- Email: [email protected]
A repA-based ELISA for discriminating cattle vaccinated with Brucella suis 2 from those naturally infected with Brucella abortus and Brucella melitensis
Molecular and Cellular Probes xxx (2014) 1e4
Contents lists available at ScienceDirect
Molecular and Cellular Probes journal homepage: www.elsevier.com/locate/ymcpr
Short communication
A repA-based ELISA for discriminating cattle vaccinated with Brucella suis 2 from those naturally infected with Brucella abortus and Brucella melitensis Jing-Yu Wang a, *, Ning Wu a, Wan-Hua Liu a, Juan-Juan Ren a, Pan Tang a, Yuan-Hao Qiu a, Chi-Young Wang b, Ching-Dong Chang c, Hung-Jen Liu d, e, f, ** a
College of Veterinary Medicine, Northwest A&F University, Yangling 712100, China Department of Veterinary Medicine, National Chung Hsing University, Taichung 402, Taiwan Department of Veterinary Medicine, National Pingtung University of Science and Technology, Pingtung 912, Taiwan d Institute of Molecular Biology, National Chung Hsing University, Taichung 402, Taiwan e Agricultural Biotechnology Center, National Chung Hsing University, Taichung 402, Taiwan f Rong Hsing Research Center for Translational Medicine, National Chung Hsing University, Taichung 402, Taiwan b c
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 April 2014 Accepted 7 June 2014 Available online xxx
The commonest ways of diagnosing brucellosis in animals include the Rose-Bengal plate agglutination test, the buffered plate agglutination test (BPA), the slide agglutination test, the complement fixation test, and the indirect enzyme linked immunosorbent assay (I-ELISA). However, these methods cannot discriminate the Brucella vaccine strain (Brucella suis strain 2; B. suis S2) from naturally acquired virulent strains. Of the six common Brucella species, Brucella melitensis, Brucella abortus, and B. suis are the commonest species occurring in China. To develop an ELISA assay that can differentiate between cows inoculated with B. suis S2 and naturally infected with B. abortus and B. melitensis, genomic sequences from six Brucella spp. (B. melitensis, B. abortus, B. suis, Brucella canis, Brucella neotomae and Brucella ovis) were compared using Basic Local Alignment Search Tool software. One particular gene, the repA-related gene, was found to be a marker that can differentiate B. suis from B. abortus and B. melitensis. The repArelated gene of B. suis was PCR amplified and subcloned into the pET-32a vector. Expressed repA-related protein was purified and used as an antigen. The repA-based ELISA was optimized and used as specific tests. In the present study, serum from animals inoculated with the B. suis S2 vaccine strain had positive repA-based ELISA results. In contrast, the test-positive reference sera against B. abortus and B. melitensis had negative repA-based ELISA results. The concordance rate between B. abortus antibody-negative (based on the repA-based ELISA) and the Brucella gene-positive (based on the ‘Bruce ladder’ multiplex PCR) was 100%. Therefore, the findings suggest that the repA-based ELISA is a useful tool for differentiating cows vaccinated with the B. suis S2 and naturally infected with B. abortus and B. melitensis. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Brucellosis Cattle B. suis S2 repA-related protein Indirect ELISA Differential diagnosis
Brucellosis, caused by Brucella spp., is a major zoonotic disease [1]. As a global epidemic, brucellosis has been reported in over 170 countries [2,3]. Brucellosis infection in animals causes infertility and/or abortion and decreased milk production in dairy herds, resulting in huge economic losses to the livestock industry [4]. Of
* Corresponding author. Tel.: þ86 29 87091117; fax: þ86 29 87091032. ** Corresponding author. Institute of Molecular Biology, National Chung Hsing University, Taichung 402, Taiwan. Tel.: þ886 4 22840485x243; fax: þ886 4 22874879. E-mail addresses: [email protected] (J.-Y. Wang), [email protected] (H.-J. Liu).
the six common Brucella species, named Brucella melitensis, Brucella abortus, Brucella suis, Brucella canis, Brucella microti and Brucella ovis [5]. B. melitensis, B. abortus, and B. suis are the commonest and most pathogenic species in China [6], and can withstand adverse environmental conditions [7,8]. Previous studies [9,10] indicated that brucellosis occurs in many provinces in China. The dominant Brucella spp. in cattle are B. abortus, B. melitensis and B. suis. Strategies for controlling animal brucellosis in China include the culling and destruction of infected animals, and immunization of those at high risk of contracting the disease [11]. Immunization of susceptible animals with attenuated vaccines is an effective way of controlling brucellosis transmission [12]. However, it can be a
http://dx.doi.org/10.1016/j.mcp.2014.06.002 0890-8508/© 2014 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Wang J-Y, et al., A repA-based ELISA for discriminating cattle vaccinated with Brucella suis 2 from those naturally infected with Brucella abortus and Brucella melitensis, Molecular and Cellular Probes (2014), http://dx.doi.org/10.1016/ j.mcp.2014.06.002
2
J.-Y. Wang et al. / Molecular and Cellular Probes xxx (2014) 1e4
challenge to distinguish vaccinated animals from those with naturally acquired Brucella infections [13]. In China, the commonest ways of diagnosing brucellosis in animals include the Rose Bengal plate agglutination test, the serum agglutination test (SAT), the complement fixation test, the indirect enzyme linked immunosorbent assay (ELISA) and the milk ring test (MRT) [6]. Typically, such methods are directed against the lipopolysaccharide [14], but these methods cannot distinguish the vaccine strain from the naturally infected with highly virulent Brucella species [15]. The live, attenuated, B. suis strain 2 has been widely used in immunization against brucellosis in cattle due to its wide host range, weak virulence, and excellent efficacy [16]. Since 1980s, the B. suis S2 vaccine has been used for immunizing cows in more than 10 provinces of China [6]. Therefore, a diagnostic method for differentiating the B. suis S2 immunization strain from natural infections with B. abortus or B. melitensis would be a useful tool for quarantine and brucellosis control in cows in China. Therefore, the aim of this study was to develop a technique that could distinguish cows vaccinated with the B. suis S2 vaccine and those with natural infections with B. melitensis or B. abortus. Along with the development of whole genome sequencing technology, the whole-genome sequences or partial sequences of many Brucella strains have now been deposited in the GenBank database; this makes it possible to screen genes that are absent from or differentially are expressed among the different Brucella strains [17,18]. By using Basic Local Alignment Search Tool (BLAST) software, the whole genomic sequences of B. abortus (NC_006933), B. melitensis (NC_017247), B. suis (CP003129.1), B. canis (CP003175), B. microti (CP001579) and B. ovis (NC_009504) were aligned and compared. Our results revealed that the repA-related gene is present in B. suis, B. canis and B. microti, but not in B. abortus, B. melitensis or B. ovis. (Table 1). This finding is consistent with the previous report [19]. In the present study, the attenuated B. suis S2 strain was purchased from the Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences (China). DNA from B. abortus and B. melitensis was kindly provided by the Inner Mongolia Agricultural University Laboratory, Inner Mongolia, China. DNA from B. suis, B. canis, B. microti and B. ovis were provided by the Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, China. Primers for amplifying the Brucella repA-related gene were designed and then synthesized by GenScript (China). A portion of the repA-related gene was amplified using the following primers: F1 (50 -CCGGAATTCATGAGTAGCCGAAACAG CG-30 ; identical to nucleotides 345471e345489) and R2 (50 -CCCAAGCTTTTA GGAAC CGCCCAGC-30 ; complementary to nucleotides 346514e346529). A primer set comprising F1 and R2 was chosen on the basis of the B. suis VBI22 DNA sequence (GenBank accession number CP003129.1). Amplicons of the size (1059 bp) expected for
Fig. 1. PCR amplification of the repA-related gene in six Brucella spp. The repA-related gene (1059 bp) was successfully amplified by PCR from B. suis S2, B. canis, and B. microti, respectively. Lane M: 2000 bp molecular weight marker. Lanes 1e5: PCR products from B. suis S2; B. canis; B. microt; B. abortus; B. ovis; and B. melitensis.
repA-related gene were successfully amplified from DNA of B. suis S2, B. canis, and B. microti (Fig. 1). As expected, no PCR products were amplified from B. abortus, B. melitensis and B. ovis DNA samples (Fig. 1). An amplicon from the repA gene of B. suis was subcloned into the pET-32a vector, and the recombinant pET-32a/repArelated plasmid was used to transform E. coli BL21 (DE3) [20]. The soluble repA-related protein obtained after induction of the cells was purified using Ni-NTA affinity column. The repA-related protein with a relative molecular mass of 39 KDa was detected (Fig. 2, lane 3). In contrast, protein was not detected in the negative (Escherichia coli and vector) controls (Fig. 2, lanes 1e2). Our results reveal that the repA-related gene of B. suis was highly expressed in E. coli, and the soluble repA-related protein was obtained after affinity purification. The purified repA-related protein of B. suis was analyzed using the respective positive control sera for B. melitensis, B. abortus, B. suis, B. canis, B. microti, and B. ovis. Western blot analysis showed that the repA-related protein of B. suis was recognized by the standard positive sera against B. suis, B. canis and B. microti antibodies (Fig. 3, lanes 1e3), respectively. However, the repA-related protein of B. suis was not detected by the standard positive sera against B. abortus, B. melitensis and B. ovis (Fig. 3, lanes 4e6). The control sera negative for Brucella antibodies and the standard positive sera for B. melitensis, B. abortus, B. suis, B. canis, B. microti and B. ovis were kindly provided by the China Institute of Veterinary Drugs Control. Taken together, our results suggest that the repA-related protein of B. suis could be used in preparation of repA-based ELISA to discriminate between cows inoculated with the B. suis 2 and those naturally infected with B. abortus and B. melitensis. To develop repA-based ELISA, the expressed repA-related protein of B. suis was used as the coating antigen (in 100 ml volume) at 1:100 dilutions in PBS (1 mg of repA-related protein per ml). The plates were incubated at 37 C for 1 h under constant orbital shaking for each step. Wells were then washed and incubated with blocking solution (PBS containing 0.5% Tween 20 [PBS-T] and 20%
Table 1 Basic local alignment search tool (blast) results for repA-related genes from Brucella species/strains. Strain
Species
Accession number
repA-related Sequence homology (%)
Brucella suis VBI22 Brucella microti CCM 4915 Brucella canis ATCC 23365 Brucella abortus bv. 1 str. 9-941 Brucella ovis ATCC 25840 Brucella melitensis M5-90
B. B. B. B.
CP003129 CP001579 CP003175 NC_006933
þ þ þ e
100 99 99 0
B. ovis NC_009504 e B. melitensis NC_017247 e
0 0
suis microti canis abortus
Sequence homology (%) is a comparison between different species of Brucella and the vaccine strain.
Fig. 2. SDS-PAGE analysis of the repA-related protein of B. suis. Lane M: protein Ruler Marker. Lane 1: E. coli only. Lane 2: PET32a vector only and E. coli., Lane 3: repA-related protein of B. suis.
Please cite this article in press as: Wang J-Y, et al., A repA-based ELISA for discriminating cattle vaccinated with Brucella suis 2 from those naturally infected with Brucella abortus and Brucella melitensis, Molecular and Cellular Probes (2014), http://dx.doi.org/10.1016/ j.mcp.2014.06.002
J.-Y. Wang et al. / Molecular and Cellular Probes xxx (2014) 1e4
Fig. 3. Western blot analysis of the expressed repA-related protein of B. suis detected with the respective standard positive sera against B. suis; B. canis; B. microt; B. abortus; B. ovis; and B. melitensis. Lane M: protein marker. Lanes 1e6: The six standard positive sera; B. suis, B. canis, B. microti, B. abortus, B. ovis, and B. melitensis.
Fig. 4. Relative sensitivity and specificity of the ELISA at various cut-off value. Vertical line shows the selected cut-off value of 0.320.
bovine serum) at 37 C for 1 h. All washing procedures were done three times, using washing buffer PBS-T. After washing of the plate, serum diluted in blocking buffer (1:100) was added in 100 ml volume. Sera were incubated for 30 min at 37 C. After washing with PBST a dilution of anti-bovine-HRPO conjugate was added and plates incubated for 1 h at 37 C. Substrate solution (OPD 1 mg/ml containing 4 ml 3% H2O2) was added to each well and the color reaction was developed for 20 min before stopping the reaction with 1 mol/L H2SO4. Optical density (OD) values were measured at 450 nm on a microplate reader. A checkerboard titration was performed for optimization of working dilution of antigen and serum in indirect ELISA. The positive and negative test serum samples were tested in dilutions starting from 1:10. The antigen and serum dilutions that gave maximum difference in absorbance at 450 nm between positive and negative (P/N) were chosen as controls. The
3
indirect ELISA was then validated by detection of antibody in known positive and negative serum samples. All ELISA values were analyzed using a receiver operating characteristic test (ROC) by testing the 110 positive sera samples from cattle vaccinated with the B. suis S2 vaccine strain and 95 serum samples negative for Brucella antibodies assessed by a SAT test. A cut-off value for optimal sensitivity and specificity was determined, before testing the field samples of unknown status. As shown by the checkerboard titration, the optimal coating conditions for the repA-related protein were 37 C for 1 h using a serum dilution of 1:40, an antigen dilution of 1: 400, and a maximal OD difference between the OD450 nm values of the repA-related-positive and negative sera of P/N ¼ 6.02. The estimated sensitivities and specificities for different values were obtained from ROC analysis. An ELISA index of 0.32 was selected as the most appropriate cut-off value in which diagnostic sensitivity and specificity were 91.2% and 96.7%, respectively (Fig. 4). In this work, 510 bovine serum samples were obtained from twenty dairy farms. Among these samples, serum samples (n ¼ 510) from cows were examined using the repA-based ELISA, SAT test, and ELISA kits (IDEXX), respectively. Using SAT and ELISA kits (IDEXX), 54 brucellosis antibody-positive samples from 510 clinical samples of cow serum were detected while 31 samples screened by the repA-based ELISA were found to be test- positive. Not all the 54 brucellosis antibody-positive samples were positive in the repAbased ELISA. This may be due to the cows having been infected with B. abortus and B. melitensis. Previous reports have demonstrated that all known Brucella spp. could be amplified and discriminated from each other using the ‘Bruce-ladder’ multiplex PCR [21]. Cows with Brucella infections can shed these pathogens via their milk [22], therefore, PCR testing of samples of such milk can be utilized to confirm a diagnosis of brucellosis [23]. Prior to the same 54 Brucella SAT-test-positive cows being culled, milk samples were obtained for analysis using the ‘Bruce ladder’ multiplex PCR. In this work, B. melitensis, B. abortus, B. suis, B. canis, B. microti, and B. ovis in the milk samples was detected using the Bruce ladder multiplex PCR [21]. The primers used in this study are shown in Table 2. DNA was extracted from the milk samples obtained from Brucella antibody-positive cows. Using the ‘Bruce ladder’ PCR, the target genes from the six known Brucella spp. in the milk samples were detected. Through comparison of the serum samples that tested positive with the repA-based ELISA with the PCR results for the milk samples from the same cows, we were able to calculate the concordance values for these samples. The results showed that the presence of B. abortus in 15 of the milk samples. However, B. suis-, B. microti-, B. canis- or B. ovis-specific gene fragments were not detected by the multiplex PCR (data not shown). Further analysis showed that, of
Table 2 Oligonucleotides used in the Bruce-ladder multiplex PCR assays. Brucella spp.
Primer
Source of genetic differences
Amplicon size (bp)
Sequence (5'e3')
Reference
B. ovis
IS711 insertion in BMEI0998 in B. abortus RB51 and deletion of 15,079 bp in BMEI0993-BMEI1012 in B. ovis Deletion of 25,061 bp in BMEII826-BMEII0850 in B. abortus
1682
B. canis
BMEI1436f BMEI1435r
Deletion of 976 bp in BMEI1435 in B. canis
794
B. melitensis
BMEI0752f BMEI0752r
Point mutation in BMEI0752 in B. melitensis Rev.1
218
B. microti
BMEII0987f BMEII0987r
Deletion of 2203 bp in BMEII0986-BMEII0988 in B. microti
152
B. suis
BMEI1688 f BMEI1687r
Deletion of 20,883 bp in BMEI1674-BMEI1703 in B. suis
278
ATCCTATTGCCCCGATAAGG GCTTCGCATTTTCACTGTAGC TTTACACAGGCAATCCAGCA GCGTCCAGTTGTTGTTGATG ACGCAGACGACCTTCGGTAT TTTATCCATCGCCCTGTCAC CAGGCAAACCCTCAGAAGC GATGTGGTAACGCACACCAA CGCAGACAGTGACCATCAAA GTATTCAGCCCCCGTTACCT TCAACTGCGTGAACAATGCT GCGGGCTCTATCTCAAGGTC
[24]
B. abortus
BMEI0998 f BMEI0997r BMEII0843f BMEII0844r
1071
[25] [17] [26] [17] [17]
Please cite this article in press as: Wang J-Y, et al., A repA-based ELISA for discriminating cattle vaccinated with Brucella suis 2 from those naturally infected with Brucella abortus and Brucella melitensis, Molecular and Cellular Probes (2014), http://dx.doi.org/10.1016/ j.mcp.2014.06.002
4
J.-Y. Wang et al. / Molecular and Cellular Probes xxx (2014) 1e4
the 15 milk samples containing the B. abortus-specific gene fragments, all were test-negative by the repA-based ELISA; therefore, they were considered to be derived from natural infections with B. abortus or B. melitensis in these cows. The B. abortus antibodynegative (based on the repA-based ELISA) and the Brucella genepositive (based on the ‘Bruce ladder’ multiplex PCR) samples had a concordance rate of 100%. The results suggests that the repArelated protein of B. suis could be specific for discriminating between cows vaccinated with the B. suis 2 vaccine and naturally infected with B. abortus and B. melitensis. In conclusion, the findings of the present study indicate that the repA-related protein-based ELISA has good specificity, sensitivity and reproducibility and can be used to discriminate between cow vaccinated with attenuated B. suis 2 vaccine and those naturally infected with B. abortus or B. melitensis. This method should be a useful tool for quarantine purposes as well as assisting in the control of brucellosis, which is an important concern for the livestock industry and public health. Acknowledgments This work was supported by grants from the National Science Foundation of China (grant no. 31272577) and from the National Science Council of Taiwan (NSC 101-2321-B-005-020-MY2) and the Ministry of Education, Taiwan under the ATU plan. References [1] Haque N, Bari M, Hossain M, Muhammad N, Ahmed S, Rahman A, et al. An overview of brucellosis. Mymensingh Med J 2011;20:742e7. che P, Jacques I, Grayon M, Al-Dahouk S, Bouchon P, Denoeud F, et al. [2] Le Fle Evaluation and selection of tandem repeat loci for a Brucella MLVA typing assay. BMC Microbiol 2006;6:9. [3] Godfroid J, Nielsen K, Saegerman C. Diagnosis of brucellosis in livestock and wildlife. Croat Med J 2010;51:296e305. € sler U, Neubauer H, Tomaso H. Brucellosis[4] Gwida M, Al-Dahouk S, Melzer F, Ro regionally emerging zoonotic disease? Croat Med J 2010;51:289e95. n I. Brucella evolution and taxonomy. Vet [5] Moreno E, Cloeckaert A, Moriyo Microbiol 2002;90:209e27. [6] Deqiu S, Donglou X, Jiming Y. Epidemiology and control of brucellosis in China. Vet Microbiol 2002;90:165e82. €hler S. Interactions between professional [7] Liautard JP, Gross A, Dornand J, Ko phagocytes and Brucella spp. Microbiologia 1996;12:197e206.
[8] Covert J, Mathison AJ, Eskra L, Banai M, Splitter J. Brucella melitensis, B. neotomae and B. ovis elicit common and distinctive macrophage defense transcriptional responses. Exp Biol Med 2009;234:1450e67. [9] Deqiu S. Control and research of brucellosis in China during 1949-1999 years. Chin J Epidemiol 2000;21:55e7 [In Chinese)]. [10] Tuerhong N, Gu W, He Q, Rehe M, Buhi Q, Yigan B, et al. Advance in brucellosis. Prog Vet Med 2007;7:82e7 [In Chinese)]. [11] Zhao Z, Yan F, Ji W, Luo D, Liu X, Xing L, et al. Identification of immunoreactive proteins of Brucella melitensis by immunoproteomics. Sci China Life Sci 2011;54:880e7. [12] Vemulapalli R, He Y, Sriranganathan N, Boyle SM, Schurig GG. Brucella abortus RB51: enhancing vaccine efficacy and developing multivalent vaccines. Vet Microbiol 2002;90:521e32. [13] Boschiroli ML, Foulongne V, O'Callaghan D. Brucellosis: a worldwide zoonosis. Curr Opin Microbiol 2001;4:58e64. [14] Sangari F, Agüero J. Molecular basis of Brucella pathogenicity: an update. Microbiologia 1996;12:207e18. [15] Xing J, Wang J, Zhao B. Progress on brucellosis and diagnostic methods. Prog Vet Med 2009;30:70e3 [In Chinese)]. nez de Bagüe s M. Efficacy of Brucella suis strain 2 [16] Blasco J, Marin C, Jime vaccine against Brucella ovis in rams. Vaccine 1993;11:1291e4. [17] Rajashekara G, Glasner JD, Glover DA, Splitter GA. Comparative wholegenome hybridization reveals genomic islands in Brucella species. J Bacteriol 2004;186:5040e51. [18] Halling SM, Peterson-Burch BD, Bricker BJ, Zuerner RL, Qing Z, Li LL, et al. Completion of the genome sequence of Brucella abortus and comparison to the highly similar genomes of Brucella melitensis and Brucella suis. J Bacteriol 2005;187:2715e26. [19] Ratushna V, Sturgill D, Ramamoorthy S, Reichow S, He Y, Lathigra R, et al. Molecular targets for rapid identification of Brucella spp. BMC Microbiol 2006;6:13. [20] Sambrook J, Russell DW. Molecular cloning: a laboratory manual. 3rd ed. New York, USA: Cold Spring Harbor; 2001. pp. 1481e508. pez Gon ~ i I, Garcia Yoldi D, Marin C, De Miguel M, Munoz P, Blasco J, et al. [21] Lo Evaluation of a multiplex PCR assay (Bruce-ladder) for molecular typing of all Brucella species, including the vaccine strains. J Clin Microbiol 2008;46:3484e7. [22] Ning P, Guo K, Xu L, Xu R, Zhang C, Cheng Y, et al. Evaluation of Brucella infection of cows by PCR detection of Brucella DNA in raw milk. J Dairy Sci 2012;95:4863e7. [23] Hamdy M, Amin A. Detection of Brucella species in the milk of infected cattle, sheep, goats and camels by PCR. Vet J 2002;163:299e305. ~ oz PM, Vizmanos JL, Lo pez-Gon ~ i I. [24] García-Yoldi D, Marín C, de Miguel MJ, Mun Multiplex PCR assay for the identification and differentiation of all Brucella species and the vaccine strains Brucella abortus S19 and RB51 and Brucella melitensis Rev1. Clin Chem 2006;52(4):779e81. [25] Vizcaíno N, Verger M, Grayon M, Zygmunt S, Cloeckaert A. DNA polymorphism at the omp-31 locus of Brucella spp.: evidence for a large deletion in Brucella abortus, and other species-specific markers. Microbiology 1997;143:2913e21. [26] Cloeckaert A, Grayon M, Grepinet O. Identification of Brucella melitensis vaccine strain Rev.1 by PCR-RFLP based on a mutation in the rpsL gene. Vaccine 2002;20:2546e50.
Please cite this article in press as: Wang J-Y, et al., A repA-based ELISA for discriminating cattle vaccinated with Brucella suis 2 from those naturally infected with Brucella abortus and Brucella melitensis, Molecular and Cellular Probes (2014), http://dx.doi.org/10.1016/ j.mcp.2014.06.002
Contents lists available at ScienceDirect
Molecular and Cellular Probes journal homepage: www.elsevier.com/locate/ymcpr
Short communication
A repA-based ELISA for discriminating cattle vaccinated with Brucella suis 2 from those naturally infected with Brucella abortus and Brucella melitensis Jing-Yu Wang a, *, Ning Wu a, Wan-Hua Liu a, Juan-Juan Ren a, Pan Tang a, Yuan-Hao Qiu a, Chi-Young Wang b, Ching-Dong Chang c, Hung-Jen Liu d, e, f, ** a
College of Veterinary Medicine, Northwest A&F University, Yangling 712100, China Department of Veterinary Medicine, National Chung Hsing University, Taichung 402, Taiwan Department of Veterinary Medicine, National Pingtung University of Science and Technology, Pingtung 912, Taiwan d Institute of Molecular Biology, National Chung Hsing University, Taichung 402, Taiwan e Agricultural Biotechnology Center, National Chung Hsing University, Taichung 402, Taiwan f Rong Hsing Research Center for Translational Medicine, National Chung Hsing University, Taichung 402, Taiwan b c
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 April 2014 Accepted 7 June 2014 Available online xxx
The commonest ways of diagnosing brucellosis in animals include the Rose-Bengal plate agglutination test, the buffered plate agglutination test (BPA), the slide agglutination test, the complement fixation test, and the indirect enzyme linked immunosorbent assay (I-ELISA). However, these methods cannot discriminate the Brucella vaccine strain (Brucella suis strain 2; B. suis S2) from naturally acquired virulent strains. Of the six common Brucella species, Brucella melitensis, Brucella abortus, and B. suis are the commonest species occurring in China. To develop an ELISA assay that can differentiate between cows inoculated with B. suis S2 and naturally infected with B. abortus and B. melitensis, genomic sequences from six Brucella spp. (B. melitensis, B. abortus, B. suis, Brucella canis, Brucella neotomae and Brucella ovis) were compared using Basic Local Alignment Search Tool software. One particular gene, the repA-related gene, was found to be a marker that can differentiate B. suis from B. abortus and B. melitensis. The repArelated gene of B. suis was PCR amplified and subcloned into the pET-32a vector. Expressed repA-related protein was purified and used as an antigen. The repA-based ELISA was optimized and used as specific tests. In the present study, serum from animals inoculated with the B. suis S2 vaccine strain had positive repA-based ELISA results. In contrast, the test-positive reference sera against B. abortus and B. melitensis had negative repA-based ELISA results. The concordance rate between B. abortus antibody-negative (based on the repA-based ELISA) and the Brucella gene-positive (based on the ‘Bruce ladder’ multiplex PCR) was 100%. Therefore, the findings suggest that the repA-based ELISA is a useful tool for differentiating cows vaccinated with the B. suis S2 and naturally infected with B. abortus and B. melitensis. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Brucellosis Cattle B. suis S2 repA-related protein Indirect ELISA Differential diagnosis
Brucellosis, caused by Brucella spp., is a major zoonotic disease [1]. As a global epidemic, brucellosis has been reported in over 170 countries [2,3]. Brucellosis infection in animals causes infertility and/or abortion and decreased milk production in dairy herds, resulting in huge economic losses to the livestock industry [4]. Of
* Corresponding author. Tel.: þ86 29 87091117; fax: þ86 29 87091032. ** Corresponding author. Institute of Molecular Biology, National Chung Hsing University, Taichung 402, Taiwan. Tel.: þ886 4 22840485x243; fax: þ886 4 22874879. E-mail addresses: [email protected] (J.-Y. Wang), [email protected] (H.-J. Liu).
the six common Brucella species, named Brucella melitensis, Brucella abortus, Brucella suis, Brucella canis, Brucella microti and Brucella ovis [5]. B. melitensis, B. abortus, and B. suis are the commonest and most pathogenic species in China [6], and can withstand adverse environmental conditions [7,8]. Previous studies [9,10] indicated that brucellosis occurs in many provinces in China. The dominant Brucella spp. in cattle are B. abortus, B. melitensis and B. suis. Strategies for controlling animal brucellosis in China include the culling and destruction of infected animals, and immunization of those at high risk of contracting the disease [11]. Immunization of susceptible animals with attenuated vaccines is an effective way of controlling brucellosis transmission [12]. However, it can be a
http://dx.doi.org/10.1016/j.mcp.2014.06.002 0890-8508/© 2014 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Wang J-Y, et al., A repA-based ELISA for discriminating cattle vaccinated with Brucella suis 2 from those naturally infected with Brucella abortus and Brucella melitensis, Molecular and Cellular Probes (2014), http://dx.doi.org/10.1016/ j.mcp.2014.06.002
2
J.-Y. Wang et al. / Molecular and Cellular Probes xxx (2014) 1e4
challenge to distinguish vaccinated animals from those with naturally acquired Brucella infections [13]. In China, the commonest ways of diagnosing brucellosis in animals include the Rose Bengal plate agglutination test, the serum agglutination test (SAT), the complement fixation test, the indirect enzyme linked immunosorbent assay (ELISA) and the milk ring test (MRT) [6]. Typically, such methods are directed against the lipopolysaccharide [14], but these methods cannot distinguish the vaccine strain from the naturally infected with highly virulent Brucella species [15]. The live, attenuated, B. suis strain 2 has been widely used in immunization against brucellosis in cattle due to its wide host range, weak virulence, and excellent efficacy [16]. Since 1980s, the B. suis S2 vaccine has been used for immunizing cows in more than 10 provinces of China [6]. Therefore, a diagnostic method for differentiating the B. suis S2 immunization strain from natural infections with B. abortus or B. melitensis would be a useful tool for quarantine and brucellosis control in cows in China. Therefore, the aim of this study was to develop a technique that could distinguish cows vaccinated with the B. suis S2 vaccine and those with natural infections with B. melitensis or B. abortus. Along with the development of whole genome sequencing technology, the whole-genome sequences or partial sequences of many Brucella strains have now been deposited in the GenBank database; this makes it possible to screen genes that are absent from or differentially are expressed among the different Brucella strains [17,18]. By using Basic Local Alignment Search Tool (BLAST) software, the whole genomic sequences of B. abortus (NC_006933), B. melitensis (NC_017247), B. suis (CP003129.1), B. canis (CP003175), B. microti (CP001579) and B. ovis (NC_009504) were aligned and compared. Our results revealed that the repA-related gene is present in B. suis, B. canis and B. microti, but not in B. abortus, B. melitensis or B. ovis. (Table 1). This finding is consistent with the previous report [19]. In the present study, the attenuated B. suis S2 strain was purchased from the Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences (China). DNA from B. abortus and B. melitensis was kindly provided by the Inner Mongolia Agricultural University Laboratory, Inner Mongolia, China. DNA from B. suis, B. canis, B. microti and B. ovis were provided by the Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, China. Primers for amplifying the Brucella repA-related gene were designed and then synthesized by GenScript (China). A portion of the repA-related gene was amplified using the following primers: F1 (50 -CCGGAATTCATGAGTAGCCGAAACAG CG-30 ; identical to nucleotides 345471e345489) and R2 (50 -CCCAAGCTTTTA GGAAC CGCCCAGC-30 ; complementary to nucleotides 346514e346529). A primer set comprising F1 and R2 was chosen on the basis of the B. suis VBI22 DNA sequence (GenBank accession number CP003129.1). Amplicons of the size (1059 bp) expected for
Fig. 1. PCR amplification of the repA-related gene in six Brucella spp. The repA-related gene (1059 bp) was successfully amplified by PCR from B. suis S2, B. canis, and B. microti, respectively. Lane M: 2000 bp molecular weight marker. Lanes 1e5: PCR products from B. suis S2; B. canis; B. microt; B. abortus; B. ovis; and B. melitensis.
repA-related gene were successfully amplified from DNA of B. suis S2, B. canis, and B. microti (Fig. 1). As expected, no PCR products were amplified from B. abortus, B. melitensis and B. ovis DNA samples (Fig. 1). An amplicon from the repA gene of B. suis was subcloned into the pET-32a vector, and the recombinant pET-32a/repArelated plasmid was used to transform E. coli BL21 (DE3) [20]. The soluble repA-related protein obtained after induction of the cells was purified using Ni-NTA affinity column. The repA-related protein with a relative molecular mass of 39 KDa was detected (Fig. 2, lane 3). In contrast, protein was not detected in the negative (Escherichia coli and vector) controls (Fig. 2, lanes 1e2). Our results reveal that the repA-related gene of B. suis was highly expressed in E. coli, and the soluble repA-related protein was obtained after affinity purification. The purified repA-related protein of B. suis was analyzed using the respective positive control sera for B. melitensis, B. abortus, B. suis, B. canis, B. microti, and B. ovis. Western blot analysis showed that the repA-related protein of B. suis was recognized by the standard positive sera against B. suis, B. canis and B. microti antibodies (Fig. 3, lanes 1e3), respectively. However, the repA-related protein of B. suis was not detected by the standard positive sera against B. abortus, B. melitensis and B. ovis (Fig. 3, lanes 4e6). The control sera negative for Brucella antibodies and the standard positive sera for B. melitensis, B. abortus, B. suis, B. canis, B. microti and B. ovis were kindly provided by the China Institute of Veterinary Drugs Control. Taken together, our results suggest that the repA-related protein of B. suis could be used in preparation of repA-based ELISA to discriminate between cows inoculated with the B. suis 2 and those naturally infected with B. abortus and B. melitensis. To develop repA-based ELISA, the expressed repA-related protein of B. suis was used as the coating antigen (in 100 ml volume) at 1:100 dilutions in PBS (1 mg of repA-related protein per ml). The plates were incubated at 37 C for 1 h under constant orbital shaking for each step. Wells were then washed and incubated with blocking solution (PBS containing 0.5% Tween 20 [PBS-T] and 20%
Table 1 Basic local alignment search tool (blast) results for repA-related genes from Brucella species/strains. Strain
Species
Accession number
repA-related Sequence homology (%)
Brucella suis VBI22 Brucella microti CCM 4915 Brucella canis ATCC 23365 Brucella abortus bv. 1 str. 9-941 Brucella ovis ATCC 25840 Brucella melitensis M5-90
B. B. B. B.
CP003129 CP001579 CP003175 NC_006933
þ þ þ e
100 99 99 0
B. ovis NC_009504 e B. melitensis NC_017247 e
0 0
suis microti canis abortus
Sequence homology (%) is a comparison between different species of Brucella and the vaccine strain.
Fig. 2. SDS-PAGE analysis of the repA-related protein of B. suis. Lane M: protein Ruler Marker. Lane 1: E. coli only. Lane 2: PET32a vector only and E. coli., Lane 3: repA-related protein of B. suis.
Please cite this article in press as: Wang J-Y, et al., A repA-based ELISA for discriminating cattle vaccinated with Brucella suis 2 from those naturally infected with Brucella abortus and Brucella melitensis, Molecular and Cellular Probes (2014), http://dx.doi.org/10.1016/ j.mcp.2014.06.002
J.-Y. Wang et al. / Molecular and Cellular Probes xxx (2014) 1e4
Fig. 3. Western blot analysis of the expressed repA-related protein of B. suis detected with the respective standard positive sera against B. suis; B. canis; B. microt; B. abortus; B. ovis; and B. melitensis. Lane M: protein marker. Lanes 1e6: The six standard positive sera; B. suis, B. canis, B. microti, B. abortus, B. ovis, and B. melitensis.
Fig. 4. Relative sensitivity and specificity of the ELISA at various cut-off value. Vertical line shows the selected cut-off value of 0.320.
bovine serum) at 37 C for 1 h. All washing procedures were done three times, using washing buffer PBS-T. After washing of the plate, serum diluted in blocking buffer (1:100) was added in 100 ml volume. Sera were incubated for 30 min at 37 C. After washing with PBST a dilution of anti-bovine-HRPO conjugate was added and plates incubated for 1 h at 37 C. Substrate solution (OPD 1 mg/ml containing 4 ml 3% H2O2) was added to each well and the color reaction was developed for 20 min before stopping the reaction with 1 mol/L H2SO4. Optical density (OD) values were measured at 450 nm on a microplate reader. A checkerboard titration was performed for optimization of working dilution of antigen and serum in indirect ELISA. The positive and negative test serum samples were tested in dilutions starting from 1:10. The antigen and serum dilutions that gave maximum difference in absorbance at 450 nm between positive and negative (P/N) were chosen as controls. The
3
indirect ELISA was then validated by detection of antibody in known positive and negative serum samples. All ELISA values were analyzed using a receiver operating characteristic test (ROC) by testing the 110 positive sera samples from cattle vaccinated with the B. suis S2 vaccine strain and 95 serum samples negative for Brucella antibodies assessed by a SAT test. A cut-off value for optimal sensitivity and specificity was determined, before testing the field samples of unknown status. As shown by the checkerboard titration, the optimal coating conditions for the repA-related protein were 37 C for 1 h using a serum dilution of 1:40, an antigen dilution of 1: 400, and a maximal OD difference between the OD450 nm values of the repA-related-positive and negative sera of P/N ¼ 6.02. The estimated sensitivities and specificities for different values were obtained from ROC analysis. An ELISA index of 0.32 was selected as the most appropriate cut-off value in which diagnostic sensitivity and specificity were 91.2% and 96.7%, respectively (Fig. 4). In this work, 510 bovine serum samples were obtained from twenty dairy farms. Among these samples, serum samples (n ¼ 510) from cows were examined using the repA-based ELISA, SAT test, and ELISA kits (IDEXX), respectively. Using SAT and ELISA kits (IDEXX), 54 brucellosis antibody-positive samples from 510 clinical samples of cow serum were detected while 31 samples screened by the repA-based ELISA were found to be test- positive. Not all the 54 brucellosis antibody-positive samples were positive in the repAbased ELISA. This may be due to the cows having been infected with B. abortus and B. melitensis. Previous reports have demonstrated that all known Brucella spp. could be amplified and discriminated from each other using the ‘Bruce-ladder’ multiplex PCR [21]. Cows with Brucella infections can shed these pathogens via their milk [22], therefore, PCR testing of samples of such milk can be utilized to confirm a diagnosis of brucellosis [23]. Prior to the same 54 Brucella SAT-test-positive cows being culled, milk samples were obtained for analysis using the ‘Bruce ladder’ multiplex PCR. In this work, B. melitensis, B. abortus, B. suis, B. canis, B. microti, and B. ovis in the milk samples was detected using the Bruce ladder multiplex PCR [21]. The primers used in this study are shown in Table 2. DNA was extracted from the milk samples obtained from Brucella antibody-positive cows. Using the ‘Bruce ladder’ PCR, the target genes from the six known Brucella spp. in the milk samples were detected. Through comparison of the serum samples that tested positive with the repA-based ELISA with the PCR results for the milk samples from the same cows, we were able to calculate the concordance values for these samples. The results showed that the presence of B. abortus in 15 of the milk samples. However, B. suis-, B. microti-, B. canis- or B. ovis-specific gene fragments were not detected by the multiplex PCR (data not shown). Further analysis showed that, of
Table 2 Oligonucleotides used in the Bruce-ladder multiplex PCR assays. Brucella spp.
Primer
Source of genetic differences
Amplicon size (bp)
Sequence (5'e3')
Reference
B. ovis
IS711 insertion in BMEI0998 in B. abortus RB51 and deletion of 15,079 bp in BMEI0993-BMEI1012 in B. ovis Deletion of 25,061 bp in BMEII826-BMEII0850 in B. abortus
1682
B. canis
BMEI1436f BMEI1435r
Deletion of 976 bp in BMEI1435 in B. canis
794
B. melitensis
BMEI0752f BMEI0752r
Point mutation in BMEI0752 in B. melitensis Rev.1
218
B. microti
BMEII0987f BMEII0987r
Deletion of 2203 bp in BMEII0986-BMEII0988 in B. microti
152
B. suis
BMEI1688 f BMEI1687r
Deletion of 20,883 bp in BMEI1674-BMEI1703 in B. suis
278
ATCCTATTGCCCCGATAAGG GCTTCGCATTTTCACTGTAGC TTTACACAGGCAATCCAGCA GCGTCCAGTTGTTGTTGATG ACGCAGACGACCTTCGGTAT TTTATCCATCGCCCTGTCAC CAGGCAAACCCTCAGAAGC GATGTGGTAACGCACACCAA CGCAGACAGTGACCATCAAA GTATTCAGCCCCCGTTACCT TCAACTGCGTGAACAATGCT GCGGGCTCTATCTCAAGGTC
[24]
B. abortus
BMEI0998 f BMEI0997r BMEII0843f BMEII0844r
1071
[25] [17] [26] [17] [17]
Please cite this article in press as: Wang J-Y, et al., A repA-based ELISA for discriminating cattle vaccinated with Brucella suis 2 from those naturally infected with Brucella abortus and Brucella melitensis, Molecular and Cellular Probes (2014), http://dx.doi.org/10.1016/ j.mcp.2014.06.002
4
J.-Y. Wang et al. / Molecular and Cellular Probes xxx (2014) 1e4
the 15 milk samples containing the B. abortus-specific gene fragments, all were test-negative by the repA-based ELISA; therefore, they were considered to be derived from natural infections with B. abortus or B. melitensis in these cows. The B. abortus antibodynegative (based on the repA-based ELISA) and the Brucella genepositive (based on the ‘Bruce ladder’ multiplex PCR) samples had a concordance rate of 100%. The results suggests that the repArelated protein of B. suis could be specific for discriminating between cows vaccinated with the B. suis 2 vaccine and naturally infected with B. abortus and B. melitensis. In conclusion, the findings of the present study indicate that the repA-related protein-based ELISA has good specificity, sensitivity and reproducibility and can be used to discriminate between cow vaccinated with attenuated B. suis 2 vaccine and those naturally infected with B. abortus or B. melitensis. This method should be a useful tool for quarantine purposes as well as assisting in the control of brucellosis, which is an important concern for the livestock industry and public health. Acknowledgments This work was supported by grants from the National Science Foundation of China (grant no. 31272577) and from the National Science Council of Taiwan (NSC 101-2321-B-005-020-MY2) and the Ministry of Education, Taiwan under the ATU plan. References [1] Haque N, Bari M, Hossain M, Muhammad N, Ahmed S, Rahman A, et al. An overview of brucellosis. Mymensingh Med J 2011;20:742e7. che P, Jacques I, Grayon M, Al-Dahouk S, Bouchon P, Denoeud F, et al. [2] Le Fle Evaluation and selection of tandem repeat loci for a Brucella MLVA typing assay. BMC Microbiol 2006;6:9. [3] Godfroid J, Nielsen K, Saegerman C. Diagnosis of brucellosis in livestock and wildlife. Croat Med J 2010;51:296e305. € sler U, Neubauer H, Tomaso H. Brucellosis[4] Gwida M, Al-Dahouk S, Melzer F, Ro regionally emerging zoonotic disease? Croat Med J 2010;51:289e95. n I. Brucella evolution and taxonomy. Vet [5] Moreno E, Cloeckaert A, Moriyo Microbiol 2002;90:209e27. [6] Deqiu S, Donglou X, Jiming Y. Epidemiology and control of brucellosis in China. Vet Microbiol 2002;90:165e82. €hler S. Interactions between professional [7] Liautard JP, Gross A, Dornand J, Ko phagocytes and Brucella spp. Microbiologia 1996;12:197e206.
[8] Covert J, Mathison AJ, Eskra L, Banai M, Splitter J. Brucella melitensis, B. neotomae and B. ovis elicit common and distinctive macrophage defense transcriptional responses. Exp Biol Med 2009;234:1450e67. [9] Deqiu S. Control and research of brucellosis in China during 1949-1999 years. Chin J Epidemiol 2000;21:55e7 [In Chinese)]. [10] Tuerhong N, Gu W, He Q, Rehe M, Buhi Q, Yigan B, et al. Advance in brucellosis. Prog Vet Med 2007;7:82e7 [In Chinese)]. [11] Zhao Z, Yan F, Ji W, Luo D, Liu X, Xing L, et al. Identification of immunoreactive proteins of Brucella melitensis by immunoproteomics. Sci China Life Sci 2011;54:880e7. [12] Vemulapalli R, He Y, Sriranganathan N, Boyle SM, Schurig GG. Brucella abortus RB51: enhancing vaccine efficacy and developing multivalent vaccines. Vet Microbiol 2002;90:521e32. [13] Boschiroli ML, Foulongne V, O'Callaghan D. Brucellosis: a worldwide zoonosis. Curr Opin Microbiol 2001;4:58e64. [14] Sangari F, Agüero J. Molecular basis of Brucella pathogenicity: an update. Microbiologia 1996;12:207e18. [15] Xing J, Wang J, Zhao B. Progress on brucellosis and diagnostic methods. Prog Vet Med 2009;30:70e3 [In Chinese)]. nez de Bagüe s M. Efficacy of Brucella suis strain 2 [16] Blasco J, Marin C, Jime vaccine against Brucella ovis in rams. Vaccine 1993;11:1291e4. [17] Rajashekara G, Glasner JD, Glover DA, Splitter GA. Comparative wholegenome hybridization reveals genomic islands in Brucella species. J Bacteriol 2004;186:5040e51. [18] Halling SM, Peterson-Burch BD, Bricker BJ, Zuerner RL, Qing Z, Li LL, et al. Completion of the genome sequence of Brucella abortus and comparison to the highly similar genomes of Brucella melitensis and Brucella suis. J Bacteriol 2005;187:2715e26. [19] Ratushna V, Sturgill D, Ramamoorthy S, Reichow S, He Y, Lathigra R, et al. Molecular targets for rapid identification of Brucella spp. BMC Microbiol 2006;6:13. [20] Sambrook J, Russell DW. Molecular cloning: a laboratory manual. 3rd ed. New York, USA: Cold Spring Harbor; 2001. pp. 1481e508. pez Gon ~ i I, Garcia Yoldi D, Marin C, De Miguel M, Munoz P, Blasco J, et al. [21] Lo Evaluation of a multiplex PCR assay (Bruce-ladder) for molecular typing of all Brucella species, including the vaccine strains. J Clin Microbiol 2008;46:3484e7. [22] Ning P, Guo K, Xu L, Xu R, Zhang C, Cheng Y, et al. Evaluation of Brucella infection of cows by PCR detection of Brucella DNA in raw milk. J Dairy Sci 2012;95:4863e7. [23] Hamdy M, Amin A. Detection of Brucella species in the milk of infected cattle, sheep, goats and camels by PCR. Vet J 2002;163:299e305. ~ oz PM, Vizmanos JL, Lo pez-Gon ~ i I. [24] García-Yoldi D, Marín C, de Miguel MJ, Mun Multiplex PCR assay for the identification and differentiation of all Brucella species and the vaccine strains Brucella abortus S19 and RB51 and Brucella melitensis Rev1. Clin Chem 2006;52(4):779e81. [25] Vizcaíno N, Verger M, Grayon M, Zygmunt S, Cloeckaert A. DNA polymorphism at the omp-31 locus of Brucella spp.: evidence for a large deletion in Brucella abortus, and other species-specific markers. Microbiology 1997;143:2913e21. [26] Cloeckaert A, Grayon M, Grepinet O. Identification of Brucella melitensis vaccine strain Rev.1 by PCR-RFLP based on a mutation in the rpsL gene. Vaccine 2002;20:2546e50.
Please cite this article in press as: Wang J-Y, et al., A repA-based ELISA for discriminating cattle vaccinated with Brucella suis 2 from those naturally infected with Brucella abortus and Brucella melitensis, Molecular and Cellular Probes (2014), http://dx.doi.org/10.1016/ j.mcp.2014.06.002