- Email: [email protected]
A reverse dot blot assay for the expanded screening of eleven Chinese G6PD mutations
Clinica Chimica Acta 418 (2013) 45–49
Contents lists available at SciVerse ScienceDirect
Clinica Chimica Acta journal homepage: www.elsevier.com/locate/clinchim
A reverse dot blot assay for the expanded screening of eleven Chinese G6PD mutations Xiaomei Lu a,⁎, 1, Liang Hua b, 1, Ting Zhang c, Siping Li a, Xuejin Fan a, Qi Peng a, Wenrui Li a, Junqin Ye a, Jianling Long a, Xiaoguang He a a b c
Dongguan Institute of Pediatrics, Guangdong Medical Collage Affiliated Shilong Boai Hospital, 68 Xihu Third Road, Dongguan, Guangdong, China Guangzhou Women and Children Medical Center, 318 Renmin Middle Road, Guangzhou, Guangdong, China Department of Genetics, School of Medicine, Zhejiang University, 866 Yuhangtang Road, Hangzhou, China
a r t i c l e
i n f o
Article history: Received 14 November 2012 Received in revised form 9 December 2012 Accepted 18 December 2012 Available online 8 January 2013 Keywords: Glucose 6-phosphate dehydrogenase deficiency (G6PD) Reverse dot blot (RDB) Multiplex polymerase reaction (M-PCR) Point mutation Genetic screening
a b s t r a c t Background: Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a multiethnic inherited disease with a particularly high prevalence in tropical and subtropical regions including southern China. A convenient and reliable method is required to detect common G6PD mutations in the Chinese population. Methods: We developed a reverse dot blot (RDB) assay for the expanded screening of eleven mutations (c.95A>G, c.392G>T, c.871G>A, c.1004C>T, c.1004C>A, c.1024C>T, c.1360C>T, c.1376G>T, c.1381G>A, c.1387C>T, c.1388G>A). The method consists of a single-tube multiplex PCR amplification of four fragments in the G6PD target sequence of wild-type and mutant genomic DNA samples followed by hybridization to a test strip containing allele-specific oligonucleotide probes. We applied our method to a group of 213 unrelated Chinese patients. Results: The test had a detection rate of 95.8%, validated by direct sequencing in a blind study with 100% concordance. Conclusions: The results demonstrate that our reverse dot blot assay is an easy, reliable, high-yield and costeffective method for genetic screening to identify G6PD patients and carriers among the Chinese population. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Glucose 6-phosphate dehydrogenase (G6PD) deficiency is one of the most common X-linked enzymopathies, affecting more than 400 million people worldwide [1,2]. G6PD deficiency manifests in different clinical phenotypes, including neonatal jaundice and hemolysis induced by ingestion of fava beans or oxidant drugs. The G6PD gene, mutations in which are the molecular genetic basis of the disorder, is located at Xq28, consists of 13 exons and encodes a 515 amino acid polypeptide. To date, more than 180 G6PD mutations have been documented [3], and each ethnic population presents a characteristic mutation profile. There are at least 21 distinct point mutations reported in the Chinese population, eight of which (c.95A>G, c.392G>T, c.871G>A, c.1004C>T, c.1024C>T, c.1360C>T, c.1376G>T, c.1388G>A) account for more than 80% of cases (Table 1) [4–7]. Presently, different methods are used to detect G6PD mutations, including classic polymerase chain reaction/restriction enzyme analysis (PCR-RFLP) [8], amplification refractory mutation system (ARMS) [9] and denaturing high-performance liquid chromatography (DHPLC) [10]. However, for convenience and technical simplicity, reverse dot ⁎ Corresponding author. Tel.: +86 86186505; fax: +86 86118287. E-mail address: [email protected] (X. Lu). 1 These two authors contributed equally in this study. 0009-8981/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.cca.2012.12.023
blot assay has been developed and applied in several genetic disorders including G6PD deficiency [11]. In this study, we employed a reverse dot blot assay for the expanded screening of the eight most common G6PD mutations and three adjacent mutations (c.1004C>A, c.1381G>A and c.1387C>T) in 213 unrelated Chinese patients. All results were confirmed by direct sequencing in a blind study. 2. Materials and methods 2.1. Subjects A total of 243 unrelated samples (80 males and 163 females) composed of 213 G6PD deficient cases and 30 normal controls were investigated and used to test the specificity and accuracy of the assay. G6PD deficient cases ranged from newborn to 37 years of age. Samples were collected at Shilong Boai Hospital, affiliated with Guangdong Medical College. The quantitative assay of G6PD activity was measured with G6PD/6GPD ratios (Guangzhou Miji Company). Informed written consent was obtained from each patient's parent or guardian. The study was approved by the Institutional Ethnics Committee of Shilong Boai Hospital. Positive controls for the establishment of the assay were clinical blood samples with seven common G6PD mutations (c.95A>G,
46
X. Lu et al. / Clinica Chimica Acta 418 (2013) 45–49
Table 1 The frequency of the eleven G6PD mutations reported in Chinese population both in our experiment and literature. Mutation types
Hemizygote
Heterozygote
Homozygote
Total
Frequency % (experiment)
Frequency % (literature [12])
G1376T G1388A A95G G871A G392T C1024T C1004T G1381A C1004A C1360T C1387T G1376T/G1388A G1376T/A95G G1388A/G871A Mutation unknown
28 24 13 6 3 1 1 1 0 0 0 0 0 0 0
47 38 18 8 6 4 0 0 0 0 0 2 1 1 0
2 0 0 0 0 0 0 0 0 0 0 0 0 0 0
77 62 31 14 9 5 1 1 0 0 0 2 1 1 9
36.2 29.1 14.6 6.6 4.2 2.3 0.5 0.5 0 0 0 0.9 0.5 0.5 4.2
3.6–53.0 10.5–64.0 2.2–26.8 2.8–11.1 0.8–8.3 1.0–28.6 0.8–1.23
c.392G>T, c.871G>A, c.1004C>T, c.1024C>T, c.1376G>T and c.1388G>A) and one adjacent mutation c.1381G>A, previously identified by DNA sequencing. The remaining three (c.1004C>A, c.1360C>T and c.1387C>T) were obtained by site-directed mutagenesis (Shanghai Shanjing Biological Company).
PCR reaction using primers of 3F/3R and 4F/4R, to amplify the segments containing the specific sites (c.1004C>A, c.1360C>T and c.1387C>T), was performed with normal sample. Ligature of the PCR product and pGEM-T Easy vector was transformed to JM109 competent cells. The white clones were selected from plates containing ampicillin, X-gal and IPTG, and gained the desired plasmids as confirmed by sequencing. These correct plasmids were amplified with one of the three sets of allele-specific primers (Table 2) and the remaining template DNA was eliminated by DpnI. Finally, the PCR products were treated with the same process, including ligation, transformation and selection, and the plasmid of interest was selected and validated again by direct-sequencing. 2.3. Genomic DNA extraction Genomic DNA was extracted from peripheral whole blood samples with the QIAamp DNA Blood Mini kit (QIAGEN) according to the instructions of manufacturer. The qualitative estimation of DNA was carried out by spectrophotometry (Nanodrop). 2.4. Design of primers and probes Four sets of primers were designed for multiplex polymerase chain reaction (M-PCR) to amplify exons 2, 5, 9, 11 and 12 of the G6PD gene spanning the 10 mutation sites (Table 3). The 5′ end of primers was labeled with biotin. A total of 19 probes including 8 normal and 11 mutant probes covering the point mutation sites were designed (Table 4). Three of the normal probes were used as controls
Table 2 Three sets of allele-specific primers for site-directed mutagenesis. Mutation
Primers
Sequence of primers (5′–3′)
C1004A
1004A-P1 1004A-P2 1360T-P1 1360T-P2 1387T-P1 1387T-P2
gcgggtccaccaccgAacacttttgcagccgtc gacggctgcaaaagtgTcggtggtggacccgc ccagatgcacttcgtgTgcaggtgaggcccagc gctgggcctcacctgcAcacgaagtgcatctgg gctccgtgaggcctggAgtattttcaccccactgc gcagtggggtgaaaatacTccaggcctcacggagc
C1387T a
3.5–54.1
for six mutant probes: 1004N for C1004T and C1004A; 1376N for G1376T and G1381A; and 1388N for G1388A and C1387T. In order to monitor the performance of the color development system, an additional probe PC was synthesized as an indicator. 2.5. Multiplex PCR amplification
2.2. Site-directed mutagenesis
C1360T
0.8–4.6
The capital letters indicate the mutagenesis of the base.
Multiplex PCR amplification was performed on an Mx3000p PCR machine (Stratagene) in a final volume of 50 μL containing 1 × PCR buffer (MgCl2 plus), 1 × Q buffer, 0.2 mmol/L of each dNTPs (Promega), 0.2 μmol/L each of the eight primers, 0.1 U/μL HotStarTaq DNA Polymerase (QIAGEN) and 1 μg genome DNA. PCR conditions were per the manufacturer's instructions: pre-denaturation at 96 °C for 15 min; 35 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s; and a final extension at 72 °C for 5 min. The products were subsequently visualized by electrophoresis on a 1.5% agarose gel. 2.6. Reverse dot blot assay All 20 probes (mentioned above) were fixed to nylon strips (PALL Biodyne C) arrayed as indicated in Fig 1. The PCR products were heated to 95 °C or higher then immediately cooled to 0 °C. Each strip and 8 ml hybridization solution A (2 × SSC, 0.1% SDS, pH7.4) was pre-heated to 45 °C after which the denatured PCR products were added and incubated at 45 °C for 2 h in a screw-top tube. Subsequently, the strips were washed with wash solution B (0.5 × SSC, 0.1% SDS, pH7.4) at 45 °C for 10 min. Afterwards the strips were transferred to a hybridization solution A diluted mixture containing 0.125 U/mL Streptavidin-POD conjugate (Roche, Mannheim, Germany) and incubated at room temperature for 30 min. Excess conjugate was removed with another two washes of solution A. Finally, the color developing solution composed of pH5.4 0.1 mg/mL TMB, 0.015‰ H2O2 and 0.1 mol/L sodium citrate was added and the color reaction developed for 20 min. Blue dots indicated the positive results of detection. Table 3 Multiplex PCR primers.
Exon 2 Exon 5 Exon 9 Exon 11/12
Sequences of primer (5′–3′)
Mutations
Size (bp)
1F ACAGCGTCATGGCAGAGCAG 1R GGGCGACCAGAGCAAAACT 2F TGCCCGCAACTCCTATGTGG 2R AGGACTCGTGAATGTTCTTGGTGA 3F GTCATCCCTGCACCCCAACTC 3R GCCGCAGCGCAGGATGAAG 4F TGGTGGCAGGCAGTGGCATCA 4R CGTGGCGGGGGTGGAGGTG
95
354
392
167
871, 1004, 1024
414
1360, 1376, 1381, 1387, 1388
538
X. Lu et al. / Clinica Chimica Acta 418 (2013) 45–49
47
Table 4 G6PD gene mutation detection probes. Name of probe
Mutation detection probe (5′ →3′)
A95G NH2-GGATACACGCATATTCATCA G392T NH2-CTCCACCTGGTGTCACAG G871A NH2-AGGTCAAGATGTTGAAATG C1004T NH2-CACCACCGTCACTTTTGCA C1004A NH2-CACCACCGACACTTTTGCA C1024T NH2-AGCCGTCGTCTTCTATGT C1360T NH2-GCACTTCGTGTGCAGGTGA G1376T NH2-GAGCTCCTTGAGGCCTGG G1381A NH2-GAGCTCCGTGAGACCTGG C1387T NH2-CCTGGTGTATTTTCACCCC G1388A NH2-CCTGGCATATTTTCACCCC PC bio-ATGCATGCATGCATGCATGC-NH2
All samples were analyzed independently by DNA sequencing to confirm the accuracy of the assay. 3. Results 3.1. Establishment of the assay The assay was established using DNA samples from eight male patients and three plasmid samples with the remaining three known mutations introduced by site-directed mutagenesis. When analyzing the results, observation of color development of the PC spot served as the primary positive control. An absence of color development of all or the majority of control probes served as a negative control. Since the G6PD gene is X-linked, gender was confirmed to match the number of alleles observed in each analysis. In this assay, the eleven positive control samples tested showed expected results. Normal DNA samples showed positive blue colored spots for the PC spot and all the control probes, and negative white colored spots for the mutation probes. Homozygous and hemizygous DNA samples showed blue colored spots for the appropriate mutant probes as well as negatively colored white spots for the corresponding probes (Fig. 2, Nos. 1–8). Heterozygous and compound heterozygous DNA samples showed blue colored spots for one or two mutant probes, respectively, and the corresponding white colored control probe spots (Fig. 2, Nos. 12–14, 18–20, 15–17). 3.2. Validation of the assay Among the 213 G6PD deficient cases assayed, mutations in 204 patients were detected giving a mutation detection frequency of 95.8%. The three most common mutations in this patient group were c.1376G>T, c.1388G>A and c.95A>G. Mutations c.1004C>A, c.1360C>T and c.1387C>T were not detected in any of the samples (Table 1). All samples were subsequently examined by DNA sequencing and demonstrated 100% concordance between the two methodologies (Fig. 3).
Fig. 1. Layout of the probes' dotting in the nylon strip designed for the reverse dot blot assay. N denotes the wild-type probes corresponding to each mutant probes (denoted as each mutation). PC is located at the lower right corner of the strip.
Name of probe
Normal probe (5′→ 3′)
95N 392N 871N 1004N
NH2-GGATACACACATATTCATCA NH2-CTCCACCTGGGGTCACAG NH2-AGGTCAAGGTGTTGAAATG NH2-CACCACCGCCACTTTTGCA
1024N 1360N 1376/1381N
NH2-AGCCGTCGTCCTCTATGT NH2-GCACTTCGTGCGCAGGTGA NH2-GAGCTCCGTGAGGCCTGG
1387/1388N
NH2-CCTGGCGTATTTTCACCCC
4. Discussion G6PD deficiency is endemic in certain parts of the world, particularly in the tropics and subtropics, including southern China. Traditional laboratory diagnosis for G6PD deficiency has involved both protein-based and DNA-based testing. Routine enzyme activity detection methodology has included methemoglobin reduction testing, fluorescence spots methods, nitrocellulose tetrazole blue (NBT) slip methods, and G6P/6PG ratio methods, among others. However, few reliably identify G6PD deficiency heterozygous females, which is a critical aspect of disease prevention. As a classic monogenic disease, simple molecular genetic diagnosis is the most effective means of detecting both affected males and carrier females. Studies of G6PD using WHO standardized procedure have documented more than 400 biochemical enzyme variants, and more than 180 G6PD mutations have been documented. Most of the mutations reported are single-base substitutions that lead to amino acid exchanges (missense mutations), and no large-deletions or entire gene deletions have been reported. Mutations are distributed throughout the 12 exons except exon 1. Thus, a reliable, rapid and inexpensive method for detecting G6PD point mutations would be helpful to patients, their families, the physicians that treat them, and the laboratories responsible for testing. To date, common methods used to detect G6PD mutations (ARMS, PCR/RE) have presented variable challenges such as insufficient accuracy, insufficient simplicity to run, and a limitation of mutations detected in a single run. Successful reverse dot blot assay has been reported in the genotyping of six common Chinese G6PD mutations and one polymorphism [11]. Our study expands the numbers of mutations screened and is designed based on the recently updated G6PD mutation database. Our search of the literature between 2006 and 2012 pertaining to the Chinese population led us to add c.392G>T and c.1360C>T to the common mutation screening panel. Notably, c.392G>T has been described as one of the six most frequent mutations both by T. Yan et al. [5] and J.B. Yan et al. [6] and is thus an important addition, as our study confirmed. The three mutations (c.1004C>A, c.1381G>A, c.1387C>T), are adjacent to c.1004C>T and c.1376G>T, therefore enabling us to amplify one fragment spanning several mutations, and even to make the same normal probes for two neighboring mutations. Furthermore, in this reverse dot blot assay, we have modified some steps, such as the addition of a PC probe, to increase the accuracy of the assay. Our results for 243 unrelated G6PD samples showed 100% concordance with independent direct sequencing. Our reverse dot blot assay can simultaneously genotype the eleven most common Chinese G6PD mutations for hemizygous, heterozygous and compound heterozygous individuals in one single test strip with a detection rate of more than 95%. Given that our patient group is derived from a very typical south China population, we expect our test strip will be useful with a good detection rate in most of south China.
48
X. Lu et al. / Clinica Chimica Acta 418 (2013) 45–49
Fig. 2. Representative results of genotyping eleven G6PD deficiency mutations using reverse dot blot assay. Hemizygote: (1) G1376T; (2) G1388A; (3) A95G; (4) G392T; (5) G871A; (6) C1024T; (7) G1381A; and (9) C1004T. Vectors obtained by site-directed mutagenesis: (8) C1387T; (10) C1004A; and (11) C1360T. Heterozygotes and homozygote (12) G1376T/N; (13) G1388A/N; (14) G871A/N; (15) G1376T/A95G; (16) G1376T/G1388A; (17) G1388A/G871A; (18) A95G/N; (19) C1024T/N; and (20) G392T/N.
Fig. 3. Representative sequencing results of eleven G6PD deficiency mutations. The mutation sites are indicated by arrows. (A) A95G/N; (B) A95G hemizygote; (C) G392T/N; (D) G871A/N; (E) G1024T/N; (F) G1376T hemizygote; (G) G1376T/N; and (H) G1388A hemizygote.
X. Lu et al. / Clinica Chimica Acta 418 (2013) 45–49
This method is easily performed with common equipment, with low cost and can be completed in 6 h. It is one of the most ideal methods for smaller clinics and laboratories with limited resources to perform front-line testing to detect G6PD without having to resort to direct DNA sequencing. Conflict of interest None declared. Acknowledgments We are grateful for the participation of all the patients and their families. We thank Dr. Michael Raff for his meticulous editing of the manuscript. This work was partially supported by the Dongguan Bureau of Science and Technology for the City Key Program of Science and Technology (Project Number: 2011105102017). References [1] Beutler E. G6PD: population genetics and clinical manifestations. Blood Rev 1996;10: 45–52. [2] Beutler E. Glucose-6-phosphate dehydrogenase deficiency: a historical perspective. Blood 2008;111:16–24.
49
[3] Minucci A, Moradkhani K, Hwang MJ, Zuppi C, Giardina B, Capoluongo E. Glucose-6-phosphate dehydrogenase (G6PD) mutations database: review of the “old” and update of the new mutations. Blood Cells Mol Dis 2012;48:154–65. [4] Du CS, Xu YK, Hua XY, Wu QL, Liu LB. Glucose-6-phosphate dehydrogenase variants and their frequency in Guangdong, China. Hum Genet 1988;80:385–8. [5] Yan T, Cai R, Mo O, et al. Incidence and complete molecular characterization of glucose-6-phosphate dehydrogenase deficiency in the Guangxi Zhuang autonomous region of southern China: description of four novel mutations. Haematologica 2006;91:1321–8. [6] Yan JB, Xu HP, Xiong C, et al. Rapid and reliable detection of glucose-6-phosphate dehydrogenase (G6PD) gene mutations in Han Chinese using high-resolution melting analysis. J Mol Diagn 2010;12:305–11. [7] Jiang W, Yu G, Liu P, et al. Structure and function of glucose-6-phosphate dehydrogenase-deficient variants in Chinese population. Hum Genet 2006;119: 463–78. [8] Tang TK, Huang CS, Huang MJ, Tam KB, Yeh CH, Tang CJ. Diverse point mutations result in glucose-6-phosphate dehydrogenase (G6PD) polymorphism in Taiwan. Blood 1992;79:2135–40. [9] Maffi D, Pasquino MT, Caprari P, et al. Identification of G6PD Mediterranean mutation by amplification refractory mutation system. Clin Chim Acta 2002;321: 43–7. [10] Wu G, Liang WH, Zhu J, et al. Rapid, simultaneous genotyping of 10 Southeast Asian glucose-6-phosphate dehydrogenase deficiency-causing mutations and a silent polymorphism by multiplex primer extension/denaturing HPLC assay. Clin Chem 2005;51:1288–91. [11] Li L, Zhou YQ, Xiao QZ, Yan TZ, Xu XM. Development and evaluation of a reverse dot blot assay for the simultaneous detection of six common Chinese G6PD mutations and one polymorphism. Blood Cells Mol Dis 2008;41:17–21. [12] Pan SL. G6PD deficiency: distribution in East and Southeast Asia and positive selection by malaria. Chin J Health Birth Child Care 2007;13:42–52.
Contents lists available at SciVerse ScienceDirect
Clinica Chimica Acta journal homepage: www.elsevier.com/locate/clinchim
A reverse dot blot assay for the expanded screening of eleven Chinese G6PD mutations Xiaomei Lu a,⁎, 1, Liang Hua b, 1, Ting Zhang c, Siping Li a, Xuejin Fan a, Qi Peng a, Wenrui Li a, Junqin Ye a, Jianling Long a, Xiaoguang He a a b c
Dongguan Institute of Pediatrics, Guangdong Medical Collage Affiliated Shilong Boai Hospital, 68 Xihu Third Road, Dongguan, Guangdong, China Guangzhou Women and Children Medical Center, 318 Renmin Middle Road, Guangzhou, Guangdong, China Department of Genetics, School of Medicine, Zhejiang University, 866 Yuhangtang Road, Hangzhou, China
a r t i c l e
i n f o
Article history: Received 14 November 2012 Received in revised form 9 December 2012 Accepted 18 December 2012 Available online 8 January 2013 Keywords: Glucose 6-phosphate dehydrogenase deficiency (G6PD) Reverse dot blot (RDB) Multiplex polymerase reaction (M-PCR) Point mutation Genetic screening
a b s t r a c t Background: Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a multiethnic inherited disease with a particularly high prevalence in tropical and subtropical regions including southern China. A convenient and reliable method is required to detect common G6PD mutations in the Chinese population. Methods: We developed a reverse dot blot (RDB) assay for the expanded screening of eleven mutations (c.95A>G, c.392G>T, c.871G>A, c.1004C>T, c.1004C>A, c.1024C>T, c.1360C>T, c.1376G>T, c.1381G>A, c.1387C>T, c.1388G>A). The method consists of a single-tube multiplex PCR amplification of four fragments in the G6PD target sequence of wild-type and mutant genomic DNA samples followed by hybridization to a test strip containing allele-specific oligonucleotide probes. We applied our method to a group of 213 unrelated Chinese patients. Results: The test had a detection rate of 95.8%, validated by direct sequencing in a blind study with 100% concordance. Conclusions: The results demonstrate that our reverse dot blot assay is an easy, reliable, high-yield and costeffective method for genetic screening to identify G6PD patients and carriers among the Chinese population. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Glucose 6-phosphate dehydrogenase (G6PD) deficiency is one of the most common X-linked enzymopathies, affecting more than 400 million people worldwide [1,2]. G6PD deficiency manifests in different clinical phenotypes, including neonatal jaundice and hemolysis induced by ingestion of fava beans or oxidant drugs. The G6PD gene, mutations in which are the molecular genetic basis of the disorder, is located at Xq28, consists of 13 exons and encodes a 515 amino acid polypeptide. To date, more than 180 G6PD mutations have been documented [3], and each ethnic population presents a characteristic mutation profile. There are at least 21 distinct point mutations reported in the Chinese population, eight of which (c.95A>G, c.392G>T, c.871G>A, c.1004C>T, c.1024C>T, c.1360C>T, c.1376G>T, c.1388G>A) account for more than 80% of cases (Table 1) [4–7]. Presently, different methods are used to detect G6PD mutations, including classic polymerase chain reaction/restriction enzyme analysis (PCR-RFLP) [8], amplification refractory mutation system (ARMS) [9] and denaturing high-performance liquid chromatography (DHPLC) [10]. However, for convenience and technical simplicity, reverse dot ⁎ Corresponding author. Tel.: +86 86186505; fax: +86 86118287. E-mail address: [email protected] (X. Lu). 1 These two authors contributed equally in this study. 0009-8981/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.cca.2012.12.023
blot assay has been developed and applied in several genetic disorders including G6PD deficiency [11]. In this study, we employed a reverse dot blot assay for the expanded screening of the eight most common G6PD mutations and three adjacent mutations (c.1004C>A, c.1381G>A and c.1387C>T) in 213 unrelated Chinese patients. All results were confirmed by direct sequencing in a blind study. 2. Materials and methods 2.1. Subjects A total of 243 unrelated samples (80 males and 163 females) composed of 213 G6PD deficient cases and 30 normal controls were investigated and used to test the specificity and accuracy of the assay. G6PD deficient cases ranged from newborn to 37 years of age. Samples were collected at Shilong Boai Hospital, affiliated with Guangdong Medical College. The quantitative assay of G6PD activity was measured with G6PD/6GPD ratios (Guangzhou Miji Company). Informed written consent was obtained from each patient's parent or guardian. The study was approved by the Institutional Ethnics Committee of Shilong Boai Hospital. Positive controls for the establishment of the assay were clinical blood samples with seven common G6PD mutations (c.95A>G,
46
X. Lu et al. / Clinica Chimica Acta 418 (2013) 45–49
Table 1 The frequency of the eleven G6PD mutations reported in Chinese population both in our experiment and literature. Mutation types
Hemizygote
Heterozygote
Homozygote
Total
Frequency % (experiment)
Frequency % (literature [12])
G1376T G1388A A95G G871A G392T C1024T C1004T G1381A C1004A C1360T C1387T G1376T/G1388A G1376T/A95G G1388A/G871A Mutation unknown
28 24 13 6 3 1 1 1 0 0 0 0 0 0 0
47 38 18 8 6 4 0 0 0 0 0 2 1 1 0
2 0 0 0 0 0 0 0 0 0 0 0 0 0 0
77 62 31 14 9 5 1 1 0 0 0 2 1 1 9
36.2 29.1 14.6 6.6 4.2 2.3 0.5 0.5 0 0 0 0.9 0.5 0.5 4.2
3.6–53.0 10.5–64.0 2.2–26.8 2.8–11.1 0.8–8.3 1.0–28.6 0.8–1.23
c.392G>T, c.871G>A, c.1004C>T, c.1024C>T, c.1376G>T and c.1388G>A) and one adjacent mutation c.1381G>A, previously identified by DNA sequencing. The remaining three (c.1004C>A, c.1360C>T and c.1387C>T) were obtained by site-directed mutagenesis (Shanghai Shanjing Biological Company).
PCR reaction using primers of 3F/3R and 4F/4R, to amplify the segments containing the specific sites (c.1004C>A, c.1360C>T and c.1387C>T), was performed with normal sample. Ligature of the PCR product and pGEM-T Easy vector was transformed to JM109 competent cells. The white clones were selected from plates containing ampicillin, X-gal and IPTG, and gained the desired plasmids as confirmed by sequencing. These correct plasmids were amplified with one of the three sets of allele-specific primers (Table 2) and the remaining template DNA was eliminated by DpnI. Finally, the PCR products were treated with the same process, including ligation, transformation and selection, and the plasmid of interest was selected and validated again by direct-sequencing. 2.3. Genomic DNA extraction Genomic DNA was extracted from peripheral whole blood samples with the QIAamp DNA Blood Mini kit (QIAGEN) according to the instructions of manufacturer. The qualitative estimation of DNA was carried out by spectrophotometry (Nanodrop). 2.4. Design of primers and probes Four sets of primers were designed for multiplex polymerase chain reaction (M-PCR) to amplify exons 2, 5, 9, 11 and 12 of the G6PD gene spanning the 10 mutation sites (Table 3). The 5′ end of primers was labeled with biotin. A total of 19 probes including 8 normal and 11 mutant probes covering the point mutation sites were designed (Table 4). Three of the normal probes were used as controls
Table 2 Three sets of allele-specific primers for site-directed mutagenesis. Mutation
Primers
Sequence of primers (5′–3′)
C1004A
1004A-P1 1004A-P2 1360T-P1 1360T-P2 1387T-P1 1387T-P2
gcgggtccaccaccgAacacttttgcagccgtc gacggctgcaaaagtgTcggtggtggacccgc ccagatgcacttcgtgTgcaggtgaggcccagc gctgggcctcacctgcAcacgaagtgcatctgg gctccgtgaggcctggAgtattttcaccccactgc gcagtggggtgaaaatacTccaggcctcacggagc
C1387T a
3.5–54.1
for six mutant probes: 1004N for C1004T and C1004A; 1376N for G1376T and G1381A; and 1388N for G1388A and C1387T. In order to monitor the performance of the color development system, an additional probe PC was synthesized as an indicator. 2.5. Multiplex PCR amplification
2.2. Site-directed mutagenesis
C1360T
0.8–4.6
The capital letters indicate the mutagenesis of the base.
Multiplex PCR amplification was performed on an Mx3000p PCR machine (Stratagene) in a final volume of 50 μL containing 1 × PCR buffer (MgCl2 plus), 1 × Q buffer, 0.2 mmol/L of each dNTPs (Promega), 0.2 μmol/L each of the eight primers, 0.1 U/μL HotStarTaq DNA Polymerase (QIAGEN) and 1 μg genome DNA. PCR conditions were per the manufacturer's instructions: pre-denaturation at 96 °C for 15 min; 35 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s; and a final extension at 72 °C for 5 min. The products were subsequently visualized by electrophoresis on a 1.5% agarose gel. 2.6. Reverse dot blot assay All 20 probes (mentioned above) were fixed to nylon strips (PALL Biodyne C) arrayed as indicated in Fig 1. The PCR products were heated to 95 °C or higher then immediately cooled to 0 °C. Each strip and 8 ml hybridization solution A (2 × SSC, 0.1% SDS, pH7.4) was pre-heated to 45 °C after which the denatured PCR products were added and incubated at 45 °C for 2 h in a screw-top tube. Subsequently, the strips were washed with wash solution B (0.5 × SSC, 0.1% SDS, pH7.4) at 45 °C for 10 min. Afterwards the strips were transferred to a hybridization solution A diluted mixture containing 0.125 U/mL Streptavidin-POD conjugate (Roche, Mannheim, Germany) and incubated at room temperature for 30 min. Excess conjugate was removed with another two washes of solution A. Finally, the color developing solution composed of pH5.4 0.1 mg/mL TMB, 0.015‰ H2O2 and 0.1 mol/L sodium citrate was added and the color reaction developed for 20 min. Blue dots indicated the positive results of detection. Table 3 Multiplex PCR primers.
Exon 2 Exon 5 Exon 9 Exon 11/12
Sequences of primer (5′–3′)
Mutations
Size (bp)
1F ACAGCGTCATGGCAGAGCAG 1R GGGCGACCAGAGCAAAACT 2F TGCCCGCAACTCCTATGTGG 2R AGGACTCGTGAATGTTCTTGGTGA 3F GTCATCCCTGCACCCCAACTC 3R GCCGCAGCGCAGGATGAAG 4F TGGTGGCAGGCAGTGGCATCA 4R CGTGGCGGGGGTGGAGGTG
95
354
392
167
871, 1004, 1024
414
1360, 1376, 1381, 1387, 1388
538
X. Lu et al. / Clinica Chimica Acta 418 (2013) 45–49
47
Table 4 G6PD gene mutation detection probes. Name of probe
Mutation detection probe (5′ →3′)
A95G NH2-GGATACACGCATATTCATCA G392T NH2-CTCCACCTGGTGTCACAG G871A NH2-AGGTCAAGATGTTGAAATG C1004T NH2-CACCACCGTCACTTTTGCA C1004A NH2-CACCACCGACACTTTTGCA C1024T NH2-AGCCGTCGTCTTCTATGT C1360T NH2-GCACTTCGTGTGCAGGTGA G1376T NH2-GAGCTCCTTGAGGCCTGG G1381A NH2-GAGCTCCGTGAGACCTGG C1387T NH2-CCTGGTGTATTTTCACCCC G1388A NH2-CCTGGCATATTTTCACCCC PC bio-ATGCATGCATGCATGCATGC-NH2
All samples were analyzed independently by DNA sequencing to confirm the accuracy of the assay. 3. Results 3.1. Establishment of the assay The assay was established using DNA samples from eight male patients and three plasmid samples with the remaining three known mutations introduced by site-directed mutagenesis. When analyzing the results, observation of color development of the PC spot served as the primary positive control. An absence of color development of all or the majority of control probes served as a negative control. Since the G6PD gene is X-linked, gender was confirmed to match the number of alleles observed in each analysis. In this assay, the eleven positive control samples tested showed expected results. Normal DNA samples showed positive blue colored spots for the PC spot and all the control probes, and negative white colored spots for the mutation probes. Homozygous and hemizygous DNA samples showed blue colored spots for the appropriate mutant probes as well as negatively colored white spots for the corresponding probes (Fig. 2, Nos. 1–8). Heterozygous and compound heterozygous DNA samples showed blue colored spots for one or two mutant probes, respectively, and the corresponding white colored control probe spots (Fig. 2, Nos. 12–14, 18–20, 15–17). 3.2. Validation of the assay Among the 213 G6PD deficient cases assayed, mutations in 204 patients were detected giving a mutation detection frequency of 95.8%. The three most common mutations in this patient group were c.1376G>T, c.1388G>A and c.95A>G. Mutations c.1004C>A, c.1360C>T and c.1387C>T were not detected in any of the samples (Table 1). All samples were subsequently examined by DNA sequencing and demonstrated 100% concordance between the two methodologies (Fig. 3).
Fig. 1. Layout of the probes' dotting in the nylon strip designed for the reverse dot blot assay. N denotes the wild-type probes corresponding to each mutant probes (denoted as each mutation). PC is located at the lower right corner of the strip.
Name of probe
Normal probe (5′→ 3′)
95N 392N 871N 1004N
NH2-GGATACACACATATTCATCA NH2-CTCCACCTGGGGTCACAG NH2-AGGTCAAGGTGTTGAAATG NH2-CACCACCGCCACTTTTGCA
1024N 1360N 1376/1381N
NH2-AGCCGTCGTCCTCTATGT NH2-GCACTTCGTGCGCAGGTGA NH2-GAGCTCCGTGAGGCCTGG
1387/1388N
NH2-CCTGGCGTATTTTCACCCC
4. Discussion G6PD deficiency is endemic in certain parts of the world, particularly in the tropics and subtropics, including southern China. Traditional laboratory diagnosis for G6PD deficiency has involved both protein-based and DNA-based testing. Routine enzyme activity detection methodology has included methemoglobin reduction testing, fluorescence spots methods, nitrocellulose tetrazole blue (NBT) slip methods, and G6P/6PG ratio methods, among others. However, few reliably identify G6PD deficiency heterozygous females, which is a critical aspect of disease prevention. As a classic monogenic disease, simple molecular genetic diagnosis is the most effective means of detecting both affected males and carrier females. Studies of G6PD using WHO standardized procedure have documented more than 400 biochemical enzyme variants, and more than 180 G6PD mutations have been documented. Most of the mutations reported are single-base substitutions that lead to amino acid exchanges (missense mutations), and no large-deletions or entire gene deletions have been reported. Mutations are distributed throughout the 12 exons except exon 1. Thus, a reliable, rapid and inexpensive method for detecting G6PD point mutations would be helpful to patients, their families, the physicians that treat them, and the laboratories responsible for testing. To date, common methods used to detect G6PD mutations (ARMS, PCR/RE) have presented variable challenges such as insufficient accuracy, insufficient simplicity to run, and a limitation of mutations detected in a single run. Successful reverse dot blot assay has been reported in the genotyping of six common Chinese G6PD mutations and one polymorphism [11]. Our study expands the numbers of mutations screened and is designed based on the recently updated G6PD mutation database. Our search of the literature between 2006 and 2012 pertaining to the Chinese population led us to add c.392G>T and c.1360C>T to the common mutation screening panel. Notably, c.392G>T has been described as one of the six most frequent mutations both by T. Yan et al. [5] and J.B. Yan et al. [6] and is thus an important addition, as our study confirmed. The three mutations (c.1004C>A, c.1381G>A, c.1387C>T), are adjacent to c.1004C>T and c.1376G>T, therefore enabling us to amplify one fragment spanning several mutations, and even to make the same normal probes for two neighboring mutations. Furthermore, in this reverse dot blot assay, we have modified some steps, such as the addition of a PC probe, to increase the accuracy of the assay. Our results for 243 unrelated G6PD samples showed 100% concordance with independent direct sequencing. Our reverse dot blot assay can simultaneously genotype the eleven most common Chinese G6PD mutations for hemizygous, heterozygous and compound heterozygous individuals in one single test strip with a detection rate of more than 95%. Given that our patient group is derived from a very typical south China population, we expect our test strip will be useful with a good detection rate in most of south China.
48
X. Lu et al. / Clinica Chimica Acta 418 (2013) 45–49
Fig. 2. Representative results of genotyping eleven G6PD deficiency mutations using reverse dot blot assay. Hemizygote: (1) G1376T; (2) G1388A; (3) A95G; (4) G392T; (5) G871A; (6) C1024T; (7) G1381A; and (9) C1004T. Vectors obtained by site-directed mutagenesis: (8) C1387T; (10) C1004A; and (11) C1360T. Heterozygotes and homozygote (12) G1376T/N; (13) G1388A/N; (14) G871A/N; (15) G1376T/A95G; (16) G1376T/G1388A; (17) G1388A/G871A; (18) A95G/N; (19) C1024T/N; and (20) G392T/N.
Fig. 3. Representative sequencing results of eleven G6PD deficiency mutations. The mutation sites are indicated by arrows. (A) A95G/N; (B) A95G hemizygote; (C) G392T/N; (D) G871A/N; (E) G1024T/N; (F) G1376T hemizygote; (G) G1376T/N; and (H) G1388A hemizygote.
X. Lu et al. / Clinica Chimica Acta 418 (2013) 45–49
This method is easily performed with common equipment, with low cost and can be completed in 6 h. It is one of the most ideal methods for smaller clinics and laboratories with limited resources to perform front-line testing to detect G6PD without having to resort to direct DNA sequencing. Conflict of interest None declared. Acknowledgments We are grateful for the participation of all the patients and their families. We thank Dr. Michael Raff for his meticulous editing of the manuscript. This work was partially supported by the Dongguan Bureau of Science and Technology for the City Key Program of Science and Technology (Project Number: 2011105102017). References [1] Beutler E. G6PD: population genetics and clinical manifestations. Blood Rev 1996;10: 45–52. [2] Beutler E. Glucose-6-phosphate dehydrogenase deficiency: a historical perspective. Blood 2008;111:16–24.
49
[3] Minucci A, Moradkhani K, Hwang MJ, Zuppi C, Giardina B, Capoluongo E. Glucose-6-phosphate dehydrogenase (G6PD) mutations database: review of the “old” and update of the new mutations. Blood Cells Mol Dis 2012;48:154–65. [4] Du CS, Xu YK, Hua XY, Wu QL, Liu LB. Glucose-6-phosphate dehydrogenase variants and their frequency in Guangdong, China. Hum Genet 1988;80:385–8. [5] Yan T, Cai R, Mo O, et al. Incidence and complete molecular characterization of glucose-6-phosphate dehydrogenase deficiency in the Guangxi Zhuang autonomous region of southern China: description of four novel mutations. Haematologica 2006;91:1321–8. [6] Yan JB, Xu HP, Xiong C, et al. Rapid and reliable detection of glucose-6-phosphate dehydrogenase (G6PD) gene mutations in Han Chinese using high-resolution melting analysis. J Mol Diagn 2010;12:305–11. [7] Jiang W, Yu G, Liu P, et al. Structure and function of glucose-6-phosphate dehydrogenase-deficient variants in Chinese population. Hum Genet 2006;119: 463–78. [8] Tang TK, Huang CS, Huang MJ, Tam KB, Yeh CH, Tang CJ. Diverse point mutations result in glucose-6-phosphate dehydrogenase (G6PD) polymorphism in Taiwan. Blood 1992;79:2135–40. [9] Maffi D, Pasquino MT, Caprari P, et al. Identification of G6PD Mediterranean mutation by amplification refractory mutation system. Clin Chim Acta 2002;321: 43–7. [10] Wu G, Liang WH, Zhu J, et al. Rapid, simultaneous genotyping of 10 Southeast Asian glucose-6-phosphate dehydrogenase deficiency-causing mutations and a silent polymorphism by multiplex primer extension/denaturing HPLC assay. Clin Chem 2005;51:1288–91. [11] Li L, Zhou YQ, Xiao QZ, Yan TZ, Xu XM. Development and evaluation of a reverse dot blot assay for the simultaneous detection of six common Chinese G6PD mutations and one polymorphism. Blood Cells Mol Dis 2008;41:17–21. [12] Pan SL. G6PD deficiency: distribution in East and Southeast Asia and positive selection by malaria. Chin J Health Birth Child Care 2007;13:42–52.