A sensitive and efficient detection method for bovine viral diarrhea virus (BVDV) in single preimplantation bovine embryos

Available online at www.sciencedirect.com

Theriogenology 71 (2009) 966–974 www.theriojournal.com

A sensitive and efficient detection method for bovine viral diarrhea virus (BVDV) in single preimplantation bovine embryos K. Gregg *, S.H. Chen, T. Guerra, S. Sadeghieh, T. Xiang, J. Meredith, I. Polejaeva Viagen Inc., 12357-A Riata Trace Parkway, Suite 100, Austin, TX 78727, United States Received 8 July 2008; received in revised form 14 October 2008; accepted 18 October 2008

Abstract The objective was to develop a method to accurately and efficiently detect minute amounts of bovine viral diarrhea virus (BVDV) associated with a single embryo. There are two major challenges for BVDV detection in a single embryo: the test sensitivity and the efficiency of viral molecule recovery. These become even more critical when attempts are made to detect BVDV infections that occurred naturally, not through artificial exposure of the embryos to high affinity BVDV strains. We have developed a one-step sample preparation method that has increased the viral molecule recovery rate compared to the standard RNA isolation procedure by 7–100-fold. Instead of using the traditional virus exposure approach, we generated BVDV positive embryos via somatic cell nuclear transfer (SCNT) technology using BVDV positive donor cells. By combining the highly efficient sample preparation procedure with a sensitive one-step, real-time PCR system, we have developed a sensitive test that allows detection of as low as two copies of BVDV in a single embryo. This method will allow systematic risk assessment for BVDV transmission during in vitro embryo production via IVF or SCNT procedures. # 2009 Elsevier Inc. All rights reserved. Keywords: BVDV testing; Real-time PCR; Single embryo; Direct cell lysis; Sensitive test

1. Introduction Transmission of BVDV through embryo-associated viruses during embryo transfer has always been a concern. Although a body of published research work suggests that the International Embryo Transfer Society (IETS) standard washing procedure is sufficient to remove BVDV from zona pellucida-intact bovine embryos [1,2], other studies have demonstrated that a proportion of in vivo- and in vitro-derived zona pellucida-intact embryos exposed to certain high affinity isolates of BVDV can retain infectious virus

* Corresponding author. Tel.: +1 512 401 5903; fax: +1 512 401 5919. E-mail address: [email protected] (K. Gregg). 0093-691X/$ – see front matter # 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.theriogenology.2008.10.018

even after the embryos have been thoroughly washed [3–5]. Somatic cell nuclear transfer (SCNT) technology is a powerful tool for reproductive biology of livestock that allows preservation and propagation of superior animal genetics. Because the SCNT procedure involves puncturing of the zona pellucida, the concern for BVDV disease transmission through this new technology is magnified. In order to accurately assess the risk of BVDV transmission through the SCNT system, a sensitive, accurate, and efficient method is essential for detection of minute amounts of virus in a single embryo or oocyte sample. Several approaches have been used to detect embryoassociated viruses. The traditional approach was to transfer in vitro or in vivo BVDV exposed embryos to naı¨ve recipients and then test the recipients for presence of the virus or viral antibodies [6]. This test is expensive,

K. Gregg et al. / Theriogenology 71 (2009) 966–974

time-consuming, and not suitable for routine evaluation. The most commonly used method is virus isolation in which sonicated fluids of embryos in question are cultured with the MDBK cells. The cells are then tested for virus presence via an immunoperoxidase monolayer assay [4,7–9]. In a recent study, Gard et al. reported detection of BVDV in single or a small group of embryos using both real time quantitative polymerase chain reaction (RT-QPCR) and virus isolation methods [8]. Although the reported methods are sufficient to detect minute amounts of BVDV associated with a single washed embryo after in vitro virus exposure, the method requires RNA isolation from embryo samples and this may reduce test sensitivity due to sample loss caused by the RNA isolation process. The objective of this study was to develop an assay system that maximizes recovery of the viral RNA to increase sensitivity of BVDV detection for single embryo. 2. Materials and methods 2.1. Experimental design The objective of this study was to develop a sensitive assay to detect minute amounts of BVDV in biological samples used for in vitro embryo production. We chose the TaqMan real-time PCR system as the platform, due to its sensitivity and reproducibility. Our approach to improve test sensitivity was to increase the efficiency of viral RNA recovery from the target samples via a onestep, direct cell lysis method using the Cells-tocDNATM II Cell Lysis Buffer from Ambion (Ambion Inc., Austin, TX, USA). The following experiments were performed to evaluate the assay for its sensitivity, reproducibility, and application value. 2.1.1. Experiment I: evaluate the effect of the Ambion lysis buffer on the real time PCR system A 10-fold control RNA dilution series from 107 to 10 copies/ml was made with either nuclease-free H2O or the Ambion lysis buffer (heat treated at 75 8C for 10 min. and then chilled on ice before use). These standard dilutions were tested side by side in multiple assays and the cycle threshold (Ct) values for each dilution were compared between H2O and lysis buffer. 2.1.2. Experiment II: evaluate the sensitivity and reproducibility of the assay A 2-fold control RNA dilution series from 100 to 1.57 copies/reaction was prepared with either lysis buffer or cell lysate of 2  106 BVDV negative cells in 1 mL cell lysis buffer and tested in multiple assays, to

967

determine the lower detection limit of the assay. A 10fold control RNA dilution series was tested in five assays over a 3-mo interval to evaluate the system’s reproducibility via the value of coefficient variance (CV) for each dilution. 2.1.3. Experiment III: compare the viral molecule recovery efficiency between the RNA isolation method and the direct cell lysis method A BVDV positive fibroblast cell line, V140, was used for this experiment. The same number of V140 cells, in the order of 40,000, 4000, 400 and 40 cells persample, were used as starting material for both RNA isolation and direct cell lysis methods. Using the RNA isolation method, RNA samples were eluted in 20 ml H2O. The cells were lysed in 20 ml lysis buffer using the direct cell lysis method. Two microliters of each sample, giving the equivalent of 4000, 400, 40, and 4 cells/reaction, were used for the test. Two replicates of each sample were prepared using each method. These were then tested for BVDV in triplicate, using TaqMan real-time PCR. 2.1.4. Experiment IV: test for BVDV in single embryos and small groups of embryos A set of embryos were produced from a BVDV positive cell line using SCNT technology and the assay was used to test single embryos and pools of five and 10 embryos for BVDV. Embryos were also produced from BVDV negative cells and used as negative controls. 2.2. Cell sample preparation The fibroblast cell line, V140, was confirmed BVDV positive by PCR and the virus isolation test performed at Auburn University [10]. The sequence analysis of the 50 UTR indicated that the V140 cell lines was infected by a type I virus, the ILLNC strain, with GeneBank accession number of U86600 (data not shown). The cells were cultured in Dulbecco’s-modified Eagle’s medium (Invitrogen, Carlsbad, CA, USA) containing 15% radiation treated fetal bovine serum (FBS) (Hyclone, Logan, UT, USA) until confluent. Once confluent, cells were washed three times with 1 phosphate-buffered saline (PBS) (Gibco, Invitrogen, Carlsbad, CA, USA) to remove FBS and then trypsinized 3 min at 37 8C with 0.1% trypsin. After trypsinization, the cells were collected in 10 mL 1 PBS and transferred to a 15-mL test tube. The cells were then washed twice with 1 PBS by repeated centrifugation at 1800  g for 5 min. The cells were resuspended in 1 mL 1 PBS and counted with a

968

K. Gregg et al. / Theriogenology 71 (2009) 966–974

hemacytometer. Cells were then resuspended in 1 mL 1 PBS to make a cell solution with a concentration of 2  106 cells/mL. A sequential 10-fold dilution series from 2  106 to 2  103 cells/mL were made with 1 PBS. Twenty microliters of each cell solution were transferred into a 1.5-mL test tube with four replicates prepared for each cell concentration. The tubes were then centrifuged at 14,000  g for 2 min in a tabletop centrifuge to pellet the cells. The supernatant was carefully removed. Two of the four samples for each cell concentration were used for RNA isolation and the other two were used for direct cell lysis.

blastocysts were collected and treated with Ambion lysis buffer for BVDV tests.

2.3. Somatic cell nuclear transfer embryo production

An aliquot (20 ml) of the Ambion Cells-to-cDNATM II Cell Lysis Buffer was added to each of the tubes with a known number of V140 cells. The cells were then resuspended into the lysis buffer via gentle pipetting. The reactions were incubated at 75 8C for 10 min and then kept on ice for same day assay, or stored at 20 8C for later use. About 2  106 BVDV negative cells were lysed with 1 mL lysis buffer to make cell lysate sample for control RNA dilutions. After incubation at 75 8C for 10 min, the cell lysate was kept at 20 8C until use. The individual Day 7 embryos were transferred to a 1.5-mL test tube containing 3 ml of the Ambion cell lysis buffer; the pools of 5 and 10 embryos were transferred to a 1.5-mL test tube containing 5 ml of the Ambion cell lysis buffer. The tubes were centrifuged at 14,000  g for 1 min in a bench top centrifuge to collect all of the materials to the bottom of the tube and were then incubated at 75 8C for 10 min. The samples were stored at 20 8C until use.

A cell line positive for BVDV (V140) and a negative cell line (V206) were used to generate SCNT embryos as described [11], with minor changes. Briefly, at 20– 21 h post-maturation, cumulus cells of bovine oocytes obtained from a commercial supplier (BoMed Inc., Madison, USA, WI and Trans Ova, IA, USA) were removed by vortexing for one min in 0.1% hyaluronidase in Hepes-M199 with Hank’s salts (H-M199) (Gibco, Invitrogen, Carlsbad, CA, USA). Denuded oocytes were incubated for 15 min in H-M199 supplemented with 0.1% BSA containing 5 mg/mL Hoechst 33342. The metaphase II-associated chromosomes were removed from oocytes by aspiration with the aid of an ultraviolet light flash to verify complete removal of the chromosomal DNA. Reconstructed oocytes were made by placing a single donor cell in the perivitelline space of each enucleated oocyte. Following reconstruction, the cell–cytoplast couplets were exposed to a 2 DC pulse of 640 V/cm for 30 ms in a 3.2-mm fusion chamber (BTX, San Diego, CA, USA) containing fusion buffer of 270 mM mannitol, 1 mM CaCl2, and 100 mM MgSO4. The fused couplets were incubated in M199 with Earle’s salts supplemented with 0.1% BSA (E-M199) for 1.5 h before being activated by exposure to 5 mM ionomycin in H-M199 for 4 min. The reconstructed zygotes were then incubated in E-M199 containing 2 mg/mL cycloheximide and 7.5 mg/mL cytochalasin B for 1 h, followed by E-M199 containing 2 mg/mL cycloheximide for 4 h at 38.5 8C in a humidified atmosphere of 5% CO2 in air. At the end of activation treatment, the zygotes were placed in modified synthetic oviduct fluid (SOF) medium supplemented with 0.4% BSA and cultured in an incubator with a gas mixture of 5% CO2, 5% O2 and 90% N at 38.5 8C. The culture medium was refreshed on Days 3 or 4. On Day 7, hatching or expanded single

2.4. RNA isolation RNA from the respective number of the V140 cells were isolated with the QIAGEN RNeasy kit (QIAGEN, Germantown, MD, USA) following the manufacturer’s protocol. The RNA for each sample was eluted into 20 ml of nuclease-free water. 2.5. Direct cell lysis sample preparation

2.6. Taqman/RT-PCR BVDV test 2.6.1. Primer and probe information The BVDV primers conserved for both genotypes I and II were designed from the highly conserved 50 UTR region of the BVDV genome, as described by Weinstocks et al. [12]. The primers and probes for the TaqMan BVDV test were designed according to Bhudevi and Weinstocks [13]. Primers information is listed in Table 1. 2.6.2. Control RNA production RNA extracted from a batch of BVDV test positive FBS (Hyclone, Logan, UT, USA) was used as a template for reverse transcription (RT) with the BVDV reverse primer (BVDV_R), using Reverse Transcriptase from Ambion (Ambion, Austin, TX, USA) in 10 ml reaction. After the RT reaction, 90 ml of a PCR reaction mix containing 1 ml BVDV_T7-103F primer (10 mM),

K. Gregg et al. / Theriogenology 71 (2009) 966–974

969

Table 1 Primer sequences and their genome position. Primer name

Sequence

Genome position

BVDV_F BVDV_R TaqManBVDV_R TaqMan_BVDVtype I TaqMan_BVDVtype II BVDV_T7-103F

TAGCCATGCCCTTAGTAGGAC ACTCCATGTGCCATGTACAGC GACGACTACCCTGTACTCAGG FAM-AACAGTGGTGAGTTCGTTGGATGGCTT-TAMRA FAM-TAGCAGTGAGTCCATTGGATGGCCGA-TAMRA GGATCCTAATACGACTCACTATAGGGAGTAGCCATGCCCTTAGTAGGAC

103–124 372–392 179–196 145–171 147–172 T7 RNA polymerase site +BVDV_F

1 ml BVDV_R primer (10 mM), 10 ml 25 mM MgCl2, 4 ml 10 mM dNTP, 1 ml Sigma Taq polymerase and 10 ml 10 reaction buffer (Sigma, St. Louis, MO, USA) and 63 ml H2O was added to the tube. The PCR reaction was performed at following thermocycling conditions: 5 min at 95 8C followed by 35 cycles of 30 s at 95 8C, 1 min at 50 8C and 1 min at 72 8C. The PCR products were then gel purified with the QIAquick gel extraction kit (QIAGEN, Germantown, MD, USA). The purified BVDV cDNA fragment with a T7 polymerase binding site at its 50 end was then used as a template for in vitro transcription via the MAXIscript1 T7 Kit (Ambion, Austin, TX, USA). After transcription, the DNA templates were removed by DNase 1 digestion at 37 8C for 30 min with 2 ml DNase1 (2 U/ml; Ambion). The control BVDV RNA molecules were then purified with the RNeasy kit (QIAGEN, Germantown, MD, USA) and eluted in 50 ml nuclease-free H2O. The concentration of the control RNA solution was measured by A260 and converted to the number of copies using the molecular weight of the BVDV RNA fragment. A dilution of 108 copies/ml of the control RNA was then made as the working stock and stored at 20 8C until use. 2.6.3. BVDV test using TaqMan/RT-PCR method The BVDV test was performed in a single tube using the AgPath-ID One-Step RT-PCR Kit from Ambion (Ambion, Austin, TX, USA). The BVDV probe mix contained 10 mM BVDV_F, 10 mM TaqManBVDV_R, 3.5 mM each of the FAM labeled Type I and Type II probes. The reaction mix for each tube contained 2 ml sample, 1 ml probe mix, 12.5 ml 2 reaction buffer, 1 ml enzyme mix and 8.5 ml H2O. The reactions were carried out on the ABI 7000 RealTime PCR system (Applied Biosystems, Foster City, CA, USA) using a thermocycling program of: 10 min at 45 8C for reverse transcription; 10 min at 95 8C to activate the DNA polymerase and inactivate the RT enzyme; 40 cycles of 15 s at 95 8C and 1 min at 60 8C. For each assay, a 10-fold dilution series of the control

RNA with the Ambion cell lysis buffer or H2O from 107 to 10 copies/ml was tested in duplicate as the standard curve to quantify the virus concentration in the samples. A BVDV negative cell lysate sample was used as a negative control. 2.7. Data analysis The quantities of the viral load in the embryos were calculated by interpolating their quantity from a standard curve using the ABI Prism 7000 SDS Software (Applied Biosystems). Microsoft Office Excel 2007 (Microsoft Corp., Redmond, WA, USA) was used to calculate the mean, standard deviation, correlation, coefficient of variance of the assay results. The difference between the cell lysis buffer and cell lysate on the test sensitivity of the assay system was analyzed using a two-sample student’s t-test with Excel. 3. Results 3.1. Effect of the cell lysis buffer on the assay system In order to use the direct cell lysis method instead of RNA isolation for sample preparation, the effect of the Ambion cell lysis buffer on the assay was evaluated. A 10-fold control RNA dilution series from 107 to 10 copies/ml prepared with either water or cell lysis buffer was tested side by side in three separate assays with a total of seven replicates. The results are summarized as the plot of the RNA concentration vs. the threshold cycle (Ct) value (Fig. 1). Both the water and cell lysis buffer dilution series produced linear standard curves (R2 > 0.99), with no significant differences noted between the two systems. 3.2. Assay sensitivity and reproducibility To evaluate the lower limit of detection for the assay using the Ambion cell lysis buffer, we tested a twofold

970

K. Gregg et al. / Theriogenology 71 (2009) 966–974

Fig. 1. Effect of the lysis buffer on the assay. Control RNA was diluted with either H2O or the cell lysis buffer (pre-incubated at 75 8C for 10 min) with a 10-fold interval from 10  107 to 10 copies/ml. Two microliters of each dilution was tested and the results of seven replicates from three independent experiments are summarized in this graph as the Ct value vs. the template concentration. Lysis buffer did not have an effect on the test system.

dilution series of the control RNA from 100 to 1.57 copies/reaction in cell lysis buffer and in BVDV negative cell lysate. Two independent assays were performed with two replicates in the first and three in the second. As low as 1.57 copies of the control RNA could be detected and there was no significant difference between dilutions made with cell lysis buffer or cell lysate ( p = 0.473) (Fig. 2).

To assess the reproducibility of the assay, five independent tests of the 10-fold control RNA dilution series in lysis buffer were conducted over a 3-mo interval. The Ct value for individual reactions, the mean Ct value, the standard deviation, and the coefficient of variation (CV) for each dilution are shown (Table 2); they indicated that this assay was highly reproducible (CV value from 1.6 to 4.9%.

Fig. 2. Assay sensitivity. A twofold dilution series from 100 to 1.57 copies/reaction in lysis buffer and cell lysate were tested in two independent assays with a total of five replicates. (A) Results are listed as the mean Ct value and S.D. for each dilution. (B) Plot of the template copy number vs. Ct value.

K. Gregg et al. / Theriogenology 71 (2009) 966–974

971

Table 2 Reproducibility of the assay. RNA copy#

Assay 1

Threshold cycle (Ct) 15.9 20 7 20 6 20.7 20 5 24.7 28.1 20 4 20 3 30.7 20 2 35.2 20 1 38.7 NC Undet

Assay 1

Assay 2

Assay 2

Assay 3

Assay 3

Assay 4

Assay 4

Assay 5

Assay 5

Mean

S.D.

CV

17.3 20.6 24.3 28.3 31.0 34.4 35.4 Undet

15.7 18.6 22.1 24.5 30.0 33.3 37.5 Undet

16.2 18.7 23.0 24.4 30.6 32.4 34.0 Undet

17.2 19.7 23.1 26.9 29.3 32.7 38.7 Undet

17.7 19.8 23.3 27.4 30.5 32.8 36.6 Undet

17.0 20.4 24.2 27.3 30.3 32.8 36.6 Undet

17.6 20.3 23.9 26.8 30.0 32.7 38.7 Undet

17.9 20.1 24.7 27.5 30.4 34.1 35.4 Undet

17.4 19.7 23.7 27.9 30.2 32.7 36.7 Undet

17.0 19.8 23.7 26.9 30.3 33.3 36.8 Undet

0.8 0.7 0.8 1.4 0.5 0.9 1.6 Undet

4.5% 3.7% 3.5% 4.9% 1.6% 2.8% 4.4% Undet

10-fold control RNA dilution series were tested in five assays performed over a 3-mo interval and the results are listed as the Ct value of the individual reaction; the mean Ct value, S.D., and coefficient of variation (CV) for each dilution.

3.3. Detection of BVDV in cell samples without RNA extraction Experiment III examined the difference between RNA isolation and the direct cell lysis method on viral RNA recovery in samples. The level of BVDV detected in the samples prepared with the direct lysis method was consistently much higher than in the samples prepared with the RNA isolation method from the same number of cells (Fig. 3). The average fold increase in terms of detected BVDV level was 24-fold for 4000 cells, 121fold for 400 cells, 46-fold for 40 cells, and 7-fold for 4 cells (Fig. 3: lysis/RNA). For the samples with four cells/reaction, the detected BVDV copy number in the isolated RNA samples is approximately three, very close to the lower detection limit of the assay. In the samples prepared with the direct lysis method, the detected BVDV copy number was approximately 22, over sevenfold higher than the samples prepared by the RNA isolation method. Therefore, the direct lysis

method was noticeably more efficient for viral RNA preservation than the RNA isolation method and it will prevent false negative result caused by sample loss. 3.4. Detection of BVDV in a single embryo To evaluate the feasibility of detecting BVDV in a single embryo using direct cell lysis and TaqMan/RTPCR, we generated a set of SCNT embryos using the BVDV positive cell line V140. The embryos were collected and tested for the presence of BVDV as single embryos, and pools of 5 and 10 embryos. All pooled samples tested BVDV positive (Table 3), and 13 of the 18 single embryos tested BVDV positive (72%, Experiment I). The BVDV concentration in the embryos was not uniform, ranging from 0 to 5000 copies. To ensure the large variation of the viral load in the single embryo samples were true, not the results of contamination and problems in the culture, another set of 58 SCNT embryos were made with V140 cell line and

Fig. 3. The effect of sample preparation on test sensitivity. Samples with the same number of cells in the order of 40,000, 4000, 400, and 40 per sample were processed for BVDV test via either RNA isolation, or direct lysis method with a final sample volume of 20 ml. Two microliters of the samples equivalent to 4000, 400, 40 and 4 cells/reaction respective to its starting material were used for BVDV testing. Two samples for each cell concentration were processed with each method. Every sample was tested for BVDV in triplicate. The means of detected BVDV copy number from the six replicates in the RNA isolation samples were plotted against those of the direct cell lysis samples. Lysis/RNA represents the fold increase of detected BVDV level in direct cell lysis sample over the RNA isolation sample.

972

K. Gregg et al. / Theriogenology 71 (2009) 966–974 Table 3 (Continued )

Table 3 Embryo test results. Sample type

Sample type Sample ID

Ct

Quantity (copy)

The 1st experiment Pool of 5 Pool of 5 Pool of 5 Pool of 10 Pool of 10 Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Negative control Positive%

P5_1 P5_2 P5_3 P10_1 P10_2 S4 S2 S3 S11 S5 S8 S13 S1 S18 S7 S6 S17 S9 S10 S12 S14 S15 S16 NC 72%

28.54 28.94 28.05 27.26 29.11 27.32 28.56 29.68 29.86 30.92 31.88 32 32.46 32.91 33.32 33.67 35.75 37.26 Undet Undet Undet Undet Undet Undet

2182 1657 3064 5304 1472 5092 2157 992 875 419 216 199 145 106 80 62 15 5 0 0 0 0 0 0

The 2nd experiment Cell Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo

V140_Cell S8 S31 S29 S14 S7 S12 S22 S11 S43 S56 S30 S54 S41 S38 S2 S24 S36 S15 S20 S18 S3 S13 S5 S42 S34 S19 S52 S37

26.84 28.36 28.95 29.05 29.26 29.38 29.41 29.44 29.52 29.65 29.66 29.68 29.84 29.91 30.09 30.19 30.31 30.38 30.43 30.44 30.51 30.57 30.7 30.91 30.91 30.96 30.98 31.12 31.16

8455 2977 1869 1739 1468 1343 1311 1276 1196 1082 1079 1057 932 887 768 710 647 614 588 583 553 528 478 405 404 389 383 344 333

Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Single embryo Negative control Positive%

Sample ID

Ct

Quantity (copy)

S40 S44 S57 S48 S1 S16 S26 S55 S21 S58 S4 S51 S46 S10 S53 S33 S45 S50 S6 S9 S17 S23 S25 S27 S28 S32 S35 S39 S47 S49 NC 79%

31.38 31.4 31.4 31.41 31.53 31.53 31.99 32.04 32.08 32.58 32.73 33.02 33.38 34.01 34.03 34.11 34.47 37.89 Undet Undet Undet Undet Undet Undet Undet Undet Undet Undet Undet Undet Undet

279 276 275 273 249 249 174 168 162 109 98 78 58 36 35 33 25 2 0 0 0 0 0 0 0 0 0 0 0 0 0

A BVDV positive cell line (V140) was used as donor cells to generate a batch of embryos by SCNT. The embryos were tested as singles, and as pools of five and 10 individuals. The results are listed as the Ct value and the estimated quantity. Two independent experiments were performed and single embryo samples were listed according to their viral load from the highest to the lowest. Embryos made with BVDV negative cell lines were used as negative controls, and all of them proved to be BVDV negative.

tested for BVDV. A result similar to the first experiment was obtained (Table 3, the 2nd Experiment), with 46 of the 58 single embryos being positive (79%) and a large viral load variation between the individual embryos (0– 3000 copies). The assay system was able to detect as low as two copies of BVDV in a single embryo. 4. Discussion Bovine viral diarrhea virus is widely distributed among cattle populations and poses a substantial threat to in vitro and in vivo embryo production systems. With the development and application of SCNT embryo production technology, a comprehensive risk assess-

K. Gregg et al. / Theriogenology 71 (2009) 966–974

ment of BVDV transmission is necessary. To ensure the success of risk assessment, availability of a sensitive, accurate, and efficient assay is essential. Although virus isolation has been regarded as the ‘‘gold standard’’, it is not sensitive enough to detect small amounts of virus in the presence of viral antibodies in the cell culture medium. Several RT-PCR-based methods have been developed for rapid and sensitive viral detection [12– 16]. The reverse transcription-nested PCR (RT-nPCR) and RT-QPCR methods have been used to detect BVDV in embryos [8]. These methods require RNA isolation, which could generate false negative results due to sample loss in the process of RNA isolation. In this study, we established a one-step sample preparation procedure using a direct cell lysis method. This method not only simplified the sample processing procedure, but also increased the efficiency of viral RNA recovery, allowing minute amounts of viral molecules to be detected. The level of detected BVDV in the samples prepared by the direct cell lysis method was 7–121-fold higher than in the samples prepared by the RNA isolation method from the same number of cells (Fig. 3). The difference in the detected BVDV copy number between the 4000 and 400 cell samples, prepared with the direct cell lysis method, was approximately twofold instead of 10-fold as expected. System overloading is likely the cause. An aliquot of 2 ml of the lysis buffer may not be enough to lyse all 4000 cells leading to incomplete viral molecule release. Consequently, the detected BVDV level in the 4000 cell sample was not 10-fold higher than in the 400 cell sample. There was over a 20-fold difference in the detected BVDV level between the 400 and 40 cell samples, and between the 40 and 4 cell samples. This may be due to the heterogeneity of the cell population. The cell line used in this study was derived from animal skin, and the cells originated from a mixed cell population, not a single colony. Different cell populations may have different physical responses to viral infection and replication. As a result, certain cells in the cell population may contain a much higher viral load than others, and some may not contain the virus at all. During the process of cell dilution, the chance of getting cells with a high level of BVDV content would be greatly reduced when the number of cells used is decreased by 10-fold. The infectivity rate of the virus may also play a role. If the infectivity rate of this BVDV strain was relatively low, then not all cells would be uniformly infected. As result, the cell dilution would greatly increase the chance of getting cells not infected or infected with low viral level. Another possibility for the decreased level of BVDV is accidental sample loss during the removal of the supernatant before adding the lysis

973

buffer. However, even though the detected BVDV level in samples with four cells prepared by the direct cell lysis method was lower than expected, they were sevenfold higher than in the samples prepared by RNA isolation method for the same number of cells. Therefore, the direct cell lysis method was more efficient than the traditional RNA isolation method. The test results of a twofold control RNA dilution series from 100 to 1.57 copies/reaction, in both cell lysis buffer and cell lysate, have demonstrated that the lower detection limit of our assay is 1.57 copies/reaction. There was a relatively large variation of the Ct values between reactions with the standard deviation (S.D.) range from 0.09 to 2.83. This large variation between reactions is expected for a PCR reaction with template concentration below a tipping point. Because the main purpose of the assay is to detect, not to accurately quantify, the minute amount of viral RNA in the target samples, the current system is sufficient to achieve the goal. Using the direct cell lysis method with TaqMan/RTPCR, we detected BVDV in a single embryo generated with a BVDV positive cell line using SCNT technology. A large variation of viral load was observed among the embryos, ranging from 0 to over 5000 copies per single embryo in the first experiment. A similar result was obtained from the second experiment with a larger sample size. These results confirmed that the variation of viral level between embryo samples were intrinsic, not the result of experimental errors. These variations supported our supposition that the cell line used for SCNT embryo production was not homogenous. Some cells may have contained a high level of active virus, whereas others may have contained a low level or lack the virus. The level of BVDV in the SCNT embryos could be strongly influenced by the viral content of the donor cells. The variation of BVDV levels in the embryos could also be the result of differences in viral replication in each embryo influenced by embryo physiology or the virulence of the individual virus carried over from the donor cell. Five of 18 embryos in the first experiment and 12 out of the 58 embryos in the second experiment produced with the V140 cell line were found to be BVDV negative. Although one cannot exclude the possibility that some of the negative results were caused by sampling error or accidental sample loss, the relatively high reproducibility between the two experiments (28% vs. 21% of embryos were negative) argues against the sampling error being responsible for the result. In addition to V140, we have also tested BVDV presence in SCNT embryos produced from two more BVDV positive cell lines. The positive rates of these embryos were 77% and 100%, respectively (data

974

K. Gregg et al. / Theriogenology 71 (2009) 966–974

not shown), suggesting that viral infection rate was cell line specific. Since the assay was able to detect as low as 1.57 copies/reaction, the negative results indicate that the cells used to generate these embryos were likely to be free of the virus. We inferred that not all cells in a particular BVDV positive cell population were infected. If necessary, it is possible to isolate BVDV negative cells from an infected population. In this study, we discovered that it was essential to make a fresh dilution of the control BVDV RNA from the stock solution (108 copies/ml). When the pre-made or 20 8C stored dilutions were used, the test sensitivity, linearity, and reproducibility between the two replicates were poor. One explanation is that some of the RNA molecules may adhere to the wall of the test tube during storage and the adherence is not uniform between tubes. As a result, the RNA concentration in the dilutions was lower than expected, and the RNA molecule distribution in the solution was not uniform; this led to reduced test sensitivity, linearity and reproducibility of the control standards. Therefore, we recommend preparing the control RNA dilution series fresh for each assay. During the study, we also discovered that the cell lysis buffer without heat treatment inhibited the real time PCR reaction, implicating the presence of heat-sensitive inhibitory factors in the lysis buffer (data not shown). It is critical to remove all of the inhibitors by incubating the cell lysis reaction at 75 8C for 10 min before testing and by pre-heating the cell lysis buffer to 75 8C for 10 min before using it to dilute the control RNA. In summary, we developed a sensitive and simple BVDV assay that allows detection as low as two copies of BVDV associated with a single embryo or a small number of cells. Application of this method in the future will increase the efficiency and accuracy of BVDV detection during the process of in vitro embryo production and embryo transfer. Acknowledgements Fernando Arenivas, Brian Findeisen, Vicki Farrar, Earl Hwang helped with the SCNTembryo production for this study. Thanks to Dr. Wenli Zhou for helpful scientific discussion during the course of this project and to Dr. Kelcey Walker for careful review of the manuscript. References [1] Potter ML, Corstvet RE, Looney CR, Fulton RW, Archbald LF, Godke RA. Evaluation of bovine viral diarrhea virus

[2]

[3]

[4]

[5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

uptake by preimplantation embryos. Am J Vet Res 1984; 45:1778–80. Singh EL, Eaglesome MD, Thomas FC, Papp-Vid G, Hare WC. Embryo transfer as a means of controlling the transmission of viral infections. I. The in vitro exposure of preimplantation bovine embryos to akabane, bluetongue and bovine viral diarrhea viruses. Theriogenology 1982;17:37–44. Waldrop JG, Stringfellow DA, Galik PK, Givens MD, Riddell KP, Riddell MG, et al. Seroconversion of calves following intravenous injection with embryos exposed to bovine viral diarrhea virus (BVDV) in vitro. Theriogenology 2006;65: 594–605. Waldrop JG, Stringfellow DA, Galik PK, Riddell KP, Riddell MG, Givens MD, et al. Infectivity of bovine viral diarrhea virus associated with in vivo-derived bovine embryos. Theriogenology 2004;62:387–97. Waldrop JG, Stringfellow DA, Riddell KP, Galik PK, Riddell MG, Givens MD, et al. Different strains of noncytopathic bovine viral diarrhea virus (BVDV) vary in their affinity for in vivoderived bovine embryos. Theriogenology 2004;62:45–55. Brock KV, Lapin DR, Skrade DR. Embryo transfer from donor cattle persistently infected with bovine viral diarrhea virus. Theriogenology 1997;47:837–44. Bielanski A, Sapp T, Lutze-Wallace C. Association of bovine embryos produced by in vitro fertilization with a noncytopathic strain of bovine viral diarrhea virus type II. Theriogenology 1998;49:1231–8. Gard JA, Givens MD, Riddell KP, Galik PK, Zhang Y, Stringfellow DA, et al. Detection of bovine viral diarrhea virus (BVDV) in single or small groups of preimplantation bovine embryos. Theriogenology 2007;67:1415–23. Givens MD, Galik PK, Riddell KP, Brock KV, Stringfellow DA. Replication and persistence of different strains of bovine viral diarrhea virus in an in vitro embryo production system. Theriogenology 2000;54:1093–107. Stringfellow DA, Riddell KP, Givens MD, Galik PK, Sullivan E, Dykstra CC, et al. Bovine viral diarrhea virus (BVDV) in cell lines used for somatic cell cloning. Theriogenology 2005;63: 1004–13. Zhou W, Xiang T, Walker S, Abruzzese RV, Hwang E, Farrar V, et al. Aggregation of bovine cloned embryos at the four-cell stage stimulated gene expression and in vitro embryo development. Mol Reprod Dev 2008;75:1281–9. Weinstock D, Bhudevi B, Castro AE. Single-tube single-enzyme reverse transcriptase PCR assay for detection of bovine viral diarrhea virus in pooled bovine serum. J Clin Microbiol 2001; 39:343–6. Bhudevi B, Weinstock D. Fluorogenic RT-PCR assay (TaqMan) for detection and classification of bovine viral diarrhea virus. Vet Microbiol 2001;83:1–10. Baxi M, McRae D, Baxi S, Greiser-Wilke I, Vilcek S, Amoako K, et al. A one-step multiplex real-time RT-PCR for detection and typing of bovine viral diarrhea viruses. Vet Microbiol 2006;116:37–44. Drew TW, Yapp F, Paton DJ. The detection of bovine viral diarrhoea virus in bulk milk samples by the use of a single-tube RT-PCR. Vet Microbiol 1999;64:145–54. Kozasa T, Tajima M, Yasutomi I, Sano K, Ohashi K, Onuma M. Relationship of bovine viral diarrhea virus persistent infection to incidence of diseases on dairy farms based on bulk tank milk test by RT-PCR. Vet Microbiol 2005;106:41–7.