently by Drosophila S2 cells (not shown). The C-terminal portion of WN E protein contains a highly hydrophobic region, which may interfere with production and secretion of the recombinant protein in the absence of the viral prM protein. We, therefore, chose to express a truncated version of WN virus E protein lacking this region. The recombinant protein, designated rWNV-ET , consists of the first 406 amino acids of WN virus E protein, with two non-native residues added to the N-terminus by the cloning procedures. Previous work on the envelope protein of Dengue virus type 4 showed that shorter truncated recombinant E proteins fail to adopt a native conformation [27]. Based on the three-dimensional structure of
3918
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
the homologous E proteins from the tick-borne encephalitis (TBE) and dengue viruses [22,28,29], rWNV-ET contains the first three structural domains of the envelope protein. The expected molecular weight of the mature, secreted rWNV-ET protein is 44,029 Da after removal of the BiP signal sequence. This predicted molecular weight does not take into account possible post-translational modifications. A stably transfected S2 cell line expressing rWNV-ET was adapted to growth in serum-free culture medium. Addition of CuSO4 to the culture medium induced the synthesis and secretion of recombinant rWNV-ET with an apparent molecular weight of 48 kDa by SDS-PAGE. This protein was recognized by an anti-E monoclonal antibody (PanBio InDx. Inc., Baltimore MD) raised against WN virus (not shown). Accumulation of rWNV-ET in the culture medium was maximal 6–8 days after addition of CuSO4 . rWNV-ET was purified from cell culture supernatants by column chromatography. Yields of purified protein ranged from 2 to 10 mg/l of serum-free culture medium. Fig. 1 shows a Coomassie blue-stained SDSPAGE electrophoretogram of purified rWNV-ET from four sequential preparations. No contaminating protein can be detected by Coomassie blue staining of 2.5 g of rWNV-ET samples, indicating that antigen purity was greater than 95%. Analysis of a rWNV-ET sample by MALDI mass spectrometry revealed a predominant species with a mass (m/z ratio) of 44,736 (not shown). More precise estimation of the mass of the protein was obtained by electrospray mass spectrometry (Fig. 2). This experiment revealed a small number of masses ranging from 44,235 to 45,160. The origin of the microheterogeneity is not known, and may represent varying
Fig. 1. SDS-PAGE analysis of purified rWNV-ET . Lanes A, B, C, and D contain 2.5 g rWNV-ET samples from four consecutive preparations stained with Coomassie blue. The positions of molecular weight markers (in kDa) are indicated on the left.
degrees of post-translational modification. The major species had a mass of 44,891, only 862 Da greater than the predicted molecular weight of rWNV-ET without post-translational modification. This result shows that rWNV-ET is not heavily glycosylated, a concern for proteins expressed in insect cells. To confirm the identity of the recombinant protein, an aliquot was hydrolyzed with trypsin and fragments were identified by MALDI mass spectrometry. This analysis,
Fig. 2. Electrospray mass spectrometry analysis of purified rWNV-ET . Shown is the spectrum obtained by transformation of the raw multiply charged ion spectrum onto a molecular scale. The masses of the major components are shown next to the corresponding peak.
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
performed by the Keck Center for Biotechnology at Yale University, positively identified 16 peptides, which together represent 154 amino acids or 38% of the expected amino acid sequence (not shown). Because only a fraction of all peptides can be recovered and analyzed by this method, this degree of coverage was sufficient to establish the identity of the recombinant protein. 3.2. rWNV-ET protein has a conformation resembling native WN virus E protein rWNV-ET produced in insect cells retains epitopes present in native WN virus envelope protein. ELISA assays showed that rWNV-ET was recognized by antibodies from eight WN virus convalescent horses (not shown), but not by sera from horses without exposure to WN virus. Fig. 3 shows the results of an immunoblot analysis of MBP-E and rWNV-ET with the serum of one horse previously infected with WN virus. Aliquots of rWNV-ET and MBP-E were separated by SDSPAGE and transferred to nitrocellulose. Antibodies from the convalescent horse bound to both recombinant proteins after reduction of disulfide bridges (lanes A and B), establishing that some native epitopes are present in both recombinant proteins. A clear difference was noted when non-reduced samples were analyzed. The 12 cysteines present in rWNVET are predicted to form six intramolecular disulfide bridges.
3919
Most of the non-reduced MBP-E was present as multimers, indicating a preponderance of intermolecular disulfide bonds (lane D). In contrast, non-reduced rWNV-ET had the mobility expected for a monomer, indicating that inappropriate disulfide bridges did not form (lane C). Furthermore, antibody binding was stronger to non-reduced rWNV-ET (compare lanes A and C, which contain equal amounts of protein). This observation suggests that intramolecular disulfide bonds help maintain native conformational epitopes, and that recombinant E protein produced in insect cells has a conformation that is closer to that of the native viral protein. It remains a possibility that rWNV-ET lacks some of the protective epitopes present in the native viral protein. 3.3. Mice vaccinated with rWNV-ET are protected against a lethal challenge with WN virus The immunoblotting results and other serological studies with rWNV-ET [25,26] suggested that immunization with rWNV-ET would elicit antibodies cross-reactive with native WN virus E protein during infection. To determine whether anti-rWNV-ET antibodies would be protective in vivo, we immunized mice with rWNV-ET and then challenged them with a lethal dose of WN virus. Mice were immunized with rWNV-ET together with either aluminum hydroxide or Freund’s adjuvant as described in the Section 2. Control mice received aluminum hydroxide without antigen. Two weeks after the second injection, the animals were challenged with a lethal dose of West Nile virus. Prior to the viral challenge, a serum sample was collected from each animal and IgG antibodies against rWNV-ET were detected by ELISA (Table 1). As expected, immunization with rWNV-ET induced antigenspecific antibodies. The mean anti-rWNV-ET antibody level was slightly higher in the animals that received the antigen with Freund’s adjuvant. There was a significant variability in the antibody levels elicited in individual animals in each treatment group, as evidenced by the wide range of observed values. Animals receiving rWNV-ET with aluminum hydroxide appeared to respond more uniformly to the antigen. Fig. 4 shows survival curves for the immunized mice after a challenge with 1000 plaque-forming units (pfu) of WN virus isolate 2741. The control non-immunized mice died within 11 days after infection. Survival at 26 days was 100% among animals vaccinated with rWNV-ET combined with aluminum Table 1 Immunization of mice with rWNV-ET
Fig. 3. Immunoblot analysis of recombinant WN virus envelope proteins. The proteins analyzed are purified rWNV-ET (lanes A and C) and MBPE (lanes B and D). Samples in lanes A and B were reduced by heating to 95 ◦ C for 5 minutes in sample buffer with 50 mM dithiothreitol prior to electrophoresis. Proteins were transferred to a nitrocellulose membrane and probed with antibodies from the serum of a WN virus convalescent horse. The molecular weights of MBP-E and rWNV-ET monomers are 87 and 45 kDa, respectively. The positions of molecular weight markers (in kDa) are indicated on the left.
Treatment group
ELISA optical density (mean ± S.D.)
Range
rWNV-ET with aluminum hydroxide rWNV-ET with Freund’s adjuvant Aluminum hydroxide alone
0.755 ± 0.367 1.144 ± 0.692 0.004 ± 0.005
0.310–1.322 0.213–2.278 0.000–0.012
Serum samples were collected 2 weeks after the second injection, at the time of viral challenge. Presence of antibodies against rWNV-ET was determined by ELISA at a 1:2000 serum dilution. All samples were analyzed in triplicate.
3920
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
Fig. 4. Survival of vaccinated mice after challenge with a lethal dose of WN virus. Groups of 10 mice were vaccinated with rWNV-ET with aluminum hydroxide () or with Freund’s adjuvant (). Control mice received aluminum hydroxide without antigen (䊉). Mice were challenged with 1000 pfu of West Nile virus isolate 2741, and were monitored daily for morbidity and mortality.
hydroxide, and 90% among animals receiving the antigen in Freund’s adjuvant. 3.4. Vaccination of horses with rWNV-ET induces neutralizing anti-WN virus antibodies The efficacy of rWNV-ET bound to aluminum hydroxide in our murine challenge model prompted us to test this vaccine formulation in horses. Twenty-two horses were
vaccinated either with a commercially available WN killed virus vaccine (Fort Dodge Animal Health InnovatorTM ), or with either 50 or 100 g rWNV-ET bound to aluminum hydroxide. All animals that had detectable antibodies against rWNV-ET or against WN virus NS-5 protein prior to the start of the study were excluded in order to avoid interference from previous vaccination or natural exposure to WN virus. Both groups of animals received two injections. Serum samples were collected 0, 25, 50, 120, 150, 190, and 250 days after the initial injection. We used three assays to analyze the equine antibody responses to vaccination. First, we measured the appearance of antibodies against the E protein, the major protective antigen in flaviviruses. Second, we determined an in vitro plaque reduction neutralization titer (PRNT80 and PRNT95 ) to measure WN virus neutralizing antibodies. Finally, we determined whether passive transfer of immunized horse serum to na¨ıve mice was protective against a lethal WN virus challenge. The presence of IgG antibodies against rWNV-ET protein was determined by ELISA. The endpoint titer calculated for each day 50 sample is shown in Table 2. Antibodies against the E protein were detected in all animals receiving rWNV-ET . The geometric mean endpoint titer was 10,159 for animals receiving two 50 g doses and 21,527 for animals receiving two 100 g doses. The geometric mean endpoint titer was 734 for horses receiving the commercial killed virus vaccine. Serum from three horses receiving the commercial WN virus vaccine did not contain antibodies against rWNV-ET that were detectable by ELISA at a 1:400 dilution.
Table 2 Antibody response in horses immunized against WN virus Vaccine administered
ELISA endpoint titer
PRNT80
PRNT95
Mouse passive immunization
50 g rWNV-ET with aluminum hydroxide
Horse 1 2 3 4 5 6
12800 12800 3200 12800 12800 12800
20 40 160 >320 >320 20
10 20 40 >320 >320 10
10/10 (control 0/10) ND 10/10 (control 0/10) ND ND ND
100 g rWNV-ET with aluminum hydroxide
7 8 9 10 11 12 13 14
3200 12800 25600 25600 3200 51200 >51200 >51200
<10 20 20 160 80 320 640 1280
<10 <10 <10 80 20 40 80 160
ND 10/10 (control 0/10) 5/10 (control 2/9) ND ND ND 10/10 (control 3/10) ND
Fort Dodge Animal Health InnovatorTM
15 16 17 18 19 20 21 22
400 <400 <400 <400 800 1600 3200 6400
<10 <10 <10 <10 <10 40 160 80
<10 <10 <10 <10 <10 20 80 40
ND 2/10 (control 0/10) ND ND ND ND 7/10 (control 0/10) ND
Serum samples collected 50 days after the initial injection were analyzed by ELISA, plaque reduction neutralization assays, and mouse passive immunization experiments (Section 2). Survival data (number of survivors 21 days after infection/total) are given in the last column. Each experiment included a control group of mice that received serum from na¨ıve horses. Survival among the control groups is indicated in parentheses.
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
Presence of WN virus neutralizing antibodies in the day 50 samples was ascertained in vitro. The serum dilutions leading to a 80% and 95% reduction in plaque numbers are shown in Table 2. Thirteen out of 14 horses receiving rWNV-ET produced virus-neutralizing antibodies. Only three out of eight horses receiving the commercial WN virus vaccine had a detectable level of in vitro neutralizing antibodies in serum samples collected 50 days after the first injection. 3.5. Antibody responses in horses vaccinated with rWNV-ET are long-lasting We next characterized the duration of the antibody response triggered by vaccination. Serial serum samples from horses vaccinated either with rWNV-ET or with Fort Dodge InnovatorTM were diluted 400-fold and presence of IgG was assayed by ELISA. Vaccination with two doses of rWNV-ET induced the appearance of high levels of IgG antibodies (Fig. 5, top panel). Antibodies were detectable 25 days after the first injection in samples taken before the booster injection. Antibody concentration reached a maximum 25 days after the second injection and then declined over the following months. Antibodies were still detectable 190 days
Fig. 5. Mean IgG antibody levels in horses vaccinated with rWNV-ET and with a commercial killed virus vaccine. Serum samples were collected at various times and IgG antibodies specific for rWNV-ET were detected by ELISA at a 1:400 dilution. The mean optical density and standard deviation are shown for each sample group. Top panel: Na¨ıve horses received two injections of rWNV-ET with aluminum hydroxide (, n = 18) or Fort Dodge InnovatorTM vaccine (, n = 8) at days 0 and 25. Bottom panel: horses vaccinated 8–13 months earlier received a single injection of rWNV-ET with aluminum hydroxide (100 g, , n = 9; 50 g, , n = 13) or Fort Dodge InnovatorTM vaccine (, n = 11). To improve the legibility of the graph, only the top or bottom error bars were printed.
3921
after the initial injection. In contrast, immunization with Fort Dodge InnovatorTM resulted in a lower overall antibody level. No antibodies were detectable until after the second injection. These antibodies were no longer detectable 190 days after the initial injection. In all experimental groups, there was considerable variation in the responses of individual horses. Antigen injections in previously vaccinated horses induced antibody responses that were more rapid and longer lasting than in na¨ıve horses. These experiments used data collected from 33 horses that had been previously vaccinated against WN virus (either with rWNV-ET or with Fort Dodge InnovatorTM ). Twelve of these animals were part of the first year study. Experimental horses received a single injection consisting of 50 g rWNV-ET with aluminum hydroxide (13 horses), 100 g rWNV-ET with aluminum hydroxide (9 horses), or the Fort Dodge InnovatorTM vaccine (11 horses). This injection was administered 8–13 months after the initial immunization course. Serum samples were collected 25, 50, 120, and 180 days later. The bottom panel of Fig. 5 shows the evolution of average anti-E protein antibody levels as determined by ELISA. In previously vaccinated horses, a single injection of either rWNV-ET or killed virus vaccine was sufficient to cause the appearance of specific antibodies that reached a maximum level 25 days post-injection. Comparison of the top and bottom panels of Fig. 5 suggests that the decrease of antibody levels is slower after the 8–13 month-boost than after the initial two injections. As part of this study, we examined the ability of rWNVET to induce the production of memory T cells. Five horses vaccinated with two doses of rWNV-ET adsorbed to aluminum hydroxide were boosted 8–12 months later with a single injection of 50 g rWNV-ET with aluminum hydroxide. Serum samples collected 25 days later were assayed by ELISA (Fig. 6). A single injection was sufficient to trigger the appearance of a high level of antibodies, indicating that
Fig. 6. Memory response induced by immunization with rWNV-ET . Five horses immunized with rWNV-ET were injected with 50 g of rWNV-ET in aluminum hydroxide 8–12 months after the primary immunization series. Serum samples from individual horses were collected before the booster injection and 25 days later. IgG antibody levels were measured at a 1:400 dilution using a rWNV-ET ELISA assay. Each sample was tested in triplicate.
3922
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
horses vaccinated with rWNV-ET harbored memory T cells that were still present 8–12 months after immunization. 3.6. Serum from horses vaccinated with rWNV-ET protects mice against a lethal WN virus challenge We next tested whether sera from vaccinated horses contained antibodies that could protect mice against a lethal viral challenge. To limit the number of mice used in these experiments, this analysis was only performed on selected sera collected 50 days after the initial injection. Groups of 10 mice received serum from vaccinated horses 24 h prior to a lethal WN virus challenge. The survival data among mice receiving serum from individual horses is given in Table 2. All the sera from horses vaccinated with rWNV-ET protected mice against a WN viral challenge. Sera from horses vaccinated with Fort Dodge InnovatorTM vaccine only afforded partial protection.
[31,32]. We were able to develop purification procedures yielding milligram amounts of highly purified antigen. In contrast to the bacterially-produced MBP-E antigen, rWNV-ET does not contain inappropriate intermolecular disulfide bonds. Although rWNV-ET harbors protective epitopes, it is clear that additional epitopes may be present in the WN virion and absent in this recombinant protein. For this reason it is possible that rWNV-ET will not elicit a full protective immune response against WN virus. The antigen doses we used are comparable to those needed to elicit an immune response against a recombinant dengue 4 virus envelope protein in Macaca monkeys [33]. Markedly lower doses were used in studies of vaccination against Japanese encephalitis [34–36] or tick-borne encephalitis [37] viruses. Because we did not observe any adverse event in our studies, we did not determine whether lower doses of rWNVET could be used. 4.2. Efficacy of rWNV-ET as a vaccine against WN virus in animal models
4. Discussion 4.1. A recombinant subunit vaccine against West Nile virus This report describes a novel candidate recombinant subunit vaccine against West Nile (WN) virus. This approach may have several potential advantages over other WN virus vaccine development strategies. Using a single, highly purified antigen reduces the potential for cross reactive immunity to host proteins. Higher antigen doses may also be used, perhaps triggering a stronger immune response directed towards the protective E protein epitopes. High antigen doses may be necessary to evoke protective responses in the elderly and immunocompromised populations, two groups at higher risk of WN virus disease. In contrast to recombinant subunit vaccines, chimeric and attenuated whole virus live vaccines carry an inherent risk of reversion to virulence and of genetic recombination. Such risks were noted in a recent review of live flavivirus vaccine development [30]. More experimental vaccines, including plasmid DNA vaccines, have never been approved for human use and may face lengthy regulatory delays. It is important to note that rWNV-ET is immunogenic in mice and horses in combination with aluminum hydroxide, the only adjuvant approved for human use. The envelope protein is the outer surface protein of flaviviruses that mediates viral entry into host cells. Most protective antibodies against flaviviruses are directed against the envelope protein. We found that Drosophila cells express a recombinant envelope protein with a conformation similar to that of the native protein. This is shown by the fact that serum from WN virus infected horses recognises rWNV-ET and that immunization with rWNV-ET elicits neutralizing antibodies. In this expression system, there was no need to co-express the prM protein, which is essential for correct folding of the native flavivirus envelope proteins in vivo
We demonstrated that mice vaccinated against rWNV-ET were protected against a lethal WN virus challenge. In this initial study, we did not challenge vaccinated horses with WN virus. Instead, we relied on indirect markers of vaccine efficacy. Three lines of evidence suggest that vaccination with rWNV-ET may protect horses. First, rWNV-ET vaccination of na¨ıve horses induces a strong and long-lasting antibody response directed against the viral envelope protein. These antibodies were still detectable 6 months after the initial immunization. In the United States, natural exposure to WN virus occurs primarily during the summer and early fall. Horses vaccinated with rWNV-ET in late spring could have circulating antiviral antibodies during the entire WN season. In previously vaccinated horses, a single booster injection administered 1 year after the initial immunization course was sufficient to elicit circulating antibodies. Interestingly, the concentration of these antibodies declined more slowly than following the initial immunization. Second, the immunoglobulins induced by vaccination were capable of neutralizing WN virus in vitro. Although non-neutralizing antibodies may confer protection, neutralizing antibodies are usually more effective. Third, passive transfer of serum from horses vaccinated with rWNV-ET protected mice against a lethal challenge with WN virus. Using these three indirect markers of efficacy, rWNV-ET appears as effective as the commercially available killed WN virus vaccine, which has an efficacy demonstrated in challenge experiments [8] and in the field. The relatively low antibody levels observed in horses immunized with Fort Dodge InnovatorTM killed virus vaccine were surprising given the established efficacy of this product. Interpretation of this result must take into account the fact that our ELISA assay only detected antibodies that bound rWNVET . Vaccination with the killed virus product may induce antibodies against structural proteins other than the envelope
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
protein or against epitopes that are not present on rWNVET . However, low ELISA titers and low plaque reduction neutralization titers were also observed by other researchers after immunization with the Fort Dodge InnovatorTM vaccine [16,38]. It is possible that these low antibody levels are sufficient to protect horses. Alternatively, protection may be conferred by cellular immunity mechanisms. Antiviral protection induced by vaccination may involve cellular and humoral immunity. We only assessed the humoral immunity response in vaccinated animals. Our results demonstrate that antibodies alone are sufficient to protect mice against a lethal challenge with WN virus. Infecting virus may be immediately neutralized by circulating antibodies in vaccinated animals. We showed that horse antibodies elicited by vaccination persist for several months following immunization. Their level may be sufficient to remain protective during this entire period. In addition, we found that administration of a single dose of antigen several months after immunization resulted in the re-appearance of high antibody levels. Experiments currently in progress show that antibody production occurs in as few as 4 days following restimulation (data not shown). Upon exposure, viral antigens are therefore expected to trigger a rapid memory response and induce the appearance of newly synthesized neutralizing antibodies. This response would be sufficiently rapid to occur before the onset of disease symptoms, which typically takes place 7 days or more after viral exposure in horses and humans [39,40]. The ability of rWNV-ET , when combined with aluminum hydroxide, to induce a protective immune response in mice and horses indicates that this antigen is suitable for further development as an equine and human vaccine.
Acknowledgements We wish to thank Deborah Beck, Amy Gates, and Bonnie Hamid for excellent technical assistance. We are grateful to Dr. Antonio Garmendia, of the University of Connecticut at Storrs, CT, for generously providing serum samples from convalescent horses. Horse sera were evaluated for antibodies against rWNV-ET and NS-5 by Dr. Susan J. Wong, of the New York State Department of Health, Albany, NY, using a fluorescent microsphere immunoassay. This project was supported by NIH SBIR grant AI49646 from the National Institute of Allergy and Infectious Diseases.
References [1] Brinton MA. The molecular biology of West Nile virus: a new invader of the western hemisphere. Annu Rev Microbiol 2002;56:371–402. [2] Gould LH, Fikrig E. West Nile virus: a growing concern? J Clin Invest 2004;113(8):1102–7. [3] Petersen LR, Marfin AA. West Nile virus: a primer for the clinician. Ann Int Med 2002;137(3):173–9.
3923
[4] Solomon T, Ooi MH, Beasley DW, Mallewa M. West Nile encephalitis. BMJ 2003;326(7394):865–9. [5] Ward MP, Levy M, Thacker HL, Ash M, Norman SK, Moore GE, et al. Investigation of an outbreak of encephalomyelitis caused by West Nile virus in 136 horses. J Am Vet Med Assoc 2004;225:84–9. [6] Haley M, Retter AS, Fowler D, Gea-Banacloche J, O’Grady NP. The role for intravenous immunoglobulin in the treatment of West Nile virus encephalitis. Clin Infect Dis 2003;37(6):e88–90. [7] Agrawal AG, Petersen LR. Human immunoglobulin as a treatment for West Nile virus infection. J Infect Dis 2003;188(1):1–4. [8] Ng T, Hathaway D, Jennings N, Champ D, Chiang YW, Chu HJ. Equine vaccine for West Nile virus. Dev Biol (Basel) 2003;114:221–7. [9] Minke JM, Siger L, Karaca K, Austgen L, Gordy P, Bowen R, et al. Recombinant canarypoxvirus vaccine carrying the prM/E genes of West Nile virus protects horses against a West Nile virus-mosquito challenge. Arch Virol 2004:221–30. [10] Arroyo J, Miller CA, Catalan J, Monath TP. Yellow fever vector live-virus vaccines: West Nile virus vaccine development. Trends Mol Med 2001;7(8):350–4. [11] Davis BS, Chang GJ, Cropp B, Rochrig JT, Martin DA, Mitchell CJ, et al. West Nile virus recombinant DNA vaccine protects mouse and horse from virus challenge and expresses in vitro a noninfectious recombinant antigen that can be used in enzyme-linked immunosorbent assays. J Virol 2001;75:4040–7. [12] Lustig S, Olshevsky U, Ben-Nathan D, Lachmi BE, Malkinson M, Kobiler D, et al. A live attenuated West Nile virus strain as a potential veterinary vaccine. Viral Immunol 2000;13:401–10. [13] Monath TP, Arroyo J, Miller C, Guirakhoo F. West Nile virus vaccine. Curr Drug Targets Infect Disord 2001;1(1):37–50. [14] Pletnev AG, Putnak R, Speicher J, Wagar EJ, Vaughn DW. West Nile virus/dengue type 4 virus chimeras that are reduced in neurovirulence and peripheral virulence without loss of immunogenicity or protective efficacy. Proc Natl Acad Sci USA 2002;99(5):3036– 41. [15] Pletnev AG, Claire MS, Elkins R, Speicher J, Murphy BR, Chanock RM. Molecularly engineered live-attenuated chimeric West Nile/dengue virus vaccines protect rhesus monkeys from West Nile virus. Virology 2003;314(1):190–5. [16] Tesh RB, Arroyo J, Travassos Da Rosa AP, Guzman H, Xiao SY, Monath TP. Efficacy of killed virus vaccine, live attenuated chimeric virus vaccine, and passive immunization for prevention of West Nile virus encephalitis in hamster model. Emerg Infect Dis 2002;8(12):1392–7. [17] Tesh RB, Travassos da Rosa AP, Guzman H, Araujo TP, Xiao SY. Immunization with heterologous flaviviruses protective against fatal West Nile encephalitis. Emerg Infect Dis 2002;8(3):245–51. [18] Kofler RM, Aberle JH, Aberle SW, Allison SL, Heinz FX, Mandl CW. Mimicking live flavivirus immunization with a noninfectious RNA vaccine. Proc Natl Acad Sci USA 2004;101(7):1951–6. [19] Arroyo J, Miller C, Catalan J, Myers GA, Ratterree MS, Trent DW, et al. ChimeriVax-West Nile virus live-attenuated vaccine: preclinical evaluation of safety, immunogenicity, and efficacy. J Virol 2004;78:12497–507. [20] Chang GJ, Kuno G, Purdy DE, Davis BS. Recent advancement in flavivirus vaccine development. Expert Rev Vaccines 2004;3(2):199–220. [21] Wang T, Anderson JF, Magnarelli LA, Wong SJ, Koski RA, Fikrig E. Immunization of mice against West Nile virus with recombinant envelope protein. J Immunol 2001;167(9):5273–7. [22] Modis Y, Ogata S, Clements D, Harrison SC. A ligand-binding pocket in the dengue virus envelope glycoprotein. Proc Natl Acad Sci USA 2003;100(12):6986–91. [23] Anderson JF, Andreadis TG, Vossbrinck CR, Tirrell S, Wakem EM, French RA, et al. Isolation of West Nile virus from mosquitoes, crows, and a Cooper’s hawk in Connecticut. Science 1999;286:2331–3.
3924
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
[24] Anderson JF, Vossbrinck CR, Andreadis TG, Iton A, Beckwith 3rd WH, Mayo DR. A phylogenetic approach to following West Nile virus in Connecticut. Proc Natl Acad Sci USA 2001;98(23):12885–9. [25] Wong SJ, Boyle RH, Demarest VL, Woodmansee AN, Kramer LD, Li H, et al. Immunoassay targeting nonstructural protein 5 to differentiate West Nile virus infection from dengue and St. Louis encephalitis virus infections and from flavivirus vaccination. J Clin Microbiol 2003;41:4217–23. [26] Wong SJ, Demarest VL, Boyle RH, Wang T, Ledizet M, Kar K, et al. Detection of human anti-flavivirus antibodies with a west nile virus recombinant antigen microsphere immunoassay. J Clin Microbiol 2004;42:65–72. [27] Men RH, Bray M, Lai CJ. Carboxy-terminally truncated dengue virus envelope glycoproteins expressed on the cell surface and secreted extracellularly exhibit increased immunogenicity in mice. J Virol 1991;65(3):1400–7. [28] Rey FA, Heinz FX, Mandl C, Kunz C, Harrison SC. The envelope glycoprotein from tick-borne encephalitis virus at 2 A resolution. Nature 1995;375(6529):291–8. [29] Mukhopadhyay S, Kim BS, Chipman PR, Rossmann MG, Kuhn RJ. Structure of West Nile virus. Science 2003;302(5643):248. [30] Seligman SJ, Gould EA. Live flavivirus vaccines: reasons for caution. Lancet 2004;363(9426):2073–5. [31] Konishi E, Mason PW. Proper maturation of the Japanese encephalitis virus envelope glycoprotein requires cosynthesis with the premembrane protein. J Virol 1993;67(3):1672–5. [32] Lorenz IC, Allison SL, Heinz FX, Helenius A. Folding and dimerization of tick-borne encephalitis virus envelope proteins prM and E in the endoplasmic reticulum. J Virol 2002;76(11):5480–91.
[33] Guzman MG, Rodriguez R, Hermida L, Alvarez M, Lazo L, Mune M, et al. Induction of neutralizing antibodies and partial protection from viral challenge in Macaca fascicularis immunized with recombinant dengue 4 virus envelope glycoprotein expressed in Pichia pastoris. Am J Trop Med Hyg 2003;69:129–34. [34] Kuzuhara S, Nakamura H, Hayashida K, Obata J, Abe M, Sonoda K, et al. Non-clinical and phase I clinical trials of a Vero cell-derived inactivated Japanese encephalitis vaccine. Vaccine 2003;21:4519– 26. [35] Mutoh E, Ishikawa T, Takamizawa A, Kurata T, Sata T, Kojima A. Japanese encephalitis subunit vaccine composed of virus-like envelope antigen particles purified from serum-free medium of a highproducer J12#26 cell clone. Vaccine 2004;22(20):2599–608. [36] Srivastava AK, Putnak JR, Lee SH, Hong SP, Moon SB, Barvir DA, et al. A purified inactivated Japanese encephalitis virus vaccine made in Vero cells. Vaccine 2001;19:4557–65. [37] Heinz FX, Allison SL, Stiasny K, Schalich J, Holzmann H, Maudl CW, et al. Recombinant and virion-derived soluble and particulate immunogens for vaccination against tick-borne encephalitis. Vaccine 1995;13:1636–42. [38] Kutzler MA, Baker RJ, Mattson DE. Humoral response to West Nile virus vaccination in alpacas and llamas. J Am Vet Med Assoc 2004;225(3):414–6. [39] Bunning ML, Bowen RA, Cropp CB, Sullivan KG, Davis BS, Komar N, et al. Experimental infection of horses with West Nile virus. Emerg Infect Dis 2002;8:380–6. [40] Pealer LN, Marfin AA, Petersen LR, Lanciotti RS, Page PL, Stramer SL, et al. Transmission of West Nile virus through blood transfusion in the United States in 2002. N Engl J Med 2003;349:1236–45.
A recombinant envelope protein vaccine against West Nile virus Michel Ledizet a,∗ , Kalipada Kar a , Harald G. Foellmer b , Tian Wang b , Sandra L. Bushmich c , John F. Anderson d , Erol Fikrig b , Raymond A. Koski a a L2 Diagnostics, LLC, 300 George Street, New Haven, CT 06511, USA Yale University School of Medicine, Section of Rheumatology, Box 208031, New Haven, CT 06520, USA University of Connecticut, Department of Pathobiology, 61 North Eagleville Road, Unit 3089, Storrs, CT 06269-3089, USA d Connecticut Agricultural Experiment Station, 123 Huntington Street, New Haven, CT 06504, USA b
c
Received 15 November 2004; received in revised form 25 February 2005; accepted 3 March 2005 Available online 6 April 2005
Abstract West Nile (WN) virus is a flavivirus that first appeared in North America in 1999. Since then, more than 600 human deaths and 22,000 equine infections have been attributed to the virus in the United States. We expressed a truncated form of WN virus envelope (E) protein in Drosophila S2 cells. This soluble recombinant E protein was recognized by antibodies from naturally infected horses, indicating that it contains native epitopes. Mice and horses produced high-titer antibodies when immunized with recombinant E protein combined with aluminum hydroxide. Immunized mice were resistant to challenge with a lethal viral dose. Sera from immunized horses, administered to na¨ıve mice, conferred resistance against a lethal WN viral challenge. In addition, sera of immunized horses neutralized West Nile virus in vitro, as demonstrated by plaque reduction assays. This recombinant form of E protein, combined with aluminum hydroxide, is a candidate vaccine that may protect humans and horses against WN virus infections. © 2005 Elsevier Ltd. All rights reserved. Keywords: West Nile virus; Vaccine; Envelope protein
1. Introduction West Nile (WN) virus, a member of the Flaviviridae family, was first identified in 1937 in Uganda [1,2]. WN virus primarily infects birds, but also horses and humans. Most human WN virus infections are unrecognised, only 20% of infected patients develop a mild febrile illness called West Nile fever [3,4]. Approximately one patient in 150 develops life-threatening meningoencephalitis. Following its introduction to North America in 1999, WN virus has caused more than 600 human deaths in the United States, and 22,000 equine cases. Fatality rate in unvaccinated horses is approximately 30% (reviewed in [5]). There is currently no specific therapy against WN virus. Recent anecdotal reports documented a clinical benefit from administering human immunoglobulins from donors living ∗
Corresponding author. Tel.: +1 203 503 0383; fax: +1 203 503 0384. E-mail address: [email protected] (M. Ledizet).
0264-410X/$ – see front matter © 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.vaccine.2005.03.006
in areas endemic for WN virus [6,7]. Clinical trials are now underway to evaluate this treatment in a larger patient population. Several groups are developing vaccines against WN virus. Two veterinary vaccines are now approved for use in the United States. One, manufactured by Fort Dodge Animal Health, consists of a killed virus preparation [8]. The other, a recombinant canarypox virus, is marketed by Merial [9]. Other vaccine development strategies are based on naked plasmid DNA, attenuated WN strains, non-infectious RNA vaccines and chimeric viruses [10–19]. A recent review presents the various strategies followed to develop vaccines against WN virus and other flaviviruses [20]. Our efforts are focused on developing a recombinant subunit vaccine against WN virus, using the viral envelope (E) protein as a target antigen [21]. Previous studies with flaviviruses have shown that most virus-neutralizing antibodies are directed against viral E proteins [1]. Antibodies against the structural M protein and the non-structural NS-1 protein may also
3916
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
provide protection to the animal host. We have previously demonstrated that immunization with recombinant WN virus envelope protein produced in bacteria protects mice against lethal WN infection [21]. It has been shown that truncated envelope protein from dengue virus, when expressed in Drosophila S2 cells, folds into a conformation resembling that of native envelope protein [22]. Here we show the results of experiments with a truncated form of WN virus envelope protein produced in Drosophila S2 cells. Mice vaccinated with this antigen were protected against a lethal challenge with WN virus. Vaccination of horses elicited neutralizing antibodies. The antigen was immunogenic when administered with aluminum hydroxide, the only adjuvant currently approved for human use. We propose that this form of truncated E protein is a candidate antigen for further development as equine and human vaccines to protect against WN virus infection.
2.2. Production and purification of recombinant E proteins
2. Materials and methods
2.3. Immunization of animals with rWNV-ET
2.1. Expression of rWNV-ET in Drosophila cells
Four to five-week-old C57Bl/6 mice were immunized intraperitoneally with 20 g of rWNV-ET adsorbed to Alhydrogel adjuvant (Accurate) at a ratio of 1 g protein/l of 1.3% aluminum hydroxide suspension. Alternatively, mice were immunized intraperitoneally with 20 g of rWNV-ET in 100 l complete Freund’s adjuvant. The mice were boosted 3 weeks later by intraperitoneal injection of 20 g of rWNV-ET bound to aluminum hydroxide or with Freund’s incomplete adjuvant. Control mice received injections of an equivalent amount of Alhydrogel adjuvant. Mice were challenged 2 weeks after the booster injection as described in Section 2.6. For this study, we selected horses of different breeds, ages, and gender, without a documented history of WN virus vaccination or infection. Serum samples were collected prior to the first injection, and analyzed for antibodies recognizing WN virus E or NS-5 proteins. These antibodies were detected by ELISA or by using a previously described fluorescent microsphere immunoassay [25,26]. Horses with antibodies against WN virus E or NS-5 proteins were presumably previously exposed to viral antigens and were excluded from this study. Horses were immunized intramuscularly with 50 or 100 g of rWNV-ET adsorbed to aluminum hydroxide at a ratio of 1 g protein/l of 1.3% aluminum hydroxide suspension. Thus, each vaccine dose contained 0.34 or 0.68 mg of elemental aluminum. FDA regulations limit the aluminum content of human vaccines to 0.85 mg per dose. A second identical injection was administered 25 days later. Horses were examined for signs of adverse reactions for several hours following each injection. The injections appeared to be safe and well tolerated. Horses were maintained on pasture or in barns. Anti-E protein antibody titers only increased following immunizations, thus ruling out natural exposure to WN virus. Horses were tested multiple times throughout the study for anti-NS5
The isolation of WN virus strain 2741 was previously described [23,24]. The DNA encoding amino acids 1–406 of WN envelope protein was amplified by PCR from strain 2741 viral cDNA using the primers AAAAAGATCTTTCAACTGCCTTGGAATGAGC and AAAATCTAGATTATTTGCCAATGCTGCTTCC. The PCR product was purified, digested with XbaI and BglII and ligated into the corresponding restriction sites of plasmid pMTBiP/V5-HisA (Invitrogen). The recombinant plasmid directs the synthesis of a fusion protein consisting of the 18-amino acid Drosophila BiP secretory signal sequence, two amino acids encoded by the multiple cloning site, followed by residues 1–406 of WN virus E protein. The secreted recombinant protein, after removal of the signal sequence, was named rWNV-ET . E protein codon 406 is immediately followed by a stop codon, and therefore, rWNV-ET does not contain the V5 epitope or polyhistidine tag encoded by the plasmid vector. The recombinant expression plasmid and a hygromycinresistance plasmid, pCoHygro, were co-transfected into Drosophila S2 cells by the calcium phosphate procedure as recommended by the manufacturer of the Drosophila Expression System kit (Invitrogen). Transfected S2 cells were grown at room temperature (20–25 ◦ C) in Schneider’s Drosophila medium (Invitrogen) supplemented with 10% fetal calf serum, penicillin, streptomycin, and fungizone. Stably transfected cells were selected with hygromycin over several weeks and then transferred to Drosophila Serum-Free Medium (Invitrogen) supplemented with 4 mM l-glutamine, penicillin, streptomycin, and fungizone. Cells were passaged every week in serum-free medium for over a year. No decrease in cell viability or yield of recombinant protein was noted during that time.
Cultured S2 cells expressing rWNV-ET were diluted 10-fold with fresh serum-free culture medium into 175 cm2 tissue culture flasks. After 6 days, CuSO4 was added to a final concentration of 500 M to induce synthesis of the recombinant protein. The cell culture supernatant was collected 7 days later. Recombinant rWNV-ET was purified from the cell culture supernatant by ion-exchange column chromatography with Sepharose Q-XL (Amersham) followed by size-exclusion chromatography. The fusion protein Maltose Binding Protein-E (MBP-E) was expressed in E. coli and purified as previously described [21]. Analysis of purified rWNV-ET by MALDI and electrospray mass spectrometry was performed by the W.M. Keck Foundation Biotechnology Resource Laboratory at Yale University. The same facility also performed a mass spectrometric analysis of tryptic fragments to identify rWNV-ET .
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
antibodies. All samples were found to be negative, further suggesting that WN viral infection did not occur (data not shown). Horse immunizations with Fort Dodge Animal Health InnovatorTM killed virus vaccine were performed as recommended [8]. Two identical injections were administered intramuscularly 30 days apart. 2.4. Detection of antibodies specific for rWNV-ET Ninety-six-well ELISA plates were coated with rWNVET in carbonate buffer at a concentration of 100 ng per well, and blocked with PBS containing 0.1% Tween-20 and 1% fat-free dry milk (PBS-TM). Mouse and horse antisera were applied after dilution in PBS-TM. After a 1-h incubation at room temperature, unbound proteins were removed by washing with PBS containing 0.1% Tween-20 (PBS-T). Alkaline phosphatase-conjugated goat anti-mouse IgG or anti-horse IgG (Sigma) was applied at a 1–3000 dilution. After a 1h incubation at room temperature, unbound proteins were removed by washing with PBS-T. Bound antibody was detected by incubation with the colorimetric substrate paranitrophenyl phosphate (pNPP, Sigma). The optical density at 405 nm was read on a 96-well plate reader (Multiskan LS, Labsystems). Positive control horse sera were included in each plate to standardize color development. This allowed comparison of results from plate to plate. All samples were analyzed in triplicate. To determine endpoint ELISA titers, sera were serially diluted and applied to the plate at two-fold dilutions ranging from 400 to 51,200. The endpoint titers represent the reciprocal of the highest dilution generating a significant signal over background. For the calculation of geometric means, endpoint titers of less than 400 and greater than 51,200 were assumed to be 200 and 102,400, respectively. 2.5. In vitro plaque reduction neutralization tests Plaque reduction neutralization tests were used to evaluate the ability of serum samples to inhibit WN virus replication in cultured Vero cells. Serum samples were heat-inactivated by incubation in a 56 ◦ C water bath for 30 min, and serially diluted in PBS with 0.5% gelatin (PBS-G). Samples were initially tested at 1:10, 1:20, and 1:40 dilutions, and were retested at higher dilutions if required. WN virus strain 2741 was diluted in PBS-G so that the final concentration was 100 plaque-forming units (pfu) per 75 l. Seventy-five microlitres of virus was mixed with 75 l of diluted serum at 37 ◦ C for 1 h and then inoculated onto confluent monolayers of Vero cells in 6-well tissue culture plates. The plates were incubated at 37 ◦ C for 1 h and were shaken every 15 min. Cells were then covered with a 1% agarose overlay containing 1 × minimal essential medium (Invitrogen). The cells were incubated for 4 days at 37 ◦ C in a humidified 5% CO2 -in-air mixture. A second agarose overlay containing 4% neutral red was added on day 4. Virus plaques were counted 12 h later. Serum titers
3917
that led to 80 and 95% reduction in viral plaque numbers (PRNT80 and PRNT95 ) were recorded. 2.6. Mouse passive immunization and West Nile viral challenge Four to five-week-old C57Bl/6 mice were used for these experiments. For passive immunization, each mouse was injected intraperitoneally with 65 l of horse serum diluted to 100 l with PBS. Twenty-four hour later, the mice were challenged with approximately 1000 pfu of WN virus isolate 2741 administered intraperitoneally. Morbidity and mortality were assessed twice daily for 21 days or longer. Mice vaccinated with rWNV-ET were challenged 2 weeks after the booster injection using the same challenge procedure.
3. Results 3.1. Production of a soluble, recombinant, truncated WN virus envelope protein (rWNV-ET ) in Drosophila S2 cells We previously demonstrated that immunization with a bacterially-expressed, truncated form of WN virus E protein protected mice against a lethal viral challenge [21]. The 87 kDa recombinant maltose binding protein (MBP)-E antigen used in that study consisted of amino acids 1–406 of WN virus envelope protein fused to the C-terminus of MBP. We were unable to separate the E protein antigen from its MBP fusion partner by protease cleavage (not shown). We, therefore, sought to express WN virus envelope protein antigens without a fusion partner or affinity purification tags in Drosophila S2 cells. Insect cells carry out various post-translational modifications, including glycosylation, on recombinant proteins. In addition, the secretion pathway in insect cells is similar to that of mammalian cells. As a result, antigens produced in insect cells may more closely resemble their mammalian native counterparts. We expressed the recombinant WN virus E protein in Drosophila S2 cells, using the Drosophila Expression System (Invitrogen). The coding sequence was placed in-frame with a BiP signal sequence, which directs the recombinant protein to the secretion pathway. In preliminary experiments, we found that the full-length E protein was not produced efficiently by Drosophila S2 cells (not shown). The C-terminal portion of WN E protein contains a highly hydrophobic region, which may interfere with production and secretion of the recombinant protein in the absence of the viral prM protein. We, therefore, chose to express a truncated version of WN virus E protein lacking this region. The recombinant protein, designated rWNV-ET , consists of the first 406 amino acids of WN virus E protein, with two non-native residues added to the N-terminus by the cloning procedures. Previous work on the envelope protein of Dengue virus type 4 showed that shorter truncated recombinant E proteins fail to adopt a native conformation [27]. Based on the three-dimensional structure of
3918
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
the homologous E proteins from the tick-borne encephalitis (TBE) and dengue viruses [22,28,29], rWNV-ET contains the first three structural domains of the envelope protein. The expected molecular weight of the mature, secreted rWNV-ET protein is 44,029 Da after removal of the BiP signal sequence. This predicted molecular weight does not take into account possible post-translational modifications. A stably transfected S2 cell line expressing rWNV-ET was adapted to growth in serum-free culture medium. Addition of CuSO4 to the culture medium induced the synthesis and secretion of recombinant rWNV-ET with an apparent molecular weight of 48 kDa by SDS-PAGE. This protein was recognized by an anti-E monoclonal antibody (PanBio InDx. Inc., Baltimore MD) raised against WN virus (not shown). Accumulation of rWNV-ET in the culture medium was maximal 6–8 days after addition of CuSO4 . rWNV-ET was purified from cell culture supernatants by column chromatography. Yields of purified protein ranged from 2 to 10 mg/l of serum-free culture medium. Fig. 1 shows a Coomassie blue-stained SDSPAGE electrophoretogram of purified rWNV-ET from four sequential preparations. No contaminating protein can be detected by Coomassie blue staining of 2.5 g of rWNV-ET samples, indicating that antigen purity was greater than 95%. Analysis of a rWNV-ET sample by MALDI mass spectrometry revealed a predominant species with a mass (m/z ratio) of 44,736 (not shown). More precise estimation of the mass of the protein was obtained by electrospray mass spectrometry (Fig. 2). This experiment revealed a small number of masses ranging from 44,235 to 45,160. The origin of the microheterogeneity is not known, and may represent varying
Fig. 1. SDS-PAGE analysis of purified rWNV-ET . Lanes A, B, C, and D contain 2.5 g rWNV-ET samples from four consecutive preparations stained with Coomassie blue. The positions of molecular weight markers (in kDa) are indicated on the left.
degrees of post-translational modification. The major species had a mass of 44,891, only 862 Da greater than the predicted molecular weight of rWNV-ET without post-translational modification. This result shows that rWNV-ET is not heavily glycosylated, a concern for proteins expressed in insect cells. To confirm the identity of the recombinant protein, an aliquot was hydrolyzed with trypsin and fragments were identified by MALDI mass spectrometry. This analysis,
Fig. 2. Electrospray mass spectrometry analysis of purified rWNV-ET . Shown is the spectrum obtained by transformation of the raw multiply charged ion spectrum onto a molecular scale. The masses of the major components are shown next to the corresponding peak.
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
performed by the Keck Center for Biotechnology at Yale University, positively identified 16 peptides, which together represent 154 amino acids or 38% of the expected amino acid sequence (not shown). Because only a fraction of all peptides can be recovered and analyzed by this method, this degree of coverage was sufficient to establish the identity of the recombinant protein. 3.2. rWNV-ET protein has a conformation resembling native WN virus E protein rWNV-ET produced in insect cells retains epitopes present in native WN virus envelope protein. ELISA assays showed that rWNV-ET was recognized by antibodies from eight WN virus convalescent horses (not shown), but not by sera from horses without exposure to WN virus. Fig. 3 shows the results of an immunoblot analysis of MBP-E and rWNV-ET with the serum of one horse previously infected with WN virus. Aliquots of rWNV-ET and MBP-E were separated by SDSPAGE and transferred to nitrocellulose. Antibodies from the convalescent horse bound to both recombinant proteins after reduction of disulfide bridges (lanes A and B), establishing that some native epitopes are present in both recombinant proteins. A clear difference was noted when non-reduced samples were analyzed. The 12 cysteines present in rWNVET are predicted to form six intramolecular disulfide bridges.
3919
Most of the non-reduced MBP-E was present as multimers, indicating a preponderance of intermolecular disulfide bonds (lane D). In contrast, non-reduced rWNV-ET had the mobility expected for a monomer, indicating that inappropriate disulfide bridges did not form (lane C). Furthermore, antibody binding was stronger to non-reduced rWNV-ET (compare lanes A and C, which contain equal amounts of protein). This observation suggests that intramolecular disulfide bonds help maintain native conformational epitopes, and that recombinant E protein produced in insect cells has a conformation that is closer to that of the native viral protein. It remains a possibility that rWNV-ET lacks some of the protective epitopes present in the native viral protein. 3.3. Mice vaccinated with rWNV-ET are protected against a lethal challenge with WN virus The immunoblotting results and other serological studies with rWNV-ET [25,26] suggested that immunization with rWNV-ET would elicit antibodies cross-reactive with native WN virus E protein during infection. To determine whether anti-rWNV-ET antibodies would be protective in vivo, we immunized mice with rWNV-ET and then challenged them with a lethal dose of WN virus. Mice were immunized with rWNV-ET together with either aluminum hydroxide or Freund’s adjuvant as described in the Section 2. Control mice received aluminum hydroxide without antigen. Two weeks after the second injection, the animals were challenged with a lethal dose of West Nile virus. Prior to the viral challenge, a serum sample was collected from each animal and IgG antibodies against rWNV-ET were detected by ELISA (Table 1). As expected, immunization with rWNV-ET induced antigenspecific antibodies. The mean anti-rWNV-ET antibody level was slightly higher in the animals that received the antigen with Freund’s adjuvant. There was a significant variability in the antibody levels elicited in individual animals in each treatment group, as evidenced by the wide range of observed values. Animals receiving rWNV-ET with aluminum hydroxide appeared to respond more uniformly to the antigen. Fig. 4 shows survival curves for the immunized mice after a challenge with 1000 plaque-forming units (pfu) of WN virus isolate 2741. The control non-immunized mice died within 11 days after infection. Survival at 26 days was 100% among animals vaccinated with rWNV-ET combined with aluminum Table 1 Immunization of mice with rWNV-ET
Fig. 3. Immunoblot analysis of recombinant WN virus envelope proteins. The proteins analyzed are purified rWNV-ET (lanes A and C) and MBPE (lanes B and D). Samples in lanes A and B were reduced by heating to 95 ◦ C for 5 minutes in sample buffer with 50 mM dithiothreitol prior to electrophoresis. Proteins were transferred to a nitrocellulose membrane and probed with antibodies from the serum of a WN virus convalescent horse. The molecular weights of MBP-E and rWNV-ET monomers are 87 and 45 kDa, respectively. The positions of molecular weight markers (in kDa) are indicated on the left.
Treatment group
ELISA optical density (mean ± S.D.)
Range
rWNV-ET with aluminum hydroxide rWNV-ET with Freund’s adjuvant Aluminum hydroxide alone
0.755 ± 0.367 1.144 ± 0.692 0.004 ± 0.005
0.310–1.322 0.213–2.278 0.000–0.012
Serum samples were collected 2 weeks after the second injection, at the time of viral challenge. Presence of antibodies against rWNV-ET was determined by ELISA at a 1:2000 serum dilution. All samples were analyzed in triplicate.
3920
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
Fig. 4. Survival of vaccinated mice after challenge with a lethal dose of WN virus. Groups of 10 mice were vaccinated with rWNV-ET with aluminum hydroxide () or with Freund’s adjuvant (). Control mice received aluminum hydroxide without antigen (䊉). Mice were challenged with 1000 pfu of West Nile virus isolate 2741, and were monitored daily for morbidity and mortality.
hydroxide, and 90% among animals receiving the antigen in Freund’s adjuvant. 3.4. Vaccination of horses with rWNV-ET induces neutralizing anti-WN virus antibodies The efficacy of rWNV-ET bound to aluminum hydroxide in our murine challenge model prompted us to test this vaccine formulation in horses. Twenty-two horses were
vaccinated either with a commercially available WN killed virus vaccine (Fort Dodge Animal Health InnovatorTM ), or with either 50 or 100 g rWNV-ET bound to aluminum hydroxide. All animals that had detectable antibodies against rWNV-ET or against WN virus NS-5 protein prior to the start of the study were excluded in order to avoid interference from previous vaccination or natural exposure to WN virus. Both groups of animals received two injections. Serum samples were collected 0, 25, 50, 120, 150, 190, and 250 days after the initial injection. We used three assays to analyze the equine antibody responses to vaccination. First, we measured the appearance of antibodies against the E protein, the major protective antigen in flaviviruses. Second, we determined an in vitro plaque reduction neutralization titer (PRNT80 and PRNT95 ) to measure WN virus neutralizing antibodies. Finally, we determined whether passive transfer of immunized horse serum to na¨ıve mice was protective against a lethal WN virus challenge. The presence of IgG antibodies against rWNV-ET protein was determined by ELISA. The endpoint titer calculated for each day 50 sample is shown in Table 2. Antibodies against the E protein were detected in all animals receiving rWNV-ET . The geometric mean endpoint titer was 10,159 for animals receiving two 50 g doses and 21,527 for animals receiving two 100 g doses. The geometric mean endpoint titer was 734 for horses receiving the commercial killed virus vaccine. Serum from three horses receiving the commercial WN virus vaccine did not contain antibodies against rWNV-ET that were detectable by ELISA at a 1:400 dilution.
Table 2 Antibody response in horses immunized against WN virus Vaccine administered
ELISA endpoint titer
PRNT80
PRNT95
Mouse passive immunization
50 g rWNV-ET with aluminum hydroxide
Horse 1 2 3 4 5 6
12800 12800 3200 12800 12800 12800
20 40 160 >320 >320 20
10 20 40 >320 >320 10
10/10 (control 0/10) ND 10/10 (control 0/10) ND ND ND
100 g rWNV-ET with aluminum hydroxide
7 8 9 10 11 12 13 14
3200 12800 25600 25600 3200 51200 >51200 >51200
<10 20 20 160 80 320 640 1280
<10 <10 <10 80 20 40 80 160
ND 10/10 (control 0/10) 5/10 (control 2/9) ND ND ND 10/10 (control 3/10) ND
Fort Dodge Animal Health InnovatorTM
15 16 17 18 19 20 21 22
400 <400 <400 <400 800 1600 3200 6400
<10 <10 <10 <10 <10 40 160 80
<10 <10 <10 <10 <10 20 80 40
ND 2/10 (control 0/10) ND ND ND ND 7/10 (control 0/10) ND
Serum samples collected 50 days after the initial injection were analyzed by ELISA, plaque reduction neutralization assays, and mouse passive immunization experiments (Section 2). Survival data (number of survivors 21 days after infection/total) are given in the last column. Each experiment included a control group of mice that received serum from na¨ıve horses. Survival among the control groups is indicated in parentheses.
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
Presence of WN virus neutralizing antibodies in the day 50 samples was ascertained in vitro. The serum dilutions leading to a 80% and 95% reduction in plaque numbers are shown in Table 2. Thirteen out of 14 horses receiving rWNV-ET produced virus-neutralizing antibodies. Only three out of eight horses receiving the commercial WN virus vaccine had a detectable level of in vitro neutralizing antibodies in serum samples collected 50 days after the first injection. 3.5. Antibody responses in horses vaccinated with rWNV-ET are long-lasting We next characterized the duration of the antibody response triggered by vaccination. Serial serum samples from horses vaccinated either with rWNV-ET or with Fort Dodge InnovatorTM were diluted 400-fold and presence of IgG was assayed by ELISA. Vaccination with two doses of rWNV-ET induced the appearance of high levels of IgG antibodies (Fig. 5, top panel). Antibodies were detectable 25 days after the first injection in samples taken before the booster injection. Antibody concentration reached a maximum 25 days after the second injection and then declined over the following months. Antibodies were still detectable 190 days
Fig. 5. Mean IgG antibody levels in horses vaccinated with rWNV-ET and with a commercial killed virus vaccine. Serum samples were collected at various times and IgG antibodies specific for rWNV-ET were detected by ELISA at a 1:400 dilution. The mean optical density and standard deviation are shown for each sample group. Top panel: Na¨ıve horses received two injections of rWNV-ET with aluminum hydroxide (, n = 18) or Fort Dodge InnovatorTM vaccine (, n = 8) at days 0 and 25. Bottom panel: horses vaccinated 8–13 months earlier received a single injection of rWNV-ET with aluminum hydroxide (100 g, , n = 9; 50 g, , n = 13) or Fort Dodge InnovatorTM vaccine (, n = 11). To improve the legibility of the graph, only the top or bottom error bars were printed.
3921
after the initial injection. In contrast, immunization with Fort Dodge InnovatorTM resulted in a lower overall antibody level. No antibodies were detectable until after the second injection. These antibodies were no longer detectable 190 days after the initial injection. In all experimental groups, there was considerable variation in the responses of individual horses. Antigen injections in previously vaccinated horses induced antibody responses that were more rapid and longer lasting than in na¨ıve horses. These experiments used data collected from 33 horses that had been previously vaccinated against WN virus (either with rWNV-ET or with Fort Dodge InnovatorTM ). Twelve of these animals were part of the first year study. Experimental horses received a single injection consisting of 50 g rWNV-ET with aluminum hydroxide (13 horses), 100 g rWNV-ET with aluminum hydroxide (9 horses), or the Fort Dodge InnovatorTM vaccine (11 horses). This injection was administered 8–13 months after the initial immunization course. Serum samples were collected 25, 50, 120, and 180 days later. The bottom panel of Fig. 5 shows the evolution of average anti-E protein antibody levels as determined by ELISA. In previously vaccinated horses, a single injection of either rWNV-ET or killed virus vaccine was sufficient to cause the appearance of specific antibodies that reached a maximum level 25 days post-injection. Comparison of the top and bottom panels of Fig. 5 suggests that the decrease of antibody levels is slower after the 8–13 month-boost than after the initial two injections. As part of this study, we examined the ability of rWNVET to induce the production of memory T cells. Five horses vaccinated with two doses of rWNV-ET adsorbed to aluminum hydroxide were boosted 8–12 months later with a single injection of 50 g rWNV-ET with aluminum hydroxide. Serum samples collected 25 days later were assayed by ELISA (Fig. 6). A single injection was sufficient to trigger the appearance of a high level of antibodies, indicating that
Fig. 6. Memory response induced by immunization with rWNV-ET . Five horses immunized with rWNV-ET were injected with 50 g of rWNV-ET in aluminum hydroxide 8–12 months after the primary immunization series. Serum samples from individual horses were collected before the booster injection and 25 days later. IgG antibody levels were measured at a 1:400 dilution using a rWNV-ET ELISA assay. Each sample was tested in triplicate.
3922
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
horses vaccinated with rWNV-ET harbored memory T cells that were still present 8–12 months after immunization. 3.6. Serum from horses vaccinated with rWNV-ET protects mice against a lethal WN virus challenge We next tested whether sera from vaccinated horses contained antibodies that could protect mice against a lethal viral challenge. To limit the number of mice used in these experiments, this analysis was only performed on selected sera collected 50 days after the initial injection. Groups of 10 mice received serum from vaccinated horses 24 h prior to a lethal WN virus challenge. The survival data among mice receiving serum from individual horses is given in Table 2. All the sera from horses vaccinated with rWNV-ET protected mice against a WN viral challenge. Sera from horses vaccinated with Fort Dodge InnovatorTM vaccine only afforded partial protection.
[31,32]. We were able to develop purification procedures yielding milligram amounts of highly purified antigen. In contrast to the bacterially-produced MBP-E antigen, rWNV-ET does not contain inappropriate intermolecular disulfide bonds. Although rWNV-ET harbors protective epitopes, it is clear that additional epitopes may be present in the WN virion and absent in this recombinant protein. For this reason it is possible that rWNV-ET will not elicit a full protective immune response against WN virus. The antigen doses we used are comparable to those needed to elicit an immune response against a recombinant dengue 4 virus envelope protein in Macaca monkeys [33]. Markedly lower doses were used in studies of vaccination against Japanese encephalitis [34–36] or tick-borne encephalitis [37] viruses. Because we did not observe any adverse event in our studies, we did not determine whether lower doses of rWNVET could be used. 4.2. Efficacy of rWNV-ET as a vaccine against WN virus in animal models
4. Discussion 4.1. A recombinant subunit vaccine against West Nile virus This report describes a novel candidate recombinant subunit vaccine against West Nile (WN) virus. This approach may have several potential advantages over other WN virus vaccine development strategies. Using a single, highly purified antigen reduces the potential for cross reactive immunity to host proteins. Higher antigen doses may also be used, perhaps triggering a stronger immune response directed towards the protective E protein epitopes. High antigen doses may be necessary to evoke protective responses in the elderly and immunocompromised populations, two groups at higher risk of WN virus disease. In contrast to recombinant subunit vaccines, chimeric and attenuated whole virus live vaccines carry an inherent risk of reversion to virulence and of genetic recombination. Such risks were noted in a recent review of live flavivirus vaccine development [30]. More experimental vaccines, including plasmid DNA vaccines, have never been approved for human use and may face lengthy regulatory delays. It is important to note that rWNV-ET is immunogenic in mice and horses in combination with aluminum hydroxide, the only adjuvant approved for human use. The envelope protein is the outer surface protein of flaviviruses that mediates viral entry into host cells. Most protective antibodies against flaviviruses are directed against the envelope protein. We found that Drosophila cells express a recombinant envelope protein with a conformation similar to that of the native protein. This is shown by the fact that serum from WN virus infected horses recognises rWNV-ET and that immunization with rWNV-ET elicits neutralizing antibodies. In this expression system, there was no need to co-express the prM protein, which is essential for correct folding of the native flavivirus envelope proteins in vivo
We demonstrated that mice vaccinated against rWNV-ET were protected against a lethal WN virus challenge. In this initial study, we did not challenge vaccinated horses with WN virus. Instead, we relied on indirect markers of vaccine efficacy. Three lines of evidence suggest that vaccination with rWNV-ET may protect horses. First, rWNV-ET vaccination of na¨ıve horses induces a strong and long-lasting antibody response directed against the viral envelope protein. These antibodies were still detectable 6 months after the initial immunization. In the United States, natural exposure to WN virus occurs primarily during the summer and early fall. Horses vaccinated with rWNV-ET in late spring could have circulating antiviral antibodies during the entire WN season. In previously vaccinated horses, a single booster injection administered 1 year after the initial immunization course was sufficient to elicit circulating antibodies. Interestingly, the concentration of these antibodies declined more slowly than following the initial immunization. Second, the immunoglobulins induced by vaccination were capable of neutralizing WN virus in vitro. Although non-neutralizing antibodies may confer protection, neutralizing antibodies are usually more effective. Third, passive transfer of serum from horses vaccinated with rWNV-ET protected mice against a lethal challenge with WN virus. Using these three indirect markers of efficacy, rWNV-ET appears as effective as the commercially available killed WN virus vaccine, which has an efficacy demonstrated in challenge experiments [8] and in the field. The relatively low antibody levels observed in horses immunized with Fort Dodge InnovatorTM killed virus vaccine were surprising given the established efficacy of this product. Interpretation of this result must take into account the fact that our ELISA assay only detected antibodies that bound rWNVET . Vaccination with the killed virus product may induce antibodies against structural proteins other than the envelope
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
protein or against epitopes that are not present on rWNVET . However, low ELISA titers and low plaque reduction neutralization titers were also observed by other researchers after immunization with the Fort Dodge InnovatorTM vaccine [16,38]. It is possible that these low antibody levels are sufficient to protect horses. Alternatively, protection may be conferred by cellular immunity mechanisms. Antiviral protection induced by vaccination may involve cellular and humoral immunity. We only assessed the humoral immunity response in vaccinated animals. Our results demonstrate that antibodies alone are sufficient to protect mice against a lethal challenge with WN virus. Infecting virus may be immediately neutralized by circulating antibodies in vaccinated animals. We showed that horse antibodies elicited by vaccination persist for several months following immunization. Their level may be sufficient to remain protective during this entire period. In addition, we found that administration of a single dose of antigen several months after immunization resulted in the re-appearance of high antibody levels. Experiments currently in progress show that antibody production occurs in as few as 4 days following restimulation (data not shown). Upon exposure, viral antigens are therefore expected to trigger a rapid memory response and induce the appearance of newly synthesized neutralizing antibodies. This response would be sufficiently rapid to occur before the onset of disease symptoms, which typically takes place 7 days or more after viral exposure in horses and humans [39,40]. The ability of rWNV-ET , when combined with aluminum hydroxide, to induce a protective immune response in mice and horses indicates that this antigen is suitable for further development as an equine and human vaccine.
Acknowledgements We wish to thank Deborah Beck, Amy Gates, and Bonnie Hamid for excellent technical assistance. We are grateful to Dr. Antonio Garmendia, of the University of Connecticut at Storrs, CT, for generously providing serum samples from convalescent horses. Horse sera were evaluated for antibodies against rWNV-ET and NS-5 by Dr. Susan J. Wong, of the New York State Department of Health, Albany, NY, using a fluorescent microsphere immunoassay. This project was supported by NIH SBIR grant AI49646 from the National Institute of Allergy and Infectious Diseases.
References [1] Brinton MA. The molecular biology of West Nile virus: a new invader of the western hemisphere. Annu Rev Microbiol 2002;56:371–402. [2] Gould LH, Fikrig E. West Nile virus: a growing concern? J Clin Invest 2004;113(8):1102–7. [3] Petersen LR, Marfin AA. West Nile virus: a primer for the clinician. Ann Int Med 2002;137(3):173–9.
3923
[4] Solomon T, Ooi MH, Beasley DW, Mallewa M. West Nile encephalitis. BMJ 2003;326(7394):865–9. [5] Ward MP, Levy M, Thacker HL, Ash M, Norman SK, Moore GE, et al. Investigation of an outbreak of encephalomyelitis caused by West Nile virus in 136 horses. J Am Vet Med Assoc 2004;225:84–9. [6] Haley M, Retter AS, Fowler D, Gea-Banacloche J, O’Grady NP. The role for intravenous immunoglobulin in the treatment of West Nile virus encephalitis. Clin Infect Dis 2003;37(6):e88–90. [7] Agrawal AG, Petersen LR. Human immunoglobulin as a treatment for West Nile virus infection. J Infect Dis 2003;188(1):1–4. [8] Ng T, Hathaway D, Jennings N, Champ D, Chiang YW, Chu HJ. Equine vaccine for West Nile virus. Dev Biol (Basel) 2003;114:221–7. [9] Minke JM, Siger L, Karaca K, Austgen L, Gordy P, Bowen R, et al. Recombinant canarypoxvirus vaccine carrying the prM/E genes of West Nile virus protects horses against a West Nile virus-mosquito challenge. Arch Virol 2004:221–30. [10] Arroyo J, Miller CA, Catalan J, Monath TP. Yellow fever vector live-virus vaccines: West Nile virus vaccine development. Trends Mol Med 2001;7(8):350–4. [11] Davis BS, Chang GJ, Cropp B, Rochrig JT, Martin DA, Mitchell CJ, et al. West Nile virus recombinant DNA vaccine protects mouse and horse from virus challenge and expresses in vitro a noninfectious recombinant antigen that can be used in enzyme-linked immunosorbent assays. J Virol 2001;75:4040–7. [12] Lustig S, Olshevsky U, Ben-Nathan D, Lachmi BE, Malkinson M, Kobiler D, et al. A live attenuated West Nile virus strain as a potential veterinary vaccine. Viral Immunol 2000;13:401–10. [13] Monath TP, Arroyo J, Miller C, Guirakhoo F. West Nile virus vaccine. Curr Drug Targets Infect Disord 2001;1(1):37–50. [14] Pletnev AG, Putnak R, Speicher J, Wagar EJ, Vaughn DW. West Nile virus/dengue type 4 virus chimeras that are reduced in neurovirulence and peripheral virulence without loss of immunogenicity or protective efficacy. Proc Natl Acad Sci USA 2002;99(5):3036– 41. [15] Pletnev AG, Claire MS, Elkins R, Speicher J, Murphy BR, Chanock RM. Molecularly engineered live-attenuated chimeric West Nile/dengue virus vaccines protect rhesus monkeys from West Nile virus. Virology 2003;314(1):190–5. [16] Tesh RB, Arroyo J, Travassos Da Rosa AP, Guzman H, Xiao SY, Monath TP. Efficacy of killed virus vaccine, live attenuated chimeric virus vaccine, and passive immunization for prevention of West Nile virus encephalitis in hamster model. Emerg Infect Dis 2002;8(12):1392–7. [17] Tesh RB, Travassos da Rosa AP, Guzman H, Araujo TP, Xiao SY. Immunization with heterologous flaviviruses protective against fatal West Nile encephalitis. Emerg Infect Dis 2002;8(3):245–51. [18] Kofler RM, Aberle JH, Aberle SW, Allison SL, Heinz FX, Mandl CW. Mimicking live flavivirus immunization with a noninfectious RNA vaccine. Proc Natl Acad Sci USA 2004;101(7):1951–6. [19] Arroyo J, Miller C, Catalan J, Myers GA, Ratterree MS, Trent DW, et al. ChimeriVax-West Nile virus live-attenuated vaccine: preclinical evaluation of safety, immunogenicity, and efficacy. J Virol 2004;78:12497–507. [20] Chang GJ, Kuno G, Purdy DE, Davis BS. Recent advancement in flavivirus vaccine development. Expert Rev Vaccines 2004;3(2):199–220. [21] Wang T, Anderson JF, Magnarelli LA, Wong SJ, Koski RA, Fikrig E. Immunization of mice against West Nile virus with recombinant envelope protein. J Immunol 2001;167(9):5273–7. [22] Modis Y, Ogata S, Clements D, Harrison SC. A ligand-binding pocket in the dengue virus envelope glycoprotein. Proc Natl Acad Sci USA 2003;100(12):6986–91. [23] Anderson JF, Andreadis TG, Vossbrinck CR, Tirrell S, Wakem EM, French RA, et al. Isolation of West Nile virus from mosquitoes, crows, and a Cooper’s hawk in Connecticut. Science 1999;286:2331–3.
3924
M. Ledizet et al. / Vaccine 23 (2005) 3915–3924
[24] Anderson JF, Vossbrinck CR, Andreadis TG, Iton A, Beckwith 3rd WH, Mayo DR. A phylogenetic approach to following West Nile virus in Connecticut. Proc Natl Acad Sci USA 2001;98(23):12885–9. [25] Wong SJ, Boyle RH, Demarest VL, Woodmansee AN, Kramer LD, Li H, et al. Immunoassay targeting nonstructural protein 5 to differentiate West Nile virus infection from dengue and St. Louis encephalitis virus infections and from flavivirus vaccination. J Clin Microbiol 2003;41:4217–23. [26] Wong SJ, Demarest VL, Boyle RH, Wang T, Ledizet M, Kar K, et al. Detection of human anti-flavivirus antibodies with a west nile virus recombinant antigen microsphere immunoassay. J Clin Microbiol 2004;42:65–72. [27] Men RH, Bray M, Lai CJ. Carboxy-terminally truncated dengue virus envelope glycoproteins expressed on the cell surface and secreted extracellularly exhibit increased immunogenicity in mice. J Virol 1991;65(3):1400–7. [28] Rey FA, Heinz FX, Mandl C, Kunz C, Harrison SC. The envelope glycoprotein from tick-borne encephalitis virus at 2 A resolution. Nature 1995;375(6529):291–8. [29] Mukhopadhyay S, Kim BS, Chipman PR, Rossmann MG, Kuhn RJ. Structure of West Nile virus. Science 2003;302(5643):248. [30] Seligman SJ, Gould EA. Live flavivirus vaccines: reasons for caution. Lancet 2004;363(9426):2073–5. [31] Konishi E, Mason PW. Proper maturation of the Japanese encephalitis virus envelope glycoprotein requires cosynthesis with the premembrane protein. J Virol 1993;67(3):1672–5. [32] Lorenz IC, Allison SL, Heinz FX, Helenius A. Folding and dimerization of tick-borne encephalitis virus envelope proteins prM and E in the endoplasmic reticulum. J Virol 2002;76(11):5480–91.
[33] Guzman MG, Rodriguez R, Hermida L, Alvarez M, Lazo L, Mune M, et al. Induction of neutralizing antibodies and partial protection from viral challenge in Macaca fascicularis immunized with recombinant dengue 4 virus envelope glycoprotein expressed in Pichia pastoris. Am J Trop Med Hyg 2003;69:129–34. [34] Kuzuhara S, Nakamura H, Hayashida K, Obata J, Abe M, Sonoda K, et al. Non-clinical and phase I clinical trials of a Vero cell-derived inactivated Japanese encephalitis vaccine. Vaccine 2003;21:4519– 26. [35] Mutoh E, Ishikawa T, Takamizawa A, Kurata T, Sata T, Kojima A. Japanese encephalitis subunit vaccine composed of virus-like envelope antigen particles purified from serum-free medium of a highproducer J12#26 cell clone. Vaccine 2004;22(20):2599–608. [36] Srivastava AK, Putnak JR, Lee SH, Hong SP, Moon SB, Barvir DA, et al. A purified inactivated Japanese encephalitis virus vaccine made in Vero cells. Vaccine 2001;19:4557–65. [37] Heinz FX, Allison SL, Stiasny K, Schalich J, Holzmann H, Maudl CW, et al. Recombinant and virion-derived soluble and particulate immunogens for vaccination against tick-borne encephalitis. Vaccine 1995;13:1636–42. [38] Kutzler MA, Baker RJ, Mattson DE. Humoral response to West Nile virus vaccination in alpacas and llamas. J Am Vet Med Assoc 2004;225(3):414–6. [39] Bunning ML, Bowen RA, Cropp CB, Sullivan KG, Davis BS, Komar N, et al. Experimental infection of horses with West Nile virus. Emerg Infect Dis 2002;8:380–6. [40] Pealer LN, Marfin AA, Petersen LR, Lanciotti RS, Page PL, Stramer SL, et al. Transmission of West Nile virus through blood transfusion in the United States in 2002. N Engl J Med 2003;349:1236–45.