A septation related gene AcsepH in Acremonium chrysogenum is involved in the cellular differentiation and cephalosporin production

Fungal Genetics and Biology 50 (2013) 11–20

Contents lists available at SciVerse ScienceDirect

Fungal Genetics and Biology journal homepage: www.elsevier.com/locate/yfgbi

A septation related gene AcsepH in Acremonium chrysogenum is involved in the cellular differentiation and cephalosporin production Liang-kun Long 1, Yanling Wang 1, Jing Yang, Xinxin Xu, Gang Liu ⇑ State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China

a r t i c l e

i n f o

Article history: Received 16 July 2012 Accepted 5 November 2012 Available online 29 November 2012 Keywords: Acremonium chrysogenum Septation Conidiation Cephalosporin

a b s t r a c t T-DNA inserted mutants of Acremonium chrysogenum were constructed by Agrobacterium tumefaciensmediated transformation (ATMT). One mutant 1223 which grew slowly was selected. TAIL-PCR and sequence analysis indicated that a putative septation protein encoding gene AcsepH was partially deleted in this mutant. AcsepH contains nine introns, and its deduced protein AcSEPH has a conserved serine/ threonine protein kinase catalytic (S_TKc) domain at its N-terminal region. AcSEPH shows high similarity with septation H proteins from other filamentous fungi based on the phylogenetic analysis of S_TKc domains. In sporulation (LPE) medium, the conidia of AcsepH mutant was only about one-seventh of the wild-type, and more than 20% of conidia produced by the mutant contain multiple nuclei which were rare in the wild-type. During fermentation, the AcsepH disruption mutant grew slowly and its cephalosporin production was only about one quarter of the wild-type, and the transcription analysis showed that pcbC expression was delayed and the expressions of cefEF, cefD1 and cefD2 were significantly decreased. The vegetative hyphae of AcsepH mutant swelled abnormally and hardly formed the typical yeast-like cells. The amount of yeast-like cells was about one-tenth of the wild-type after fermentation for 5 days. Comparison of hyphal viabilities revealed that the cells of AcsepH mutant died easily than the wild-type at the late stage of fermentation. Fluorescent stains revealed that the absence of AcsepH in A. chrysogenum led to reduction of septation and formation of multinucleate cells. These data indicates that AcsepH is required for the normal cellular septation and differentiation of A. chrysogenum, and its absence may change the cellular physiological status and causes the decline in cephalosporin production. Ó 2012 Elsevier Inc. All rights reserved.

1. Introduction Acremonium chrysogenum (the former Cephalosporium acremonium) is an important industrial fungus for the exclusive production of pharmaceutically relevant b-lactam antibiotic cephalosporin C. The biosynthetic pathway of cephalosporin C in A. chrysogenum includes eight enzyme reactions, and the expression of these enzyme encoding genes is controlled by several factors (e.g. CreA, PACC, CPCR1) through complex regulatory processes (Martin et al., 2010; Schmitt et al., 2004a). Recently, lots of inspiring works about this important fungus have been done from its basic physiology to industry application with molecular techniques (An et al., 2012; Liu et al., 2010; Martin et al., 2004; Pöggeler et al., 2008). The morphological differentiation generally is related with the physiological status which changes during fermentations and with the operating conditions in filamentous fungi (Sámi et al., 2001; Sándor et al., 2001; Scott and Eaton, 2008). At the same time, the

⇑ Corresponding author. Fax: +86 10 64806017. 1

E-mail address: [email protected] (G. Liu). These authors contributed equally to this work.

1087-1845/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.fgb.2012.11.002

fungal secondary metabolism commonly is associated with cellular morphological differentiation and development (Calvo et al., 2002; Keller et al., 2005). In A. chrysogenum, three types of culture differentiation are formed. The formation of conidia from vegetative mycelium is associated with the lower production of cephalosporin. The formation of arthrospores at the late stage of fungal development is associated with the basic metabolism and lower production of cephalosporin. The arthrospore chains (also called ‘‘yeast-like’’ cell) represent metabolically active cells enriched with intracellular organelles and lipid-containing vacuoles, and the cellular differentiation into arthrospores coincides with the maximum rate of cephalosporin production (Bartoshevich et al., 1990; Hoff et al., 2005). It is well-known that DL-methionine (Met) could significantly stimulate cephalosporin biosynthesis and arthrospore chains formation in A. chrysogenum (Demain and Zhang, 1998). A similar stimulatory effect was also found by addition of glycerol in the fermentation of A. chrysogenum producer strain M35 (Shin et al., 2010). Although there is no obligate relationship between the antibiotic biosynthesis and cellular differentiation in A. chrysogenum (Nash and Huber, 1971; Sándor et al., 1998, 2001), analysis of the morphology related genes is important for a good understanding of secondary metabolic biosynthesis in this fungus.

12

L.-k. Long et al. / Fungal Genetics and Biology 50 (2013) 11–20

Septum formation is one of the key processes in fungal cellular morphogenesis (Harris, 2012). Septation is closely related with nuclear division through a conserved kinase cascade which is called the septation initiation network (SIN) (Krapp and Simanis, 2008). The SIN pathway activates the GTPase Rho4 which recruits SepA and in turn triggers the formation of cytokinetic actin ring which is essential for septation (Si et al., 2010). The mitotic cyclin-dependent kinases (CDKs) are the important components of SIN in fungi (Csikász-Nagy et al., 2007). It is reported that the CDK activity increased 10-times during asexual development of Aspergillus nidulans (Ye et al., 1999), suggesting that the morphological differentiation is regulated by the kinase cascade. As secondary metabolic biosynthesis is commonly associated with the developmental processes including morphological differentiation (Calvo, 2008; Calvo et al., 2002), it is possible that the SIN pathway also affects secondary metabolic biosynthesis through some pleiotropic regulators which involved in both morphological differentiation and secondary metabolism of fungi. However, no any study of SIN pathway on the secondary metabolic biosynthesis has been reported although the mitogen-activated protein kinase might regulate secondary metabolic biosynthesis in filamentous fungi (Park et al., 2008). A. chrysogenum belongs to the Deuteromycetes which lack a sexual cycle and are not accessible for conventional genetic analysis (Schmitt et al., 2004a). T-DNA insertional mutagenesis has been used and developed as an effective tool for investigating gene functions in many filamentous fungi (Weld et al., 2006; Zhong et al., 2011, 2012). In this study, we identified a septation related gene AcsepH in A. chrysogenum by T-DNA mediated insertional mutagenesis, and its functions on hyphal growth, cellular differentiation and cephalosporin biosynthesis were investigated.

2.3. Identification of T-DNA insertion sites in mutants Thermal asymmetric interlaced (TAIL-) PCR was used to obtain the flanking sequences of T-DNA in mutants. All of the primers used in this study were listed in Table 1. Each mutant was incubated in 20 ml of MMC liquid medium for 60 h at 28 °C, 220 rpm. The mycelia were harvested by a steel wire mesh, dried with filter paper and ground in liquid nitrogen using sterilized mortar and pestle. Genomic DNA was isolated with DNA Quick Plant System (TianGen, China). TAIL-PCR was performed using the primers listed in Table 1 as described by Liu and Chen (2007). The amplified fragments were cloned into the vector pEasy-Blunt (TranGene, China) and sequenced by Invitrogen Trading Co., Ltd (Shanghai). Obtained flanking sequences were compared with the whole-genomic DNA sequence of A. chrysogenum CGMCC 3.3795 (unpublished data), the flanking sequences were localized and the T-DNA inserted sites were identified. The target mutants were further identified by specific PCR amplifications.

2.4. Complementation of mutant 1223 with gene AcsepH To confirm the function of a putative septation protein H encoding gene (AcsepH), a 7.046-kb DNA fragment containing the intact AcsepH gene with 1.6 kb upstream region and 0.6 kb downstream region was obtained from the wild-type strain by three PCR amplifications and fragments ligation. After the 7.046-kb fragment was ligated into the plasmid pMB (Long et al., 2012), the recombinant plasmid pMB-AcsepH was introduced into the mutant 1223 by PEG-mediated protoplast transformation as described previously (Long et al., 2012). The complementary transformants (CM) were selected on TSA plates containing 10 lg/ml bleomycin.

2. Materials and methods 2.1. Strains, media and growth conditions

2.5. cDNA cloning and sequence analysis of AcsepH

A. chrysogenum wild-type (WT) strain CGMCC 3.3795 was purchased from the China General Microbiological Culture Collection Center (CGMCC). Agrobacterium tumefaciens AGL-1 was used for fungal transformation. Escherichia coli JM109 was used for plasmid propagation. Bacillus subtilis CGMCC 1.1630 (a cephalosporin-sensitive strain) was used for bioassays. For sporulation, A. chrysogenum was grown in LPE medium (per liter, 1 g glucose, 2 g yeast extraction, 1.5 g NaCl, 10 g CaCl2, 25 g agar, pH 6.8) at 28 °C for 7 days. TSA, MMC, MMDN (per liter, 10 g Glucose, 6 g NaNO3, 27 g K2HPO43H2O, 0.52 g KCl, 0.18 g MgSO47H2O, 1 ml Salt solution (1.3% Fe(NH4)2(SO4)26H2O, 0.3% MnSO44H2O, 0.3% ZnSO47H2O, 0.08% CuSO45H2O)) and MDFA (modified) media were used for the fungal growth or fermentation as described previously (Long et al., 2012; Sato et al., 2011). E. coli was grown at 37 °C in Luria–Bertani (LB) medium (per liter, 10 g tryptone, 5 g yeast extraction, 10 g NaCl, pH 7.0) supplemented with necessary antibiotics for propagating plasmids.

Total RNA was isolated from the A. chrysogenum wild-type strain using Trizol Reagent (Invitrogen, USA) according to the commercial manual. First-strand cDNA was synthesized by reverse transcript kit (oligo (dT) was used) (Promega, USA). The cDNA of AcsepH was amplified with four specific primer sets, respectively. After their sequences were validated, the four fragments were digested and orderly ligated together. To characterize AcsepH, the deduced protein was analyzed by online software SMART (http:// smart.embl-heidelberg.de/smart/), and phylogenetic analysis of conserved amino acid was performed by using the neighbor-joining method (p-distance model) with MEGA 5 software.

2.2. Construction and screening T-DNA inserted mutants of A. chrysogenum The plasmid pAg1-H3 was transformed into the A. chrysogenum wild-type strain by A. tumefaciens-mediated transformation (ATMT) (Long et al., 2012; Zhang et al., 2003). T-DNA inserted mutants were selected on TSA plates containing 50 lg/ml hygromycin B. All the T-DNA inserted mutants and the wild-type strain were inoculated onto TSA, MMDN or MMC plates respectively. After growth at 28 °C for 3–5 days, the target mutants were selected on the basis of colony size, hyphal morphology or pigmentation using the wild-type strain as a control.

2.6. Determination of hyphal growth and conidia formation Conidia of the A. chrysogenum wild-type, mutant 1223 and CM strain were collected from LPE plates, and resuspended in sterilized dH2O to a final concentration of (1–2)  107 spores/ml, respectively. Per 100 ll of spore suspension was spread onto a LPE plate covered with a cellophane paper, and then incubated at 28 °C for 10 days. At least three repeats were established for each fungal strain. For each plate, the fungal cultures were collected, and put into a 250-ml flask containing 10 ml sterilized dH2O, vortexed for 2 min and incubated in an orbital shaker at 120 rpm for 30 min. After separated the conidia from hyphae by a steel wire mesh, the quantity of conidia was determined by hemacytometer count method. At the same time, dry cell weight of the collected mycelia was determined. To test the temperature sensitivity of mutant 1223, 1 ll of spore suspension (about 1  107 spores/ml) was spotted onto MMC plates, and incubated for 4 days at 28, 37, 40 and 42 °C respectively.

13

L.-k. Long et al. / Fungal Genetics and Biology 50 (2013) 11–20 Table 1 Primers used in this study. Primer

Sequence (50 –30 )

Source

Primers used for TAIL-PCR AC1 LAD1-4 LAD1-1 RB-a RB-b RB-c LB-a LB-b LB-c

acgatggactccagag acgatggactccagagcggccgcbdnbnnncggt acgatggactccagagcggccgcvnvnnnggaa ttcggcgtgggtatggtgg acgatggactccagtccggcctactactgggctgcttcctaatg cagattgtcgtttcccgccttca tgtgctcaccgcctggacgact acgatggactccagtccggcctccagccaagcccaaaaagtgc taatcgccttgcagcacatcc

Liu and Chen (2007) Liu and Chen (2007) Liu and Chen (2007) This study This study This study This study This study This study

Primers used for clone DNA of AcsepH AcsepH _f1 AcsepH _r1 AcsepH _f2 AcsepH _r2 AcsepH _f3 AcsepH _r3

ccaagcttacgacgcacaccgccattcag ggagcagttagcacaccaagc cccaagcttcatcgcctcgctacc acatgccttcttcacccctt tatgtcacccgttctatgtcc gctctagacctccctttgagtctctatcc

This This This This This This

study study study study study study

Primers used for clone cDNA of AcsepH AcsepH_c_f1 AcsepH_c_r1 AcsepH_c_f2 AcsepH_c_r2 AcsepH_c_f3 AcsepH_c_r3 AcsepH_c_f4 AcsepH_c_r4

gacttcctcatgcaatgcttc gctcgctctcttccttctcta ccacccgtcagatctcaccag ctccacattcgccgtctcctc atcattcccctgttacttcgc catcattgctgcctctctctc acgcaaaagaccgtggagatg aggagctttcgggctgtgact

This This This This This This This This

study study study study study study study study

Primers used for real-time PCR AcsepH_q_f AcsepH_q_r cpcR1_q_f cpcR1_q_r cefD1_F cefD1_R cefD2_F cefD2_R cefEF_U1 cefEF_L1 Ac_IPNS_U1 Ac_IPNS_L1 Ac_act_U3 Ac_act_L3 GAPDH_F GAPDH_R

cttggatagtcggttgtc taggttcggttctgatga cttccacggcacattgac tacagaacaaggtcgcactc tgctgctcctgccctcat cgaagccgctcaccaact aggaacaagtcgtccatctgc cttgagaaggacctctgtggg ccgtaaccaccaagggtatct ctcctcgcttccgttcttga accagtccgacgtgcagaat tcggtgatatgggccatgtag gcgacgtcgatgtccgtaa agaaggagcaagagcagtgatctc gccaagaaggtcatcatc caagaagcgttggagatg

This study This study This study This study This study This study This study This study Dreyer et al. Dreyer et al. Dreyer et al. Dreyer et al. Dreyer et al. Dreyer et al. This study This study

Primers used for identification of hygromycin phosphotransferase gene hph_f hph_r

aagttcgacagcgtctcc ttccactatcggcgagta

This study This study

2.7. Fungal fermentation and cephalosporin production About 3  107 spores of the A. chrysogenum wild-type, mutant 1223 and CM strain were inoculated into 40 ml of seed medium (MDFA without glycerol) in 250-ml flask, respectively. After incubation for 2 days in an orbital shaker at 28 °C and 220 rpm, 1 ml of seed culture was inoculated into 25 ml MDFA medium, and fermentation was carried out for 6 days at 28 °C, 220 rpm. The fungal biomass and cephalosporin production were determined every day. Cephalosporin production during fermentation was determined by bioassays against B. subtilis CGMCC 1.1630 with agar-diffusion method (LB medium, 1% (w/v) agar). Each test plate was added 50,000 units of penicillinase to exclude accumulated penicillin in fermentation (RodrÍguez-Sáiz et al., 2005). Standard of cephalosporin C-Zn (Sigma, USA) was used as control. 2.8. Quantitative real-time PCR Total RNAs of all the samples were prepared with Trizol Reagent and followed by DNase 1 digestion. cDNAs were synthesized from about 1 lg of total RNA with PrimeScript™ RT reagent kit (oligo

(2007) (2007) (2007) (2007) (2007) (2007)

(dT) and 6-mers random primers were used) (TaKaRa, Japan). Quantitative real-time PCR (qRT-PCR) was performed in 25 ll of mixtures in 8-strip PCR tubes in a Mastercycler (Eppendorf, Germany). The PCR cycling reaction was performed with 1 SYBR Premix Ex Taq (TaKaRa, Japan) according to the following parameters: one cycle of pre-denaturation at 95 °C for 30 s, and 40 cycles of denaturation at 95 °C for 5 s, annealing at 60 °C for 20 s and elongation at 72 °C for 15 s. As a negative control, PCR was done without reverse transcript reaction. The relative abundance of mRNAs was standardized against the levels of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene using Pfaffl’s method (Pfaffl, 2001). 2.9. Microscopy and image analysis Hyphal morphology at different fermentation times (1–5 days) was analyzed by using 40 objective lenses under an Olympus BX51 phase contrast microscope (Olympus, Tokyo, Japan). Images were captured with a Canon EOS 450D digital camera and processed with Adobe Photoshop 7.0 software. Hyphal vitality was assessed under bright field illumination on the microscope after Evans blue staining (Jacobson et al., 1998) or under the fluorescene

14

L.-k. Long et al. / Fungal Genetics and Biology 50 (2013) 11–20

microscope after propidium iodide (PI) staining (Raschke and Knorr, 2009). Septa and cell nuclei were fluorescently stained using Calcofluor white (CFW, Sigma) or 40 , 6-diamidino-2-phenylindole (DAPI, Roche) by the reported method (Harris et al., 1994), and examined under an upright Zeiss Axio imager A1 fluorescent microscope (Carl Zeiss, Germany) at an excitation wavelength of 450–490 nm. Images were captured by a Zeiss AxioCam MR camera with Axiovision Release 4.8.2 software. 3. Results 3.1. Construction and identification of the T-DNA inserted mutants Total 1632 mutants of A. chrysogenum were obtained by onetime ATMT transformation of about 1  107 fungal spores. The mutants which grew normally in TSA medium and grew slowly in MMDN or MMC medium were further selected. Among them, 23 mutants displayed obviously different from the wild-type strain

in hyphal growth, colonial size or pigmentation when grown in TAS, MMDN or MMC medium. For most of them, the insertion sites could be identified by TAIL-PCR and sequence analysis of the TDNA flanking regions. Since growth and development are related with metabolic activity in fungi, it might be also related with cephalosporin production in A. chrysogenum. Therefore, one slowgrowth mutant (numbered 1223) in MMDN medium (NaNO3 as nitrogen source) was selected for further study. Mutant 1223 grew slowly and appeared roughened on the colony surface in MMDN medium, but it could restore to the same growth level as the wild-type strain in TSA or MMC medium. These suggested that the mutation might affect the growth and morphological differentiation of A. chrysogenum. Through tail-PCR, the flanking sequences of T-DNA inserted site in the mutant 1223 were determined. In search of the genomic sequence, the flanking sequences were localized in the genome and the T-DNA inserted site was found in one open reading frame (ORF) encoding a homologous of SepH, this ORF was designated as AcsepH. This T-DNA insertion led to a partially (1.7-kb fragment of the 50 terminus) deletion in AcsepH (Fig. 1A). This mutagenesis was reconfirmed by specific PCR amplifications (Fig. 1B). 3.2. Isolation and characterization of the AcsepH gene Integrated DNA and cDNA fragments of AcsepH gene (GenBank accession number JQ937328) were obtained by PCR and fragments ligation. Alignment analysis of the two sequences indicates that the 4245 bp coding region is interrupted by nine small introns (Supplementary Fig. 1A). Its deduced protein AcSEPH consists of 1415 amino acid residues with a theoretical molecular mass of 156.3 kDa. A conserved Ser/Thr protein kinases catalytic (S_TKc) domain is found at the N-terminal region (sites 48–301) of AcSEPH by sequence analysis with software SMART (Supplementary Fig. 1B), and it contains twelve conserved subdomains in the catalytic portion of Ser/ Thr protein kinases (Supplementary Fig. 2) compared with the published data (Hanks et al., 1988; Schweitzer and Philippsen, 1991). Phylogenetic analysis of the conserved domain indicates that AcSEPH is similar to SEPH proteins from other filamentous fungi and it is mostly closed to the SEPH of Neurospora crassa (Fig. 2). AcSEPH shows 49.9% identity with SEPH from A. nidulans (AF011756.2). As SEPH is required for SepA localizing at septation site of A. nidulans (Sharpless and Harris, 2002), AcSEPH might be also involved in the morphological differentiation of A. chrysogenum.

Fig. 1. Construction of the AcsepH disruption mutant of A. chrysogenum. (A) Schematic representation of the T-DNA insertion mutagenesis in mutant 1223. kb, kilobases; hph, hygromycin phosphotransferase gene. (B) Identification of the mutant 1223 by PCR. PCR1 and PCR2 were performed with primer sets AcsepH_f2/ AcsepH_r2 and hph_f/hph_r, respectively. NC, negative control; ladder, 1 kb ladder.

3.3. AcsepH is involved in normal conidiation of A. chrysogenum Sequence analysis showed that the coding region of the S_TKc domain of AcSEPH was completely absent in the slow-growth mu-

Fig. 2. Phylogeny of protein kinase catalytic domains illustrating the position of AcSEPH. Related protein kinase sequences were collected from NCBI database, and their serine/threonine protein kinase catalytic (S_TKc) domains were extracted by online analysis using software SMART. The phylogenetic tree was constructed using the neighbor-joining method (p-distance model) with MEGA 5 software.

L.-k. Long et al. / Fungal Genetics and Biology 50 (2013) 11–20

15

Fig. 3. Comparison of growth and conidia formation in the A. chrysogenum wild-type (WT), AcsepH disruption mutant (1223) and complementary strain (CM). (A) Biomass of WT, 1223 and CM strains. Dry cell weight was determined after drying the fungal mycelia at 70 °C in a hot air oven until a constant weight. (B) Conidia formation in WT, 1223 and CM strains. Per 1.2  106 spores was spread onto a LPE plate covered with a cellophane paper, and then incubated at 28 °C for 10 days. Error bars represent standard deviations from three independent experiments. (C) Number of nuclei in conidia of WT, 1223 and CM strains. About 200 conidia of each fungal strain were stained with DAPI and examined under an upright fluorescent microscope. Bar = 5 lm.

tant 1223. As the conserved S_TKc domain plays an essential role in enzyme structure and function of SEPH (Bardin et al., 2003; Dickmana and Yarden, 1999; Hanks and Hunter, 1995), deletion of S_TKc domain could result in the inactivation of AcSEPH in A. chrysogenum. To further study the function of AcsepH in A. chrysogenum, the AcsepH complementary strains (CM) were constructed by introducing the entire AcsepH gene into the mutant 1223. Total 18 complementary strains were obtained and one of them (C15) was chosen for the subsequent experiments. RT-PCR analysis demonstrated that AcsepH was normally expressing in the CM strain but not in the mutant (Supplementary Fig. 3). In LPE medium, the AcsepH disruption mutant (1223) grew more slowly than the wild-type, but the final biomass of them tended to the same after incubated for 10 days (Fig. 3A). The quantity of new-formed conidia in the mutant was about one-seventh of the wild-type, and it was restored to the wild-type level in the complementary strain (Fig. 3B). The result indicated that AcsepH was required for normal conidiation of A. chrysogenum as sepH in A. nidulans (Bruno et al., 2001). At least 200 conidia from each fungal strain were observed under a phase contrast microscope. The average size of the wild-type conidia was 1.17  3.47 lm, the average size of the mutant conidia was 1.34  4.41 lm and that of the complementary strain was 1.13  3.44 lm. About 20% of the conidia from the mutant were abnormal in shape and their average size was two to fourfold of the normal conidia, while the WT or CM strain rarely produced the big size conidia (generally only about 1%). DAPI nucleic acid stain demonstrated that these big conidia usually contained multiple nuclei. Conidia with double-nuclei (19%), three-nuclei (4%), even four-nuclei (0.45%) were produced by the mutant strain, while the WT or CM strain always produced single-nucleus conidia (Fig. 3C). Obviously, absence of AcsepH in A. chrysogenum resulted in reduction of conidia production and formation of abnormal conidia. 3.4. AcsepH is required for the normal hyphal growth of A. chrysogenum In MDFA medium, the hyphal growth of AcsepH disruption mutant was delayed comparing with the wild-type strain. After incuba-

Fig. 4. Comparison of growth and cephalosporin production in the A. chrysogenum wild-type (WT), AcsepH disruption mutant (1223) and complementary strain (CM) in MDFA medium. (A) Growth of the WT, 1223 and CM strains under the fermentation condition. Dry cell weight was determined after drying the fungal mycelia at 70 °C in a hot air oven until a constant weight. (B) Time courses of total cephalosporin production by the WT, 1223 and CM strains. (C) Cephalosporin production was determined by bioassays against B. subtilis. Forty ll of culture filtrates after 5 days fermentation was used to detect the cephalosporin production. The plate was added 50,000 units of penicillinase to exclude penicillin in culture filtrates. PenG, penicillin (20 lg/ml). Error bars represent standard deviations from three independent experiments.

16

L.-k. Long et al. / Fungal Genetics and Biology 50 (2013) 11–20

Fig. 5. Relative expression levels of AcsepH, cpcR1, pcbC, cefEF, cefD1 and cefD2 genes in the A. chrysogenum wild-type strain (WT), AcsepH disruption mutant (1223) and the complementary strain grown in MDFA medium. The primers used for real time-PCR were listed in Table 1. Gene expression levels were calculated relative to the transcriptional level of the wild-type strain after 1 day fermentation. The relative abundance of mRNAs was standardized against to the levels of GAPDH gene. Error bars represent standard deviations from three independent experiments.

tion for 2 days, the cellular dry weight of mutant 1223 was about one half of the wild-type strain. After incubation for 4 days, the cellular dry weight of the mutant gradually reached the wild-type level. These suggested that the biomass of mutant 1223 was not significantly different from the wild-type at the late stage of fermentation. The growth of complementary strain was close to the wild-type (Fig. 4A). It has been reported that the SEPH-deficient mutants of some filamentous fungi displayed temperature-sensitivity (Harris et al., 1994; Saunders et al., 2010), but our result showed that the AcsepH disruption mutant exhibited the same sensitivity to high temperature as the wild-type strain (Supplementary Fig. 4). 3.5. Disruption of AcsepH reduces cephalosporin production In the wild-type or CM strain, the cephalosporin yield significantly increased after fermentation for 4–5 days (Fig. 4B). Whereas, the cephalosporin production in the AcsepH mutant was always at a low level that was about one quarter of the wild-type during fermentation (Fig. 4B). In addition, doubling the seeds of inoculation in the fermentation of AcsepH mutant could only improve the accumulation of biomass but not the cephalosporin production (data not shown). The expressions of cephalosporin biosynthetic genes pcbC (the isopenicillin N-synthetase encoding gene), cefEF (the bifunctional deacetoxycephalosporin C synthase/hydroxylase encoding gene), cefD1 (the isopenicillinyl N-CoA synthetase encoding gene) and cefD2 (the isopenicillinyl N-CoA epimerase encoding gene) in the wild-type and mutant strains were measured by qRT-PCR (Fig. 5). At the early stage (1–2 days) of fermentation, pcbC showed a low transcriptional level in the mutant compared with the wild-type, and it gradually increased to the similar level of wild-type after fermentation for 3 days. The transcriptional level of cefEF and cefD1 in

the mutant was always lower than that of the wild-type during fermentation (1–4 days). The transcription of cefD2 was significantly reduced at the late stage of fermentation (3–4 days). Absence of AcsepH in A. chrysogenum affected the transcriptions of cephalosporin biosynthetic genes during fermentation, suggesting that AcsepH is related to cephalosporin biosynthesis probably through some unknown transcriptional regulators. 3.6. AcsepH is involved in the arthrospore formation of A. chrysogenum For the wild-type or CM strain, about 30% hyphae transformed into yeast-like cells (arthrospore chains) after 2 days of cultivation, and the yeast-like cells increased to 70–90% after 3–5 days (Fig. 6). At the same time the vegetative hyphae of AcsepH mutant swelled largely, but it was difficult to form typical yeast-like cells (only 3.3–8.3% hyphae transformed into yeast-like cells), and the amount of yeast-like cells was about one-tenth of the WT strain during the last stage of fermentation (Fig. 6). Transcriptional analysis revealed that the expression of AcsepH was getting higher in the wild-type strain at the late stage of fermentation (Fig. 5), suggesting that AcsepH is related to fungal physiological state. The further result showed that the transcriptional level of arthrosporulation-control gene cpcR1 in the mutant was lower than that of the wilt-type at the late stage of fermentation (Fig. 5). These data indicated that AcsepH was related to the arthrospores formation of A. chrysogenum. 3.7. Reduction of cell vitality and septation in AcsepH disruption mutant During fermentation, a remarkable increase in cellular death was observed in the AcsepH mutant under the bright-field micro-

L.-k. Long et al. / Fungal Genetics and Biology 50 (2013) 11–20

17

Fig. 6. Arthrospore formation of the A. chrysogenum wild-type strain (WT), AcsepH disruption mutant (1223) and complementary strain (CM) in MDFA medium. After 2– 5 days of cultivation, fungal tissues were observed under a phase contrast microscope. Typical yeast-like cells formed in the WT or CM strains, and few single arthrospores formed by the mutant at 4–5 days. The percent of hyphae transformed into arthroposres were calculated. Error bars represent standard deviations from three independent experiments. Bar = 5 lm.

scope or the fluorescene microscope after Evans blue staining and propidium iodide (PI) staining (Fig. 7). At least 30% cells of the AcsepH mutant were dead (stained blue by Evans blue or red by PI) after 4 days fermentation. In contrast, under the same condition more than 90% cells of the wild-type or CM strains were still alive. To elucidate the reason of cellular death in the AcsepH mutant, septation and nuclear distribution in these fungal strains were investigated by fluorescent stain (Fig. 8). In the hyphae of AcsepH mutant, the number of septa was obviously reduced compared with the wild-type strain. After fermentation for 2 days, the number of nuclei but not septa per unit length hyphae was increased in the AcsepH mutant, resulting in multinucleate cells. These results indicated that AcsepH was critical for normal septation, but not for nuclear division in A. chrysogenum. As observed under phase contrast microscope, the typical yeastlike cells were abundantly formed in the wild-type but not in the mutant after fermentation for 3 days. At the same time, the hypha septation in AcsepH mutant was about 30% of the wild-type in quantity. Unlike the wild-type, more hyphae of the mutant were dead which could not be stained with DAPI after fermentation for 4 days. The defections of septation and hyphal vitality were rescued in the complementary strain (Figs. 7 and 8). Additionally, the lack of AcsepH also resulted in reduction (20–30%) in the number of

hyphal septa when the fungus grew in the sporulation medium. This further confirmed that deficiency of AcSEPH hindered the septum formation and cytokinesis in A. chrysogenum.

4. Discussion Secondary metabolites are produced from primary metabolites which are closely related with cellular growth and utilization of nitrogen and carbon source, therefore fungal growth and morphological differentiation have some relationships with the secondary metabolism (Bartoshevich et al., 1990; Betina, 1995; Keller et al., 2005). The nitrogen source is different in TSA and MMDN media. MMDN is the defined medium containing inorganic nitrogen. TSA is the complex medium with tryptone and soytone as nitrogen source. Thus the growth rate demonstrated the fungal utilization ability for different nitrogen source. We speculate that the utilization ability for different nitrogen source may affect secondary metabolism in fungi. Thus, the mutants which grew normally in TSA medium and grew slowly in MMDN medium were selected. To search the genes involved in the cephalosporin production in A. chrysogenum, we constructed T-DNA inserted mutants of the wild-type strain CGMCC3.3795 and screened the mutants on the

18

L.-k. Long et al. / Fungal Genetics and Biology 50 (2013) 11–20

Fig. 7. Cellular death of the A. chrysogenum wild-type strain (WT), AcsepH disruption mutant (1223) and complemented strain (CM). After 4 days of fermentation in MDFA medium, fungal tissues were stained with Evans blue (A) or propidium iodide (B), and examined under the bright-field microscope or the fluorescene microscope. Dead cells were strained blue after Evans blue staining or stained red with propidium iodide. Bar = 15 lm.

basis of fungal growth or morphogenesis. A slow-growth mutant 1223 was found to reduce cephalosporin production in the primary fermentation experiment (data not shown). Analysis of the T-DNA flanking regions revealed that the mutant was partially (1.7-kb fragment of the 50 terminus) deleted in a putative septation protein encoding gene AcsepH. The deduced AcSEPH (1415 aa) contains a conserved S_TKc domain with twelve subdomains at the N-terminal region (sites 48–301), which plays essential roles in enzyme structure and function (Bardin et al., 2003; Dickmana and Yarden, 1999; Hanks and Hunter, 1995). AcSEPH is most closely to the septation protein H from other filamentous fungi based on the phylogenetic analysis of S_TKc domains. SEPH of A. nidulans is an orthologue of Schizosaccharomyces pombe Cdc7 protein, and similar to Cdc15 of Saccharomyces cerevisiae (Bruno et al., 2001). Cdc7 of S. pombe plays a key role in initiation of septum formation and cytokinesis, and is a dosage dependent regulator of septum formation (Fankhauser and Simanis, 1994). In A. nidulans, sepH is required for the initiation of cytokinesis and construction of the actin ring (Bruno et al., 2001). In our investigation, disruption of AcsepH prevented the septation and resulted in the formation of multinucleate cells, this defection was rescued in the complementary strain, suggesting that AcsepH is invovled in septation of A. chrysogenum. Not all the SEPH homologs positively regulate septum formation, Sep1 (the homolog of S. pombe Cdc7) of Magnaporthe oryzae may act as a negative regulator of cytokinesis as more septa were formed in the mutant of sep1G849R (Saunders et al., 2010). Thus, the functions of conserved cytokinesis related protein in eukaryotes may not always be identical across different species (Goh et al., 2011). The Cdc7-deficient strain of S. pombe and the sep1G849R mutants of M. oryzae display temperature-sensitive (Fankhauser and Simanis, 1994; Saunders et al., 2010). At restrictive temperature (42 °C), the A. nidulans sepH1 mutant is unable to form septa and conidiation (Bruno et al., 2001). However, the AcsepH disruption mutant of A. chrysogenum did not show more sensitive to high temperature (40 °C) than the wild-type strain in our study. Since the A. chrysogenum wild-type and AcsepH mutant strains did not germinate and grow at 42 °C in the test medium, it could not compare the sensitivity of A. chrysogenum and other fungi.

The SEPH is not required for vegetative growth of A. nidulans by the comparison of radial growth rate sepH1 mutant and wild-type colonies at permissive or restrictive temperatures (Bruno et al., 2001; Harris et al., 1994). Differently, the lacking of sep1 in M. oryzae could lead to the hyphal growth defect (Saunders et al., 2010). We found that there was no significant difference of the colonial sizes between the AcsepH mutant and wild-type strain grown on LPE plate, but the biomass of the mutant was lower than the wild-type at the early stage of growth (data not shown). The growth of AcsepH mutant was also delayed in liquid MDFA medium. The functional difference between AcsepH of A. chrysogenum and sepH of A. nidulans is probably due to the different septation regulatory cascade in different fungi. To elucidate the septation regulatory cascade of A. chrysogenum, more studies need to do in future. Conidiation of the AcsepH-deficient strain was significantly inhibited in sporulation medium (LPE), only one-seventh of conidia was formed comparing with the wild-type strain. On the other hand, more than 20% conidia from the AcsepH disruption mutant contained multiple nuclei. This is similar to A. nidulans which the sepH is required for production of uninucleate spores (Bruno et al., 2001). It is possible that the formation of multinucleate cells is due to the inhibition of septation and continuing nuclei division. Hyphal growth and morphological differentiation of A. chrysogenum commonly associated with the secondary metabolism (Bartoshevich et al., 1990; Queenearn and Ellis, 1975). In MDFA medium, the hyphal growth of AcsepH mutant was delayed 1–2 days compared to the wild-type strain, and cephalosporin production of the mutant declined to about one quarter of that produced by the wild-type. Since absence of AcsepH reduced the fungal growth, increment of seed inoculation was performed in the fermentation of AcsepH mutant. However, this could not improve the accumulation of cephalosporin (data not shown). The cephalosporin C production decreased was closely coordinated with the decline of yeast-like cells which are associated with the active synthesis of cephalosporin C (Bartoshevich et al., 1990). Although transcriptional analysis further verified that the transcriptions of cephalosporin biosynthetic genes pcbC and cefEF declined significantly during the early stage (for pcbC) and throughout (for cefEF) fermen-

L.-k. Long et al. / Fungal Genetics and Biology 50 (2013) 11–20

19

Fig. 8. Distributions of nuclei and septa in the A. chrysogenum wild-type strain (WT), AcsepH disruption mutant (1223) and complemented strain (CM) grown in MDFA medium. Fungal tissues were stained with DAPI/CFW and examined under an upright fluorescent microscope. Quantity of septa in the AcsepH mutant was less than the WT or CM strain. The septa in mutant were marked by arrowheads. Bar = 5 lm.

tation in the AcsepH mutant, it is still hard to know how lack of AcSEPH in A. chrysogenum seriously reduced the cephalosporin biosynthesis. In A. chrysogenum, arthrospores especially yeast-like cells represent metabolically active cells and the morphological differentiation into arthrospores coincides with the maximum production of cephalosporin C (Bartoshevich et al., 1990; Nash and Huber, 1971). After 3–4 days fermentation, the vegetative hyphae of AcsepH mutant swelled largely but they were difficult to form typical yeast-like cells which abundantly formed by the wild-type, and a few arthrospores were formed by the mutant during the final stage of fermentation. The reduced arthrospores formation in the AcsepH mutant might be a possible explanation for the decline in cephalosporin production. It is known that the global regulator CPCR1 controls the arthroposre formation and the transcription of pcbC in A. chrysogenum (Hoff et al., 2005; Schmitt et al., 2004b). The transcriptional level of cpcR1 in the mutant was lower than the wilttype at 3 or 4 days of fermentation. Then, we speculate that there exist some relationship between AcSEPH and CPCR1. Evans blue and PI stains are easy and effective methods to determine cell viability (Chen and Dickman, 2005; Jacobson et al., 1998; Raschke and Knorr, 2009). By the determinations, we found that the percentage of dead cells in AcsepH mutant was higher than these in the wild-type at the late stage of fermentation, suggesting that absence of AcSEPH in A. chrysogenum accelerated the cell death in liquid fermentation. The cell death might relate to low number of septa formed in the AcsepH mutant, resulting in multinucleate cells, and the abnormal swell of hyphae. Since AcsepH is required for normal septation in A. chrysogenum, its absence might change the cellular physiological status and decline the cephalosporin production. Understanding the action mechanism of AcsepH in vivo will be helpful to reveal the molecular base of cell division cycle and cellular differentiation in this important industrial fungus.

Acknowledgments We thank Prof. Xingzhong Liu (Institute of Microbiology, Chinese Academy of Sciences) and Prof. Seogchan Kang (Penn State University, USA) for providing the plasmid pAg1-H3. This work was supported by grants from the National Natural Science Foundation of China (grant number 31030003), the Knowledge Innovation Program of the Chinese Academy of Sciences (Grant No. KSCX2-EW-J-6) and the Ministry of Science and Technology of China (Grant No. 2010ZX09401-403). Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.fgb.2012.11.002. References An, Y., Dong, H.L., Liu, G., 2012. Expression of cefF significantly decreased deacetoxycephalosporin C formation during cephalosporin C production in Acremonium chrysogenum. J. Ind. Microbiol. Biot. 39, 269–274. Bardin, A.J., Boselli, M.G., Amon, A., 2003. Mitotic exit regulation through distinct domains within the protein kinase Cdc15. Mol. Cell. Biol. 23, 5018–5030. Bartoshevich, Y.E., Zaslavskaya, P.L., Novak, M.J., Yudina, O.D., 1990. Acremonium chrysogenum differentiation and biosynthesis of cephalosporin. J. Basic Microbiol. 30, 313–320. Betina, V., 1995. Differentiation and secondary metabolism in some prokaryotes and fungi. Folia Microbiol. 40, 51–67. Bruno, K.S., Morrell, J.L., Hamer, J.E., Staiger, C.J., 2001. SEPH, a Cdc7p orthologue from Aspergillus nidulans, functions upstream of actin ring formation during cytokinesis. Mol. Microbiol. 42, 3–12. Calvo, A.M., 2008. The VeA regulatory system and its role in morphological and chemical development in fungi. Fungal Genet. Biol. 45, 1053–1061. Calvo, A.M., Wilson, R.A., Bok, J.W., Keller, N.P., 2002. Relationship between secondary metabolism and fungal development. Microbiol. Mol. Biol. Rev. 66, 447–459. Chen, C., Dickman, M.B., 2005. Proline suppresses apoptosis in the fungal pathogen Colletotrichum trifolii. PNAS 102, 3459–3464.

20

L.-k. Long et al. / Fungal Genetics and Biology 50 (2013) 11–20

Csikász-Nagy, A., Kapuy, O., Gyorffy, B., Tyson, J.J., Novák, B., 2007. Modeling the septation initiation network (SIN) in fission yeast cells. Curr. Genet. 51, 245– 255. Demain, A.L., Zhang, J.Y., 1998. Cephalosporin C production by Cephalosporium acremonium: the methionine story. Crit. Rev. Biotechnol. 18, 283–294. Dickmana, M.B., Yarden, O., 1999. Serine/threonine protein kinases and phosphatases in filamentious fungi. Fungal Genet. Biol. 26, 99–117. Dreyer, J., Eichhorn, H., Friedlin, E., Kurnsteiner, H., Kuck, U., 2007. A homologue of the Aspergillus velvet gene regulates both cephalosporin C biosynthesis and hyphal fragmentation in Acremonium chrysogenum. Appl. Environ. Microbiol. 73, 3412–3422. Fankhauser, C., Simanis, V., 1994. The cdc7 protein kinase is a dosage dependent regulator of septum formation in fission yeast. EMBO J. 13, 3011–3019. Goh, J.G., Kim, K.S., Park, J., Jeon, J., Park, S.-Y., Lee, Y.-H., 2011. The cell cycle gene MoCDC15 regulates hyphal growth, asexual development and plant infection in the rice blast pathogen Magnaporthe oryzae. Fungal Genet. Biol. 48, 784–792. Hanks, S.K., Hunter, T., 1995. Protein kinases 6. The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. FASEB J. 9, 576–596. Hanks, S.K., Quinn, A.M., Hunter, T., 1988. The protein-kinase family-conserved features and deduced phylogeny of the catalytic domains. Science 241, 42–52. Harris, S.D., 2012. Molecular basis of morphogenesis in fungi. Morphogenesis and pathogenicity in fungi. Topics Curr. Genet. 22 (2012), 1–20. http://dx.doi.org/ 10.1007/978-3-642-22916-9_1. Harris, S.D., Morrell, J.L., Hamer, J., 1994. Identification and characterization of Aspergillus nidulans mutants defective in cytokinesis. Genetics 136, 517–532. Hoff, B., Schmitt, E.K., Kuck, U., 2005. CPCR1, but not its interacting transcription factor AcFKH1, controls fungal arthrospore formation in Acremonium chrysogenum. Mol. Microbiol. 56, 1220–1233. Jacobson, D.J., Beurkens, K., Klomparens, K.L., 1998. Microscopic and ultrastructural examination of vegetative incompatibility in partial diploids heterozygous at het loci in Neurospora crassa. Fungal Genet. Biol. 23, 45–56. Keller, N.P., Turner, G., Bennett, J.W., 2005. Fungal secondary metabolism-from biochemistry to genomics. Nat. Rev. Microbiol. 3, 937–947. Krapp, A., Simanis, V., 2008. An overview of the fission yeast septation initiation network (SIN). Biochem. Soc. Trans. 36, 411–415. Liu, Y., Gong, G., Xie, L., Yuan, N., Zhu, C., Zhu, B., Hu, Y., 2010. Improvement of cephalosporin C production by recombinant DNA integration in Acremonium chrysogenum. Mol. Biotechnol. 44, 101–109. Liu, Y.G., Chen, Y., 2007. High-efficiency thermal asymmetric interlaced PCR for amplification of unknown flanking sequences. Biotechniques 43, 649–656. Long, L.K., Yang, J., An, Y., Liu, G., 2012. Disruption of a glutathione reductase encoding gene in Acremonium chrysogenum leads to reduction of its growth, cephalosporin production and antioxidative ability which is recovered by exogenous methionine. Fungal Genet. Biol. 49, 114–122. Martin, J.F., Ullan, R.V., Casqueiro, J., 2004. Novel genes involved in cephalosporin biosynthesis: the three-component isopenicillin N epimerase system. Adv. Biochem. Eng. Biotechnol. 88, 91–109. Martin, J.F., Ullan, R.V., Garcia-Estrada, C., 2010. Regulation and compartmentalization of beta-lactam biosynthesis. Microb. Biotechnol. 3, 285–299. Nash, C.H., Huber, F.M., 1971. Antibiotic synthesis and morphological differentiation of Cephalosporium acremonium. Appl. Microbiol. 22, 6–10. Park, G., Pan, S., Borkovich, K.A., 2008. Mitogen-activated protein kinase cascade required for regulation of development and secondary metabolism in Neurospora crassa. Eukaryotic Cell 7, 2113–2122. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in realtime RT-PCR. Nucl. Acids Res. 29, 2002–2007. Pöggeler, S., Hoff, B., Kück, U., 2008. Asexual cephalosporin C producer Acremonium chrysogenum carries a functional mating type locus. Appl. Environ. Microbiol. 74, 6006–6016.

Queenearn, S.W., Ellis, D.L.F., 1975. Differentiation of mutants of Cephalosporium acremonium in complex medium: the formation of unicellular arthrospores and their germination. Can. J. Microbiol. 21, 1981–1996. Raschke, D., Knorr, D., 2009. Rapid monitoring of cell size, vitality and lipid droplet development in the oleaginous yeast Waltomyces lipofer. J. Microbiol. Methods 79, 178–183. RodrÍguez-Sáiz, M., de la Fuente, J., Barredo, J.-L., 2005. Metabolic Engineering of Acremonium chrysogenum to produce deacetoxycephalosporin C and bioconversion to 7-aminodeacetoxycephalosporanic acid. Microb. Process Prod. 18, 41–64. Sámi, L., Emri, T., Pócsi, I., 2001. Autolysis and ageing of Penicillium chrysogenum cultures under carbon starvation: glutathione-metabolism and formation of reactive oxygen species. Mycol. Res. 105, 1246–1250. Sándor, E., Pusztahelyi, T., Karaffa, L., Karányi, Z., Pócsi, I., Biró, S., Szentirmai, A., Pócsi, I., 1998. Allosamidin inhibits the fragmentation of Acremonium chrysogenum but does not influence the cephalosporin-C production of the fungus. FEMS Microbiol. Lett. 164, 231–236. Sándor, E., Szentirmai, A., Paul, G.C., Thomas, C.R., Pócsi, L., Karaffa, L., 2001. Analysis of the relationship between growth, cephalosporin C production, and fragmentation in Acremonium chrysogenum. Can. J. Microbiol. 47, 801–806. Sato, I., Shimatani, K., Fujita, K., Abe, T., Shimizu, M., Fujii, T., Hoshino, T., Takaya, N., 2011. Glutathione reductase/glutathione is responsible for cytotoxic elemental sulfur tolerance via polysulfide shuttle in fungi. J. Biol. Chem. 286, 20283– 20291. Saunders, D.G.O., Dagdas, Y.F., Talbot, N.J., 2010. Spatial uncoupling of mitosis and cytokinesis during appresorium-mediated plant infection by the rice blast fungus Magnaporthe oryzae. Plant Cell. 22, 2417–2428. Schmitt, E.K., Hoff, B., Kuck, U., 2004a. Regulation of cephalosporin biosynthesis. Adv. Biochem. Eng. Biotechnol. 88, 1–43. Schmitt, E.K., Hoff, B., Kuck, U., 2004b. AcFKH1, a novel member of the forkhead family, associates with the RFX transcription factor CPCR1 in the cephalosporin C producing fungus Acremonium chrysogenum. Gene 342, 269–281. Schweitzer, B., Philippsen, P., 1991. CDC15, an essential cell cycle gene in Saccharomyces cerevisiae, encodes a protein kinased domain. Yeast 7, 265–273. Scott, B., Eaton, C.J., 2008. Role of reactive oxygen species in fungal cellular differentiations. Curr. Opin. Microbiol. 11, 488–493. Sharpless, K.E., Harris, S.D., 2002. Functional characterization and localization of the Aspergillus nidulans formin SEPA. Mol. Biol. Cell 13, 469–479. Shin, H.Y., Lee, J.Y., Jung, Y.R., Kim, S.W., 2010. Stimulation of cephalosporin C production in Acremonium chrysogenum M35 by glycerol. Bioresour. Technol. 101, 4549–4553. Si, H., Justa-Schuch, D., Seiler, S., Harris, S.D., 2010. Regulation of septum formation by the Bud3-Rho4 GTPase module in Aspergillus nidulans. Genetics 185, 165– 176. Weld, R.J., Plummer, K.M., Carpenter, M.A., Ridgway, H.J., 2006. Approaches to functional genomics in filamentous fungi. Cell Res. 16, 31–44. Ye, X.S., Lee, S.L., Wolkow, T.D., McGuire, S.L., Hamer, J.E., Wood, G.C., Osmani, S.A., 1999. Interaction between developmental and cell cycle regulators is required for morphogenesis in Aspergillus nidulans. EMBO J. 18, 6994–7001. Zhang, A., Lu, P., Dahl-Roshak, A.M., Paress, P.S., Kennedy, S., Tkacz, J.S., An, Z., 2003. Efficient disruption of a polyketide synthase gene (pks1) required for melanin synthesis through Agrobacterium-mediated transformation of Glarea lozoyensis. Mol. Gen. Genom. 268, 645–655. Zhong, Y., Wang, X., Yu, H., Liang, S., Wang, T., 2012. Application of T-DNA insertional mutagenesis for improving cellulase production in the filamentous fungus Trichoderma reesei. Bioresour. Technol. 110, 572–577. Zhong, Y.H., Yu, H.N., Wang, X.L., Lu, Y., Wang, T.H., 2011. Towards a novel efficient T-DNA-based mutagenesis and screening system using green fluorescent protein as a vital reporter in the industrially important fungus Trichoderma reesei. Mol. Biol. Rep. 38, 4145–4151.