A short-hairpin RNA targeting osteopontin downregulates MMP-2 and MMP-9 expressions in prostate cancer PC-3 cells

Cancer Letters 295 (2010) 27–37

Contents lists available at ScienceDirect

Cancer Letters journal homepage: www.elsevier.com/locate/canlet

A short-hairpin RNA targeting osteopontin downregulates MMP-2 and MMP-9 expressions in prostate cancer PC-3 cells Hao Liu, Anmin Chen, Fengjing Guo *, Lin Yuan Department of Orthopedics, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, China

a r t i c l e

i n f o

Article history: Received 30 November 2009 Received in revised form 28 January 2010 Accepted 11 February 2010

Keywords: Osteopontin Matrix metalloproteinase Nuclear factor kappaB Human prostate cancer Gene therapy

a b s t r a c t Osteopontin (OPN), a secreted phosphoglycoprotein, is frequently associated with cell proliferation and tumor metastatic spread in a variety of cancers. It has been reported that OPN induce matrix metalloproteinase (MMP)-2 and MMP-9 activations through nuclear factor kappaB (NF-jB)-mediated signaling pathways. In this study, we investigated the roles of OPN in human prostate cancer cells and provided clues about the possible functions of IkappaB kinase (IKK) in NF-jB-mediated OPN-induced activations of MMP-2 and MMP-9. Short-hairpin RNA (shRNA) expression vectors were used to inhibit OPN expression in PC-3 cells, human prostate cancer cell line, and IKK inhibitor VII were applied to inhibit the activities of IKK-1 and IKK-2. The results showed that OPN shRNA-mediated RNA interference can downregulate OPN, MMP-2 and MMP-9 expressions, thereby resulting in suppression of the proliferation, migration and invasion of PC-3 cells in vitro and tumor growth in vivo. Moreover, the inhibition of IKK-2 can suppress MMP-2 and MMP9 expressions, in contrast, the inhibition of IKK-1 has no effects on the OPN, MMP-2 and MMP-9 expression levels. Thus, this study demonstrated that OPN knockdown could downregulate MMP-2 and MMP-9 expressions result in inhibiting the malignant physiological behaviors of PC-3 cell and that IKK-2 may play a crucial role in OPN-induced MMP-2 and MMP-9 expressions via NF-jB-mediated signaling pathways. Ó 2010 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Prostate cancer is one of the malignant tumors with a high incidence of metastases. Deaths from prostate cancer are partly the results of distant metastases, especially osseAbbreviations: DMEM-F12, mixture (1:1) Dulbecco’s-modified minimum essential medium and Ham’s F-12 medium; EGFR, epidermal growth factor receptor; EGFP, enhanced green fluorescent protein; FBS, fetal bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IKK, IkappaB alpha kinase; MMP, matrix metalloproteinase; NF-jB, nuclear factor kappaB; OPN, osteopontin; RNAi, RNA interference; shRNA, short-hairpin RNA; siRNA, small interfering RNA; uPA, urokinase plasminogen activator. * Corresponding author. Address: Department of Orthopedics, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Liberalization Street, No. 1095, 430030 Wuhan, China. Tel.: +86 27 8670 8550; fax: +86 27 8364 6605. E-mail address: [email protected] (F. Guo). 0304-3835/$ - see front matter Ó 2010 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.canlet.2010.02.012

ous and pulmonary metastases [1,2]. Therefore, identification of the target genes associated with the progression of prostate cancer is necessary to improve the survival of patients with this type of tumor. Substantial data have linked osteopontin (OPN), a secreted phosphoglycoprotein, with tumor progression and metastatic spread [3–7]. However, the molecular mechanisms that define the roles of OPN in these processes are complex and have not completely understood. Cumulative evidences showed that OPN play important roles in tumorigenesis, invasion and metastases in a variety of cancers, but previous evidences generally focus on breast cancers, lung cancers and gastrointestinal tract tumors [8–11]. The reports about the role of OPN on the progression of human prostate cancer are relatively less and some are short of direct functional evidences. A recent study published by Jain et al. [12] reported that OPN level is significantly

28

H. Liu et al. / Cancer Letters 295 (2010) 27–37

elevated in the tumor tissues and plasma of patients with advanced prostate cancer. Likewise, OPN overexpression has been associated with tumor progression in diverse tumor histiotypes [4–6]. Functionally, overexpression of OPN increases cell invasiveness and plasminogen activator expression in human mammary epithelial cells [13]. Reduced OPN expression decreases colony formation and the incidence of osseous metastases of human breast cancer cells [14,15], while an OPN antisense oligonucleotide can decreased colony formation and reduced osteolytic metastases in human breast cancer cell [16]. OPN-deficient mice showed reduced metastases to bone and local soft tissues and decreased osseous and pulmonary metastases with B16 melanoma cells [17,18]. Polyclonal antibodies to human OPN (hOPN) stimulated anchorage-independent growth of the human prostate cancer cells in vitro and antibodies to hOPN can suppress the growth-stimulatory effect by endogenous OPN [2]. In all, OPN is generally associated with tumor progression and metastasis. Recently, it has been identified that several OPN-dependent molecules, such as CD44, avb3, matrix metalloproteinase (MMP)-2 and MMP-9, regulate the adhesion, progression and invasion of tumor cells [19–24]. OPN enhances the abilities of mobility and chemical invasiveness of malignant tumor cells possibly through regulating the activities of MMP-2 and MMP-9, which degradate extracellular matrix [19,25,26]. It has been reported that OPN expression obviously increase in PC-3 cells, a human prostate cancer line with a high incidence of metastases [19]. A recent study involving prostate cancer by Khodavirdi et al. [27] found that OPN could lead to increased proliferation, invasion, and to enhanced ability to intravasate into blood vessels. However, the molecular mechanisms that define the roles of OPN in osseous metastases of prostate cancer are complicated and the effects of OPN on the malignant biological behaviors of PC-3 cells have not completely understood. Kundu et al. [25,26] reported that OPN induces nuclear factor kappaB (NF-jB)-mediated MMP-2 and MMP-9 activations through IjBa kinase (IKK)-dependent signaling pathways in murine melanoma cells. Mercurio et al. [28] revealed that mutant versions of IKK-2, one of the catalytic subunits of IKK, exert an influence on NFjB-dependent reporter activity, consistent with a critical role for IKK in the NF-jB signaling pathway. In this regard, whether OPN can mediate the expressions of MMP-2 and MMP-9 in human prostate cancer PC-3 cells, and whether

IKK-1 and IKK-2 have different functions in these processes has not been understood. The goals of the present study were to evaluate the roles of OPN in PC-3 cells and determine the possible functions of IKK-1 and IKK-2 in NF-jBmediated OPN-induced MMP-2 and MMP-9 activations. 2. Materials and methods 2.1. OPN short-hairpin RNA sequences and constructions Using the GenBank sequence for human OPN mRNA (GenBank accession No. J04765.1), we selected four candidate sequences in the OPN mRNA sequence for RNA interference (RNAi). The details of these sequences are shown in Table 1. These 21-nt sequences show no homology with other known genes in the human genome by Blast analysis. Synthesis and purification of recombinant plasmid (PGPU6/GFP/Neo-OPN) were confided to Shanghai GenePharma Co., Ltd. Four kinds of recombinant plasmid were transfected into PC-3 cells respectively and RT-PCR methods were used to screen the most highly functional shRNA recombinant plasmid for further studies. 2.2. Cell culture and transfection The human prostate cancer cell line PC-3 was obtained from the China Center for Type Culture Collection (Wuhan, China). Cell line was cultured in DMEM/F12 (1:1) medium supplemented with 10% fetal bovine serum (FBS). Transfections were carried out using Lipofectamine 2000 (TaKaRa Co., Tokyo, Japan) according to the manufacturer’s instructions. The cells stably transfected with recombinant plasmid were selected in medium containing G418 at a final concentration of 600 lg/mL for 72 h. Stable transfected cells (PC/OPN1, PC/OPN2, PC/OPN3 and PC/OPN4) were screened by limiting dilution assay. The stable transfected unicell clones, of which the fluorescence can last for 15 generations, were tested by RT-PCR and Western blot. Cells transfected with mock vectors (PC/Vect) and untreated PC3 cells (PCs) were regarded as control groups. 2.3. Screening for a highly functional recombinant plasmid by RT-PCR Stably transfected cells were collected during the logarithmic growth phase. RT-PCR was performed using a ReverTra Ace-a™ One-Step Kit (Toyobo Co., Osaka, Japan)

Table 1 The details of OPN shRNA sequences used in this study. shRNA notation

Targeted OPN mRNA sequence

Loop

Reverse complement sequence

Termination signal

Position in GenBank (J04765.1)

OPN1 OPN2 OPN3 OPN4

CACCGCCATACCAGTTAAACAGGCT CACCGCAGCTTTACAACAAATACCC CACCGAGCAATGAGCATTCCGATGT CACCGCCATGAAGATATGCTGGTTG

TTCAAGAGA TTCAAGAGA TTCAAGAGA TTCAAGAGA

AGCCTGTTTAACTGGTATGGC GGGTATTTGTTGTAAAGCTGC ACATCGGAATGCTCATTGCTC CAACCAGCATATCTTCATGGC

TTTTTTG TTTTTTG TTTTTTG TTTTTTG

154 198 825 906

The OPN shRNAs were cloned into eukaryotic expression plasmid PGPU6/GFP/Neo to evaluate the efficiency of OPN gene silencing. This table gives the notations of OPN shRNAs used in this paper, the sequences that OPN shRNAs are expected to target and their positions (GenBank accession No. J04765.1) in different regions of the OPN mRNA. The hairpin structure is composed of twenty-one pairs of complementary bases, a loop including nine oligonucleotides and a termination sequence.

29

H. Liu et al. / Cancer Letters 295 (2010) 27–37

and DDCT. We used RQ (2DDCT) values to assess the relative quantities of special mRNA expression.

Table 2 Primers used in RT-PCR and real-time PCR. Notations

Primer sequences

Amplification fragment

OPN

Forward, 50 GTTAAACAGGCTGATTCTGG-30 Reverse, 50 CATGGTCATCATCATCTTCA-30

193 bp

MMP-2

Forward, 50 TACACCAAGAACTTCCGTCT-30 Reverse, 50 GCCATCAAATACAATGTCCT-30

153 bp

MMP-9

Forward, 50 GCAGAGGAATACCTGTACCGC-30 Reverse, 50 AGGTTTGGAATCTGCCCAGGT-3

196 bp

GAPDH

Forward, 50 ACGACCACTTTGTCAAGCTC-30 Reverse, 50 GTGAGGAGGGGAGATTCAGT-30

210 bp

according to the manufacturer’s instructions. Human GAPDH was amplified as a housekeeping gene. The primers for OPN amplification used in RT-PCR were showed on Table 2. The primers used for GAPDH amplification were: forward, reverse, 50 -TCCAC50 -ACCACAGTCCATGCCATCAC-30 ; CACCCTGTTGCTGTA-30 . The amplification conditions were as follows: 95 °C for 5 min; 40 cycles of 94 °C for 30 s, 54 °C for 30 s and 72 °C for 30 s; 72 °C for 5 min. The PCR products were separated by 1.5% agarose gel electrophoresis. The optical density ratios of OPN to GAPDH were calculated to represent the relative expression amounts of OPN mRNA, and the most highly functional shRNA recombinant plasmid (PGPU6/GFP/Neo-OPN2) was selected for further studies. 2.4. Real-time PCR analysis Three sorts of cell clones (PCs, PC/Vect and PC/OPN2) were harvested during the logarithmic growth phase. Total RNAs were extracted from the harvested cells using the Trizol reagent (Invitrogen Co., Carlsbad, CA). After removal of genomic DNA and reverse transcription using a reverse transcription system kit (Toyobo Co.), fluorescent quantitative real-time PCR amplifications were performed as follows: 50 °C for 2 min; 95 °C for 10 min; 40 cycles of 95 °C for 15 s and 60 °C for 45 s; 60 °C for 10 s. The primers used in real-time PCR were showed on Table 2. According to the amplification plots and melting curves, we determined that the results were creditable and calculated the DCT

2.5. Western blot assay Cells were harvested and total proteins were extracted using RIPA Extraction Reagents (ProMab Biotechnologies, Albany, CA). Total cell lysate samples (20–40 lg protein per lane) were prepared in 1 loading buffer. The proteins in the samples were separated by 10% SDS–PAGE and transferred onto PVDF membranes. The membranes were blocked with 5% skimmed milk for 2 h at room temperature, then incubated with the primary antibody overnight at 4 °C, and then incubated with a secondary antibody for 1 h at room temperature. The antigen–antibody complexes were visualized using an enhanced chemiluminescence kit (BestBio Co., Shanghai, China). The antibodies used in Western blot assays were showed in Table 3. 2.6. Flow cytometry assay Cells were collected during the logarithmic growth phase and then unicell suspensions were prepared and incubated with 75% alcohol overnight. After poaching with phosphate buffered solution (PBS) for three times, the cell suspensions were added with RNaseA at 10 mg/L concentration, and then were dyed using propidium iodide (PI) away from light for 30 min. DNA quantities in different cell cycles (G0/G1, S and G2/M phases) were analysed by flow cytometry. Each groups detected in triplicate experiments and mean were calculated. 2.7. In vitro cell growth assay To assess possible impacts of OPN shRNA on PC-3 cells’ malignant biological behaviors. The cells were trypsinized, counted, plated and assayed for cell proliferation, migration and invasion in triplicate experiments. For proliferation assays, cells in the log-growth phase were harvested, suspended at a density of approximately 1  104 cells/lL and seeded into triplicate wells of 96-well plates at 100 lL/well. After 24 h of culture, 50 lL of 1 MTT was added to each well. The plates were then incubated at 37 °C for 4 h. After removal of the supernatants, the precipitates were solubilized in DMSO (150 lL/well) and shaken for 20 min. The absorbances of the wells were measured at a wavelength of 450 nm and the numbers of surviving cells were calculated.

Table 3 Antibodies used in Western blot assays and their titres. Primary antibody and titre

Corporation and batch no.

Secondary antibody and titre

Target protein and batch no.

Rabbit OPN antibody (1:400) Mouse MMP-2 antibody (1:300) Rabbit MMP-9 antibody (1:500) Mouse GAPDH antibody (1:800) Rabbit IKK-1 antibody (1:300) Mouse IKK-2 antibody (1:300)

SANTA, SC-20788 ZYMED, 35-1300Z SANTA, SC-10737 ProMab, Mab-2005079 SANTA, SC-7182 SANTA, SC-130152

Goat Goat Goat Goat Goat Goat

66 kD, 72 kD, 92 kD, 37 kD, 85 kD, 87 kD,

Anti Anti Anti Anti Anti Anti

Rabbit IgG/HRP (1:40000) Mouse IgG/HRP (1:30000) Rabbit IgG/HRP (1:50000) Mouse IgG/HRP (1:80000) Rabbit IgG/HRP (1:30000) Mouse IgG/HRP (1:30000)

SC-2004 L1I006 SC-2004 L1I006 SC-2004 L1I006

H. Liu et al. / Cancer Letters 295 (2010) 27–37

2.8. In vitro migration and invasion assays Sterile polycarbonate membrane filters (Corning Inc., New York, NY) with 8-lm pores were coated with 6 lg/ mL Matrigel gelatin (BD Co., Franklin Lakes, NJ). The filters were hydrated with 200 lL of serum-free medium at 37 °C for 60 min before use. Cells (5  104) were seeded into the top chambers of 6-well plates, and the lower chambers were filled with 500 lL of DMEM/F12 (1:1) medium containing 10% FBS. The plates incubated in a 5% CO2 humidified incubator at 37 °C for 24 h. The filters were fixed with 95% alcohol and stained with hematoxylin for 15 min. The cells on the upper surface were gently removed with a cotton swab and the cells on the lower surface of the filters were quantified under a microscope at 400 magnification. For invasion assays, Matrigel-coated sterile 8-lm polyethylene filters were rehydrated as described above. The lower chambers of 24-well plates were filled with 1 mL of DMEM/F12 (1:1) medium containing 10 lg of fibronectin as a chemoattractant and 0.5 mL of serum-free DMEM/F12 (1:1) containing 5  104 PC-3 cells was added to the upper chambers. The plates were then incubated at 37 °C in a 5% CO2 humidified atmosphere for 48 h. Subsequently, the cells were stained with hematoxylin and the numbers of cells that had invaded the filters were recorded. Each test group was assayed in triplicate. The average numbers of invaded cells were quantified. 2.9. Animal studies For growth assays in vivo, 6 to 8-week-old female nude mice (BALB/c-nu) were obtained from the Experimental Animal Center of Huazhong University of Science and Technology (Wuhan, China). All animals in our study were housed under pathogen-free conditions and maintained according to the guidelines of the Committee on Animals of Huazhong University of Science and Technology. Three groups of cells (PCs, PC/Vect and PC/OPN2) were harvested and single-cell suspensions (3  106 cells in 0.1 mL of Hanks solution) were injected subcutaneously into the nude mice. The tumor diameters were measured and the tumor volumes were calculated every 4 days. Tumor volumes were respectively calculated by the formulas: a2b/2 and ab2/2, here a and b are the two maximum diameters measured by a sliding caliper. Four weeks later, the mice were killed and the expressions of OPN, MMP-2 and MMP-9 in the tumor tissues were detected by real-time PCR and Western blot assays. 2.10. Enzyme linked immunosorbent assay

Wave XS. BIO-TEK Instruments, Inc., USA.) at 450 nm measurement wavelength. The blank samples and standard control samples were established. Each groups detected in triplicate experiments and the average numbers of OD values were quantified. The standard curves were drawn using CurveExpert 1.3 software. 2.11. Functional assays for IKK-1 and IKK-2 According to the instruction of Merck Corporation, 40 nmol/L and 200 nmol/L concentrations of IKK inhibitor VII could inhibit the activities of IKK-2 and IKK-1, respectively, in HUVEC cells. To determine whether it is also reliable in PC-3 cells, different clones were treated with different concentrations of IKK inhibitor VII (Merck, Darmstadt, Germany) for 72 h. IKK inhibitor VII is a cellpermeable benzamido-pyrimidine compound that acts as a potent, selective and ATP-competitive inhibitor of IKK. The experimental samples were grouped as follows: group 1: PC-3 cells treated with 200 nM IKK inhibitor VII; group 2: PC-3 cells treated with 40 nM IKK inhibitor VII; group 3: untreated PC-3 cells. Western blot analyses were performed for relative expressions of IKK-1 and IKK-2 in PC3 cells. To examine the effects of IKK inhibitor on the expressions of OPN, MMP-2 and MMP-9, different groups of cells (PCs, PC/Vect and PC/OPN) were treated with different concentrations of IKK inhibitor VII, then the cells were tested by real-time PCR and Western blot assays as described above. The experimental groups were as follows: group

A

B

Relative OPN mRNA Expression Levels 0.4

0.3 OPN/GAPDH

30

0.2

0.1

To examine whether OPN can regulate the activities of MMP-2 and MMP-9 in PC-3 cells, the semiconfluent cells were treated with 10 lm OPN (Wako Pure Chemical Industries, Ltd.) for 24 h at 37 °C. Then, the MMP-2 and MMP-9 human ELISA Kits (MI Co., USA) were used to detect and quantify protein levels of MMP-2 and MMP-9 in the condition culture supernatant of PC-3 cells according to the manufacturer’s instructions. OD values were measured by using of Universal Microplate Spectrophotometer (Power-

0.0 PC/OPN1

PC/OPN2

PC/OPN3

PC/OPN4

PC/Vect

Fig. 1. Screening for a highly functional recombinant plasmid by RT-PCR. (A) RT-PCR analysis of OPN mRNA expression levels in PC-3 cells transfected with recombinant plasmids. M: marker; L1–L5: OPN; L6– L10: GAPDH. L1 and L6: PC/OPN1; L2 and L7: PC/OPN2; L3 and L8: PC/ OPN3; L4 and L9: PC/OPN4; L5 and L10: PC/Vect (B) Relative expression levels of OPN mRNAs in PC-3 cells transfected with recombinant plasmids.

H. Liu et al. / Cancer Letters 295 (2010) 27–37

31

Fig. 2. OPN shRNA-induced downregulations of OPN, MMP-2 and MMP-9 in PC-3 cells. (A) Relative expression levels of OPN, MMP-2 and MMP-9 mRNAs in PC-3 cells detected by real-time PCR. P < 0.05, vs. PCs or PC/Vect. (B) and (C) Expression levels of OPN, MMP-2 and MMP-9 proteins in PC-3 cells detected by Western blot. Levels of GAPDH are shown and were evaluated as an internal control for loading. Compared with PCs or PC/Vect, the expression levels of OPN, MMP-2 and MMP-9 proteins in PC/OPN2 were decreased significantly.

Fig. 3. The diversity of cycle phase of three groups detected by flow cytometry. The cell cycles of PC/OPN2 group were blocked in S phase, and the DNA quantities of hypodiploid decreased significantly, compared with PCs or PC/Vect groups.

32

H. Liu et al. / Cancer Letters 295 (2010) 27–37

1: untreated PC-3 cells; group 2: PC-3 cells treated with 40 nM IKK inhibitor VII; group 3: PC/Vect cells treated with 40 nM IKK inhibitor VII; group 4: PC/OPN2 cells treated with 40 nM IKK inhibitor VII; group 5: PC-3 cells treated with 200 nM IKK inhibitor VII; group 6: PC/Vect cells treated with 200 nM IKK inhibitor VII; group 7: PC/OPN2 cells treated with 200 nM IKK inhibitor VII; group 8: PC/OPN2 cells. 2.12. Data analysis Data were expressed as means ± standard deviations. Statistical analyses were performed using Student’s t-test. Differences were considered to be statistically significant when the P value was <0.05.

Since the expression levels of GAPDH in the treated cells and controls showed no significant differences, these RNAi effects were specific. On the basis of these results, we selected PC/OPN2 for further studies.

3.2. OPN shRNA suppresses the expressions of OPN, MMP-2 and MMP-9 To determine whether the shRNA OPN recombinant plasmid could downregulate OPN, MMP-2 and MMP-9 expressions in PC-3 cells, realtime PCR and Western blot analyses were performed for OPN, MMP-2 and MMP-9, as well as GAPDH as an internal control. As shown in Fig. 2, compared with PCs, the mRNA and protein expression levels of OPN in PC/OPN2 were reduced by 72.89% and 48.15%, respectively (P < 0.05). On the other hand, the mRNA and protein expression levels of MMP-2 in PC/OPN2 were decreased by 44.62% and 52.10%, and the mRNA and protein expression levels of MMP-9 in PC/OPN2 were decreased by 49.89% and 28.81%, respectively (P < 0.05). However, PC/Vect showed no significant differences in the expressions of OPN, MMP-2 and MMP-9 compared with PCs.

3. Results 3.1. Screening of OPN shRNA recombinant plasmids

3.3. Analyses different cell phases by flow cytometry

As shown in Fig. 1, OPN expression was significantly inhibited by the OPN shRNA recombinant plasmids. Compared with PC/Vect, the OPN mRNA expression levels in clones PC/OPN1, PC/OPN2, PC/OPN3 and PC/ OPN4 were reduced by 43.51%, 78.76%, 52.32% and 36.83%, respectively.

The groups of PCs, PC/Vect and PC/OPN2 were detected by flow cytometry respectively. As shown in Fig. 3 and Table 4, compared with PCs group or PC/Vect group, the hypodiploid DNA quantities in PC/OPN group were obviously increased (P < 0.05), however, the DNA quantities

Table 4 Analyses of DNA quantities in different cell cycles by flow cytometry. Groups PCs PC/Vect PC/OPN

G0/G1 phase 40.23 ± 0.54 37.83 ± 1.71 43.40 ± 1.07

S phase 14.26 ± 1.16 18.80 ± 1.56 15.76 ± 1.28

G2/M phase 41.90 ± 2.52 39.97 ± 0.91 32.33 ± 0.83*

P < 0.05, vs. PCs group. Each group was assayed in triplicate experiments.

Growth Curves of Three Cell Groups

A = 450 nm

A

Comparisons of the Cell Migration and Invasion Activities Among Three Cell Groups

PCs

Migration

PC/OPN2

Invasion

PC/Vect

24h

B

48h

Cell Number

*

Hypodiploid DNA 3.61 ± 0.83 3.40 ± 0.76 8.52 ± 1.04*

72h

96h

PCs

PC/Vect

PC/OPN2

Fig. 4. OPN shRNA inhibited proliferation, migration and invasion of PC-3 cells in vitro. (A) Growth curves of three cell groups evaluated by MTT assays. (B) Comparisons of the cell migration and invasion activities among three cell groups. Compared with PCs, the cell migration and invasiveness of PC/OPN2 were reduced by 46.71% and 54.24%, respectively (P < 0.05) (B1, B2 and B3) The typical invasion photographs of three groups. B1: PCs group; B2: PC/Vect group; B3: PC/OPN2 group.

H. Liu et al. / Cancer Letters 295 (2010) 27–37 of G2/M phases were significantly decreased (P < 0.05). In contrast, PCs groups showed no significant differences compared with PC/Vect groups (P > 0.05).

33

cell migration and invasiveness of PC/OPN2 were reduced by 46.71% and 54.24%, respectively (P < 0.05). In contrast, PC/Vect showed no significant differences compared with PCs (P > 0.05). Taken together, these data suggest that the OPN shRNA significantly suppressed the proliferation, migration and invasion of PC-3 cells in vitro.

3.4. OPN shRNA suppresses the proliferation, migration and invasion of PC-3 cells in vitro 3.5. Tumor formation in vivo It has been reported that OPN silencing by small interfering RNA suppresses the proliferation, migration and invasion of CT26 murine colon adenocarcinoma cells in vitro and in vivo [29], therefore we first examined the effects of OPN on human prostate cancer PC-3 cell proliferation and anchorage-independent growth in vitro. As shown in Fig. 4A, the clones transfected with the OPN shRNA recombinant plasmid and mock vector for 24 h exhibited decreased cell proliferation by 2.17% and 0.81%, respectively (P > 0.05). However, after 48 h, the proliferation was significantly decreased by 8.97% and 4.72%, respectively, compared with PCs (P < 0.05). We further evaluated whether the suppressed expression of OPN altered the motility of PC-3 cells across Transwell polycarbonate membranes. As shown in Fig. 4B and Fig. 4 (C1–C3), compared with PCs, the

In tumor formation assays in nude mice, PCs and PC/Vect grew rapidly and resulted in palpable tumors at 4–5 days after injection. In contrast, the tumor formations were remarkably slower after injection of PC/ OPN2 cells and the diameters of the tumors were significantly smaller (Fig. 5A and A1–A3). To determine the status of OPN, MMP-2 and MMP9 in these tumor tissues, RNA was extracted from tumor tissues and real-time PCR assays were performed. The results (Fig. 5B) revealed that the mRNA expression levels of OPN, MMP-2 and MMP-9 in the tumor tissues of PC/OPN2 groups were decreased 74.40%, 54.32% and 47.21%, respectively (P < 0.05), compared with PCs groups. No significant differences were detected between the PC/Vect and PCs groups. These results

Fig. 5. Effects of OPN shRNA on tumor formation in vivo and the expression levels of OPN, MMP-2 and MMP-9 in tumor tissues. (A) PCs, PC/Vect, or PC/OPN2 cells were inoculated subcutaneously into the nude mice. Tumor growth was monitored and tumor volumes were calculated. P < 0.05, compared with PCs or PC/Vect. (A1, A2 and A3) Typical photographs of tumor formation in nude mice. A1: PCs group; A2: PC/Vect group; A3: PC/OPN2 group; (B) Relative expression levels of OPN, MMP-2 and MMP-9 mRNAs in tumor tissues of nude mice detected by real-time PCR assays. *P < 0.05, compared with PCs or PC/ Vect. (C) Expression levels of OPN, MMP-2 and MMP-9 proteins in tumor tissues of three groups detected by Western blot. GAPDH were evaluated as an internal control for loading. Compared with PCs group or PC/Vect group, the expression levels of OPN, MMP-2 and MMP-9 proteins in PC/OPN2 group were obviously decreased.

34

H. Liu et al. / Cancer Letters 295 (2010) 27–37

Table 5 Detection of OPN-induced MMP-2 and MMP-9 expressions by ELISA. Cell groups

OD values of MMP-2 (A = 450 nm)

MMP-2 concentrations (lg/ mL)

OD values of MMP-9 (A = 450 nm)

MMP-9 concentrations (lg/ mL)

PC-3 cells OPN + PC-3 cells

2.19 ± 0.12 2.63 ± 0.24a

3268.38 ± 263.53 4435.84 ± 657.87a

2.78 ± 0.30 3.25 ± 0.21a

1940.47 ± 186.36 2531.92 ± 254.75a

Each group was assayed in triplicate experiments. a P < 0.05, compared with PC-3 cells, respectively.

indicated that inhibition of OPN by shRNA expression vector was stable in vivo and can suppress the growth of PC-3 cells in vivo. Furthermore, the tumor samples were lysed, and the levels of OPN, MMP-2 and MMP-9 in these samples were analysed by Western blot as described earlier. The results (Fig. 5C) revealed that the protein levels of OPN, MMP-2 and MMP-9 in the PC/OPN2 groups were decreased 53.51%, 47.63% and 39.22%, respectively (P < 0.05), compared with the control groups.

A

3.6. OPN induces the secretions of MMP-2 and MMP-9

3.7. Effects of different concentrations of IKK inhibitor VII on IKK-1 and IKK-2 activities To determine whether 40 nM and 200 nM concentrations of IKK inhibitors VII could inhibit the activities of IKK-2 and IKK-1 in PC-3 cells, respectively. Western blot analyses were performed for relative expressions of IKK-1 and IKK-2. As shown in Fig. 6, compared with untreated PC-3 cells, the expression levels of IKK-1 in group 1 (treated with 200 nM IKK inhibitor VII) were decreased by 78.35%, on the other hand, the expression levels of IKK-2 in group 2 (treated with 40 nM IKK inhibitor VII) were decreased by 66.24%, the differences were considered to be statistically significant, P < 0.05.

3.8. Effects of IKK inhibitor on OPN, MMP-2 and MMP-9 expressions It has been reported that OPN induces the activations of MMP-2 and MMP-9 through NF-jB-mediated signaling pathways in murine melanoma cells [25,26]. Therefore, we examined the possible functions of IKK in the activations of MMP-2 and MMP-9 in PC-3 cells. As shown in Fig. 7, compared with PCs (group 1), treatment with 40 nM IKK inhibitor VII (group 2; at this concentration, IKK-2 is inhibited) had no remarkable effect on OPN mRNA expression, but inhibited the expressions of MMP-2 and MMP-9 by 56.32% and 44.41%, respectively (P < 0.05). On the other hand, treatment with 200 nM IKK inhibitor VII (group 5; at this concentration, IKK-1 is inhibited) had no effects on the OPN, MMP-2 and MMP-9 expression levels. When compared group 4 to 2 and group 7 to 5, we found that the shRNA/OPN2 efficiently inhibited the mRNA expression levels of OPN, MMP-2 and MMP-9, the results are the same as before. When compared group 4 to group 8 or 2, we found that OPN shRNA and 40 nM IKK inhibitor VII have synergistic effect on downregulation of MMP-2 and MMP-9. We further evaluated the protein expression levels of OPN, MMP-2 and MMP-9 in eight clones by Western blotting. As shown in Fig. 8A–D, the results were the same as those obtained by the real-time PCR analyses. Taken together, these data revealed that OPN shRNA-mediated RNAi can suppress OPN, MMP-2 and MMP-9 expressions and inhibit the malignant biological behaviors of human prostate cancer PC-3 cells. Moreover, catalytic subunit IKK-2 may play a critical role in OPN-induced NF-jBmediated activations of MMP-2 and MMP-9.

B

Relative IKK expression levels IKK-1

IKK-2

IKK/GAPDH

To examine whether OPN can induce MMP-2 and MMP-9 secretions in PC-3 cells, the cells were treated with 10 lm OPN for 24 h and the condition culture supernatant of PC-3 cells were analysed by ELISA. As shown in Table 5, compared with untreated PC-3 cells, the levels of MMP-2 and MMP-9 proteins in the cells treated with 10 lm OPN were increased by 35.72% and 30.48%, respectively, P < 0.05. These data suggested that OPN can induce MMP-2 and MMP-9 secretions in PC-3 cells in vitro.

Fig. 6. Relative expressions of IKK-1 and IKK-2 proteins detected by Western blot. GAPDH were evaluated as an internal control for loading. Group 1: PC-3 cells treated with 200 nM IKK inhibitor VII; group 2: PC-3 cells treated with 40 nM IKK inhibitor VII; group 3: untreated PC-3 cells.

4. Discussion OPN is a secreted non-collagenous phosphoglycoprotein involved in a variety of physiologic cellular functions, including osteoblast differentiation, angiogenesis and bone formation [30–32]. Previous studies have separately reported elevated expression of OPN in biopsies and serum from prostate cancer patients [12] and established a correlation between an increased gradient of osteopontin expression throughout the stages of murine prostate cancer and a proliferative and invasive advantage to those prostate tumor cells overexpression osteopontin [27]. In the present study, our data showed that gene therapy targeting OPN can efficiently suppress the proliferation, migration and invasion of human prostate cancer PC-3 cells in vitro and inhibit tumor growth in vivo. These were achieved by selectively inhibiting OPN expression and protein production using shRNA expression vector-mediated RNAi. RNAi is highly specific and efficient, easy to control

H. Liu et al. / Cancer Letters 295 (2010) 27–37

Relative mRNA Expression of OPN

RQ

A

35

Sample Relative mRNA Expression of MMP-2

RQ

B

Sample Relative mRNA Expression of MMP-9

RQ

C

Sample Fig. 7. Functional analyses of IKK for OPN-induced MMP-2 and MMP-9 expressions by Real-time PCR. The experimental groups were as follows: Sample 1: untreated PC-3 cells; Sample 2: PC-3 cells treated with 40 nM IKK inhibitor VII; Sample 3: PC/Vect cells treated with 40 nM IKK inhibitor VII; Sample 4: PC/OPN2 cells treated with 40 nM IKK inhibitor VII; Sample 5: PC-3 cells treated with 200 nM IKK inhibitor VII; Sample 6: PC/Vect cells treated with 200 nM IKK inhibitor VII; Sample 7: PC/OPN2 cells treated with 200 nM IKK inhibitor VII; Sample 8: PC/OPN2 cells. (A) Realtime PCR analysis of the relative OPN mRNA expression levels in eight groups. Groups 4, 7 or 8 vs. groups 1, P < 0.05. (B) Relative expression of MMP-2 mRNA detected by real-time PCR analysis. Groups 2 or 3 vs. groups 1, P < 0.05; groups 4 vs. groups 2, 3 or 8, P < 0.05. (C) Relative expression of MMP-9 mRNA in different groups detected by real-time PCR analysis. Groups 2 or 3 vs. groups 1, P < 0.05; groups 4 vs. groups 2, 3 or 8, P < 0.05.

and manipulate, versatile, time-saving and inexpensive [33]. It has been extensively used in studies on gene functions, tumor gene therapies and antiviral medicine manufacture [34–36]. We designed four different shRNAs targeting OPN sequences in different regions of the OPN mRNA and constructed four vector-based expression systems in which the sense and antisense strands of the synthetic OPN sequences were transcribed into hairpin

Fig. 8. Functional analyses of IKK for OPN-induced MMP-2 and MMP-9 expressions by Western blot. The experimental groups were the same as real-time PCR analysis. (A) The expression levels of OPN, MMP-2 and MMP-9 proteins detected by Western blot analysis. GAPDH was evaluated as an indicator of equal loading. (B) Relative expression levels of OPN protein in different groups. (C) Relative expression levels of MMP-2 protein in different groups. (D) Relative expression levels of MMP-9 protein in different groups. *P < 0.05, vs. group 1; 4P < 0.05, vs. groups 2, 3 or 8.

structures that included a 9-nucleotide loop. The shRNA fragments were transferred into the target cells and then, under the control of the U6 promoter of the eukaryotic expression plasmid PGPU6/GFP/Neo, processed into functional small interfering RNA by a double strand-specific RNase called Dicer inside the cells [37,38]. In the present study, our data of human prostate cancer line PC-3 have shown that shRNA recombinant plasmidmediated RNAi can be employed to inhibit the expression of OPN. In addition, this study has demonstrated that suppression of OPN expression decreased the proliferation, migration and invasion activities of PC-3 cells in vitro, as well as inhibiting tumor formation in vivo. Our data represent the first report describing direct mechanistic evidence for OPN as a mediator in proliferation, migration and inva-

36

H. Liu et al. / Cancer Letters 295 (2010) 27–37

sion of human prostate cancer PC-3 cells, and suggest that OPN is a potential therapeutic target for human prostate cancer. The administration of an OPN shRNA may represent a new gene therapy approach for human prostate cancer in the future. It has been reported that a number of OPN downstream target molecules, such as MMP-2, MMP-9, EGFR, Met, avb3 and CD44, are involved in regulating tumor progression and invasive behaviors [39–42]. A recent study published by Castellano et al. [24] reported that the extent of OPN pathway activation could correlate with prostate cancer progression and plasma analyses revealed a significant increase in OPN and MMP-9 levels and activities in patients with prostate cancer. Our in vitro data indicated that the expressions of MMP-2 and MMP-9 in PC-3 cells pretreated with OPN significantly increased, however they were obviously decreased in OPN shRNA-transfected PC-3 cells, and the same results were observed in vivo tumor formation tests. Thus, our in vitro and in vivo data showed that OPN can regulate the activities of MMP-2 and MMP-9 in PC-3 cells. Cumulative evidence also suggests that there are a number of OPN-dependent signaling pathways correlating with these processes [43–46]. Das et al. [44] recently reported that OPN induction of urokinase plasminogen activator (uPA) secretion is mediated by the NF-jB/IjBa/IKK pathway and dependent on phosphatidylinositol 3-kinase/IKK/Akt signaling pathways. In addition, OPN induces AP-1-mediated secretion of uPA in breast cancer cells through c-Src/EGFR/ERK signaling pathways [46]. Observations by Desai et al. [23] suggest that CD44 surface expression is an important event in the activation of MMP-9 and migration of prostate cancer cells. Our data in PC-3 cells have shown that knock down the expression of OPN by shRNA expression vector could suppress the activities of MMP-2 and MMP-9. The expressions of OPN, MMP-2 and MMP-9 were inhibited in the PC-3 cells stably transfected with OPN shRNA recombinant plasmid, as evaluated by real-time PCR and Western blot assays. The transcription factors of the NF-jB family are critical regulators of gene transcriptions that educe functions in cell proliferation, inflammation and apoptosis [47–49]. Activation of NF-jB is controlled by the sequential phosphorylation, ubiquitination and degradation of the IjB subunit. IKK-1 and IKK-2, two catalytic subunits of IjB kinase, responsible for IjB phosphorylation and NF-jB activation [50,51]. Rangaswami et al. [26] demonstrated that OPN induces NF-jB-mediated pro-MMP-9 activation through MAPK/IKK signaling pathways in murine melanoma cells and induces NF-jB-mediated pro-MMP-2 activation via IjBa/IKK signaling pathways. Studies performed by James et al. [52] suggest that IKK-1 and IKK-2 contain non-equivalent active sites when two catalytic subunits expressed as homodimers. Our studies involving human prostate cancer PC-3 cells detected that inhibition of IKK-2 could attenuate the expressions of MMP-2 and MMP-9, but inhibition of IKK-1 has no significant effect on the expressions of OPN, MMP-2 and MMP-9. These data indicated that IKK-2 may play a critical role in OPN-induced NF-jB-mediated MMP-2 and MMP-9 activations. Our results are consistent with previous reports by Mercurio and James [28,52].

In summary, we have shown that inducible OPN shRNA expression vector-mediated RNAi can downregulate OPN, MMP-2 and MMP-9 expressions in human prostate cancer PC-3 cells, thereby resulting in suppressions of the proliferation, migration and invasion of PC-3 cells in vitro and tumor growth in vivo. Our findings provided a clue that OPN plays a crucial role in the tumorigenicity of human prostate cancer and regulates the activations of MMP-2 and MMP-9. Moreover, the catalytic subunit IKK-2 may plays an important role in OPN-induced NF-jB-mediated MMP-2 and MMP-9 activations in PC-3 cells. Conflict of interest The authors declare no competing financial interests. Acknowledgment This work is supported by a grant from the Major State Basic Research Development Program of China (973 Program) (No. 2002CB513100). Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.canlet. 2010.02.012. References [1] J.T. Buijs, G. van der Pluijm, Osteotropic cancers: from primary tumor to bone, Cancer Lett. 273 (2009) 177–193. [2] G.N. Thalmann, R.A. Sikes, R.E. Devoll, J.A. Kiefer, R. Markwalder, I. Klima, C.M. Farach-Carson, U.E. Studer, L.W. Chung, Osteopontin: possible role in prostate cancer progression, Clin. Cancer Res. 5 (1999) 2271–2277. [3] H. Singhal, D.S. Bautista, K.S. Tonkin, F.P. O’Malley, A.B. Tuck, A.F. Chambers, J.F. Harris, Elevated plasma osteopontin in metastatic breast cancer associated with increased tumor burden and decreased survival, Clin. Cancer 3 (1997) 605–611. [4] D. Agrawal, T. Chen, R. Irby, J. Quackenbush, A.F. Chambers, M. Szabo, A. Cantor, D. Coppola, T.J. Yeatman, Osteopontin identified as lead marker of colon cancer progression using pooled sample expression profiling, J. Natl. Cancer Inst. 94 (2002) 513–521. [5] P.S. Rudland, A. Platt-Higgins, M. El-Tanani, S. De Silva Rudland, R. Barraclough, J.H. Winstanley, R. Howitt, C.R. West, Prognostic significance of the metastasis-associated protein osteopontin in human breast cancer, Cancer Res. 62 (2002) 3417–3427. [6] D. Coppola, M. Szabo, D. Boulware, P. Muraca, M. Alsarraj, A.F. Chambers, T.J. Yeatman, Correlation of osteopontin protein expression and pathological stage across a wide variety of tumor histologies, Clin. Cancer Res. 10 (2004) 184–190. [7] S.R. Rittling, A.F. Chambers, Role of osteopontin in tumour progression, Brit. J. Cancer 90 (2004) 1877–1881. [8] A. Macrì, A. Versaci, G. Lupo, G. Trimarchi, C. Tomasello, S. Loddo, G. Sfuncia, R. Caminiti, D. Teti, C. Famulari, Role of osteopontin in breast cancer patients, Tumori 95 (2009) 48–52. [9] Y.C. Fong, S.C. Liu, C.Y. Huang, T.M. Li, S.F. Hsu, S.T. Kao, F.J. Tsai, W.C. Chen, C.Y. Chen, C.H. Tang, Osteopontin increases lung cancer cells migration via activation of the alphavbeta3 integrin/FAK/Akt and NFkappaB-dependent pathway, Lung Cancer 64 (2009) 263–270. [10] J. Zhang, K. Takahashi, F. Takahashi, K. Shimizu, F. Ohshita, Y. Kameda, K. Maeda, K. Nishio, Y. Fukuchi, Differential osteopontin expression in lung cancer, Cancer Lett. 171 (2001) 215–222. [11] M. Gong, Z. Lu, G. Fang, J. Bi, X. Xue, A small interfering RNA targeting osteopontin as gastric cancer therapeutics, Cancer Lett. 272 (2008) 148–159. [12] A. Jain, D.A. McKnight, L.W. Fisher, E.B. Humphreys, L.A. Mangold, A.W. Partin, N.S. Fedarko, Small integrin-binding proteins as serum

H. Liu et al. / Cancer Letters 295 (2010) 27–37

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30] [31]

markers for prostate cancer detection, Clin. Cancer Res. 15 (2009) 5199–5207. A.B. Tuck, D.M. Arsenault, F.P. O’Malley, C. Hota, M.C. Ling, S.M. Wilson, A.F. Chambers, Osteopontin induces increased invasiveness and plasminogen activator expression of human mammary epithelial cells, Oncogene 18 (1999) 4237–4246. H. Adwan, T.J. Bauerle, M.R. Berger, Downregulation of osteopontin and bone sialoprotein II is related to reduced colony formation and metastasis formation of MDA-MB-231 human breast cancer cells, Cancer Gene Ther. 11 (2004) 109–120. H. Adwan, T. Bäuerle, Y. Najajreh, V. Elazer, G. Golomb, M.R. Berger, Decreased levels of osteopontin and bone sialoprotein II are correlated with reduced proliferation, colony formation, and migration of GFP-MDA-MB-231 cells, Int. J. Oncol. 24 (2004) 1234– 1235. T. Yamate, K. Kohri, T. Umekawa, M. Iguchi, T. Kurita, Osteopontin antisense oligonucleotide inhibits adhesion of calcium oxalate crystals in Madin-Darby canine kidney cell, J. Urol. 160 (1998) 1506–1512. H. Nemoto, S.R. Rittling, H. Yoshitake, K. Furuya, T. Amagasa, K. Tsuji, A. Nifuji, D.T. Denhardt, M. Noda, Osteopontin deficiency reduces experimental tumor cell metastasis to bone and soft tissues, J. Bone Miner. Res. 16 (2001) 652–659. Y. Wu, D.T. Denhardt, S.R. Rittling, Osteopontin is required for full expression of the transformed phenotype by the ras oncogene, Brit. J. Cancer 83 (2000) 156–163. B. Desai, M.J. Rogers, M.A. Chellaiah, Mechanisms of osteopontin and CD44 as metastatic principles in prostate cancer cells, Mol. Cancer 6 (2007) 18. G.F. Weber, S. Akshar, M.J. Glimcher, H. Cantor, Receptor-Ligand interaction between CD44 and osteopontin (Eta-1), Science 271 (1996) 509–519. D. Panda, G.C. Kundu, B.I. Lee, A. Peri, D. Fohl, I. Chackalaparampil, B.B. Mukherjee, X.D. Li, D.C. Mukherjee, S. Seides, J. Rosenberg, K. Stark, A.B. Mukherjee, Potential roles of osteopontin and alphaVbeta3 integrin in the development of coronary artery restenosis after angioplasty, Proc. Natl. Acad. Sci. USA 94 (1997) 9308–9313. Z. Mi, H. Guo, M.B. Russell, Y. Liu, B.A. Sullenger, P.C. Kuo, RNA Aptamer blockade of osteopontin inhibits growth and metastasis of MDA-MB231 breast cancer cells, Mol. Ther. 17 (2009) 153–161. B. Desai, T. Ma, J. Zhu, M.A. Chellaiah, Characterization of the expression of variant and standard CD44 in prostate cancer cells: identification of the possible molecular mechanism of CD44/MMP9 complex formation on the cell surface, J. Cell Biochem. 108 (2009) 272–284. G. Castellano, G. Malaponte, M.C. Mazzarino, M. Figini, F. Marchese, P. Gangemi, S. Travali, F. Stivala, S. Canevari, M. Libra, Activation of the osteopontin/matrix metalloproteinase-9 pathway correlates with prostate cancer progression, Clin. Cancer Res. 14 (2008) 7470–7480. S. Philip, A. Bulbule, G.C. Kundu, Osteopontin stimulates tumor growth and activation of promatrix metalloproteinase-2 through nuclear factor-kappaB-mediated induction of membrane type 1 matrix metalloproteinase in murine melanoma cells, J. Biol. Chem. 276 (2001) 44926–44935. H. Rangaswami, A. Bulbule, G.C. Kundu, Nuclear factor-inducing kinase plays a crucial role in osteopontin-induced MAPK/I kappaBalpha kinase-dependent nuclear factor kappa B-mediated promatrix metalloproteinase-9 activation, J. Biol. Chem. 279 (2004) 38921–38935. A.C. Khodavirdi, Z. Song, S. Yang, C. Zhong, S. Wang, H. Wu, C. Pritchard, P.S. Nelson, P. Roy-Burman, Increased expression of osteopontin contributes to the progression of prostate cancer, Cancer Res. 66 (2006) 883–888. F. Mercurio, H. Zhu, B.W. Murray, A. Shevchenko, B.L. Bennett, J. Li, D.B. Young, M. Barbosa, M. Mann, A. Manning, A. Rao, IKK-1 and IKK2: cytokine-activated IkappaB kinases essential for NF-kappaB activation, Science 278 (1997) 860–866. P.Y. Wai, Z. Mi, H. Guo, S. Sarraf-Yazdi, C. Gao, J. Wei, C.E. Marroquin, B. Clary, P.C. Kuo, Osteopontin silencing by small interfering RNA suppresses in vitro and in vivo CT26 murine colon adenocarcinoma metastasis, Carcinogenesis 26 (2005) 741–751. W.T. Butler, The nature and significance of osteopontin, Connect. Tissue Res. 23 (1989) 123–136. M. Hirama, F. Takahashi, K. Takahashi, S. Akutagawa, K. Shimizu, S. Soma, Y. Shimanuki, K. Nishio, Y. Fukuchi, Osteopontin

[32] [33] [34]

[35]

[36]

[37]

[38] [39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49] [50]

[51]

[52]

37

overproduced by tumor cells acts as a potent angiogenic factor contributing to tumor growth, Cancer Lett. 198 (2003) 107–117. D.T. Denhardt, X. Guo, Osteopontin: a protein with diverse functions, FASEB J. 7 (1993) 1475–1482. A.R. Naqvi, M.N. Islan, N.R. Choudhury, Q.M. Haq, The fascinating world of RNA interference, Int. J. Biol. Sci. 5 (2009) 97–117. J. Song, A. Giang, Y. Lu, S. Pang, R. Chiu, Multiple shRNA expressing vector enhances efficiency of gene silencing, BMB Rep. 41 (2008) 358–362. H. Chang, RNAi-mediated knockdown of target genes: a promising strategy for pancreatic cancer research, Cancer Gene Ther. 14 (2007) 677–685. J. Haasnoot, E.M. Westerhout, B. Berkhout, RNA interference against viruses: strike and counterstrike, Nat. Biotechnol. 25 (2007) 1435– 1443. T.R. Brummelkamp, R. Bernards, R. Agami, A system for stable expression of short interfering RNAs in mammalian cells, Science 296 (2002) 550–553. R.S. Dave, R.J. Pomerantz, RNA interference on the road to an alternate therapeutic strategy, Rev. Med. Virol. 13 (2003) 373–385. A.B. Tuck, C. Hota, S.M. Wilson, A.F. Chambers, Osteopontin induced migration of human mammary epithelial cells involves activation of EGF receptor and multiple signal transduction pathways, Oncogene 22 (2003) 1198–1205. A.B. Tuck, B.E. Elliott, C. Hota, E. Tremblay, A.F. Chambers, Osteopontin-induced, integrin-dependent migration of human mammary epithelial cells involves activation of the hepatocyte growth factor receptor (Met), J. Cell Biochem. 78 (2000) 465–475. Y.H. Lin, C.J. Huang, J.R. Chao, S.T. Chen, S.F. Lee, J.J. Yen, H.F. YangYen, Coupling of osteopontin and its cell surface receptor CD44 to the cell survival response elicited by interleukin-3 or granulocytemacrophage colony-stimulating factor, Mol. Cell Biol. 20 (2000) 2734–2742. B. Zhu, K. Suzuki, H.A. Goldberg, S.R. Rittling, D.T. Denhardt, C.A. McCulloch, J. Sodek, Osteopontin modulates CD44-dependent chemotaxis of peritoneal macrophages through G-protein-coupled receptors: evidence of a role for an intracellular form of osteopontin, J. Cell Physiol. 198 (2004) 155–167. H. Teramoto, M.D. Castellone, R.L. Malek, N. Letwin, B. Frank, J.S. Gutkind, N.H. Lee, Autocrine activation of an osteopontin-CD44-Rac pathway enhances invasion and transformation by H-RasV12, Oncogene 24 (2005) 489–501. R. Das, G.H. Mahabeleshwar, G.C. Kundu, Osteopontin stimulates cell motility and nuclear factor kappaB-mediated secretion of urokinase type plasminogen activator through phosphatidylinositol 3-kinase/ Akt signaling pathways in breast cancer cells, J. Biol. Chem. 278 (2003) 28593–28606. T. Ogata, T. Ueyama, T. Nomura, S. Asada, M. Tagawa, T. Nakamura, T. Takahashi, H. Matsubara, H. Oh, Osteopontin is a myosphere-derived secretory molecule that promotes angiogenic progenitor cell proliferation through the phosphoinositide 3-kinase/Akt pathway, Biochem. Biophys. Res. Commun. 359 (2007) 341–347. R. Das, G.H. Mahabeleshwar, G.C. Kundu, Osteopontin induces AP-1mediated secretion of urokinase-type plasminogen activator through c-Src-dependent epidermal growth factor receptor transactivation in breast cancer cells, J. Biol.Chem. 279 (2004) 11051–11064. P.J. Barnes, M. Karin, Nuclear factor-kappaB: a pivotal transcription factor in chronic inflammatory diseases, New Engl. J. Med. 336 (1997) 1066–1071. J.E. Thompson, R.J. Phillips, H. Erdjument-Bromage, P. Tempst, S. Ghosh, I kappa B-beta regulates the persistent response in a biphasic activation of NF-kappa B, Cell 80 (1995) 573–582. C. Zhaodan, J.H. William, G. Xiong, IRAK: a kinase associated with the interleukin-1 receptor, Science 27 (1996) 1128–1131. A.A. Beg, S.M. Ruben, R.I. Scheinman, S. Haskill, C.A. Rosen, A.S. Baldwin Jr., I kappaB interacts with the nuclear localization sequences of the subunits of NF-kappaB: a mechanism for cytoplasmic retention, Genes Dev. 6 (1992) 1899–1913. R.T. Hay, L. Vuillard, J.M. Desterro, M.S. Rodriguez, Control of NFkappa B transcriptional activation by signal induced proteolysis of I kappa B alpha, Philos. Trans. Roy. Soc. Lond. B. Biol. Sci. 354 (1999) 1601–1609. J.R. Burke, J. Strnad, The catalytic subunits of IkappaB kinase, IKK-1 and IKK-2, Contain non-equivalent active sites when expressed as homodimers, Biochem. Biophys. Res. Commun. 293 (2002) 1508– 1513.