- Email: [email protected]
A Simple Method for Preparation of Rice Genomic DNA
Rice Science, 2010, 17(4): 326−329 Copyright © 2010, China National Rice Research Institute. Published by Elsevier BV. All rights reserved DOI: 10.1016/S1672-6308(09)60034-2
A Simple Method for Preparation of Rice Genomic DNA SUN Chuan1, 2, #, HE Ying-hong1, #, CHEN Gang1, 2, RAO Yu-chun1, ZHANG Guang-heng1, GAO Zhen-yu1, LIU Jian1, JU Pei-na1, HU Jiang1, GUO Long-biao1, QIAN Qian1, ZENG Da-li1 (1State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou 310006, China; 2Agricultural College, Yangzhou University, Yangzhou 225009, China; #These authors contributed equally to this paper)
Abstract: The extraction of DNA is often the most time consuming and laborious step in high-throughput molecular genetic analysis and marker assisted selection (MAS) programs. A simple method for preparation of rice genomic DNA was developed. A small amount (1–50 mg) of leaf tissue of rice seedling, 500 μL of extraction buffer, and one steel bead were put into a 2-mL microcentrifuge tube. After vigorously mashing for 2 min, 5 μL of supernatant was directly applied to PCR amplification. Otherwise, the supernatant was precipitated with two times volume of ethanol to obtain high quality genomic DNA. This method is simple, rapid, low cost, and reliable for PCR analysis. One person can manipulate as many as 96 samples for PCR in 10 min. It is especially suitable for genotyping of large number of samples. Key words: DNA extraction; high-throughput PCR; marker assisted selection; gene mapping; rice
PCR-based molecular marker technology has been widely used in rice gene mapping, gene cloning, marker assisted selection (MAS) and so on. In rice and most other crops, PCRbased markers such as simple sequence repeats (SSR or microsatellites) are preferable for MAS because of their high levels of polymorphism, reliability, technical simplicity, requirement for relatively small amount of DNA and low cost. Moreover, with the development of biotechnology, the completion of rice genome sequencing and the increasing number of functional genes identified, MAS is becoming more and more popular in crop improvement. The potential advantages of molecular breeding verified by numerous examples of MAS in rice and other crops have prompted many rice breeding and research institutions to establish biotechnology or DNA marker laboratories (Yu et al, 2003; Zhao et al, 2006; Wang et al, 2009). However, the preparation of DNA from plants is still a time-consuming, laborious and expensive work because of the multiple manipulation steps (Steenkamp et al, 1991; Aljanabi and Martinez, 1997; McCouch et al, 1998). The extracted DNA is only used in screening and identification, and most of remained DNA will be discarded as redundant. To overcome this problem, several DNA extraction protocols for different crops have been described, based on the use of 96-well microtiter plates (Dilworth and Frey, 2000; Paris and Carter, 2000; Mace et al, 2003) and the increasing number of relatively expensive commercial products available [e.g., DNeasy 96 Plant Kit (QIAGEN), Wizard Magnetic 96 DNA Plant System (Promega)]. Nevertheless, a bottleneck still exists.
Received: 22 July 2010; Accepted: 28 September 2010 Corresponding authors: QIAN Qian ([email protected]); ZENG Da-li ([email protected])
MATERIALS AND METHODS Plant materials Rice varieties such as Nipponbare, TN1, Chunjiang 06, Zhonghua 11, C-Bao and Jaimaica were used in this study. Rice seeds were germinated in an incubator for 2 to 3 days. After germination, the seeds were sown into paddy fields. Reagents and chemicals Solution A: 150 mmol/L sorbitol, 125 mmol/L Tris, 25 mmol/L EDTA-Na2, 500 mmol/L NaCl, 20 mmol/L Na2SO3, 0.8% (w/v) hexadecyl trimethyl ammonium bromide (CTAB), 2% (w/v) sarkosyl, pH 7.5. Solution B: 100 mmol/L Tris, 500 mmol/L KCl, 18 mmol/L MgCl2, 1% (w/v) Triton X-100, pH 9.0. Solution C (DNA extraction): Solution A, solution B and ddH2O at a ratio of 1:2:7, then add 0.2% (v/v) β-mercaptoethanol before using. Solution D (10×PCR buffer): 50 mmol/L Tris, 250 mmol/L KCl, 9 mmol/L MgCl2, 0.5% (w/v) Triton X-100, 10% (v/v) bovine serum albumin (BSA), pH 9.0. DNA isolation protocol The protocol for DNA isolation was as follows: 1) Add 500 μL solution C to a 2-mL microcentrifuge tube containing small pieces of young leaves (about 0.01 g rice samples), then add 200 μL chloroform and one steel bead (diameter about 5 mm). 2) Grind the samples in the collecting microcentrifuge tube for 2 min in a cell cracker (TissueLyser II, German) with
SUN Chuan, et al. A Simple Method for Preparation of Rice Genomic DNA 28 Hz. 3) Centrifuge the microcentrifuge tube at 8 000–10 000 r/min for 4–6 min at room temperature. 4) Transfer 5 μL of supernatant to a new 96-well plate for PCR amplification. To gain high quality genomic DNA, the process as followed should be held on. 5) According to the screening of PCR analysis, transfer 400 μL of supernatant from the step 3 to a new microcentrifuge tube, then add 400–800 μL of ethanol and shake gently, incubate for 30–60 min at room temperature. Centrifuge at 8 000–10 000 r/min for 10–15 min at room temperature, and then discard the supernatant. 6) Wash the pellet with 500 μL of 70% ethanol, centrifuge at 8 000–10 000 r/min for 10–15 min at room temperature, and discard the supernatant. 7) Air-dry the pellet, then dissolve the pellet in 200 μL of ddH2O and directly use as a template for PCR amplification or store the pellet at -20°C. PCR analysis PCR was performed in a total volume of 20 μL, containing 5 μL of crude DNA, 2 μL of the solution D as PCR buffer, 5 nmol/L each of dNTPs, 8 pmol/L primers and 1 U of Taq DNA polymerase. PCR reactions were run in 96-well thermal cycles (EASTWIN, Inc) under the following conditions: 1 cycle of 4 min at 94°C, 35 cycles of 1 min at 94°C, 45 s at 55°C and 45 s at 72°C, followed by a final extension at 72°C for 10 min. The PCR products were separated by electrophoresis on 3%–4% agarose gels. The gels were stained with ethidium bromide and detected under UV light. Assay of DNA yield and purity Absorbances (A) at 260 nm and 280 nm (and background absorbance at 320 nm) were measured using a Beckman Spectrophotometer (Model No. DU800, Beckman Coulter, Fullerton, California, USA), for determining the yield and purity of the DNA.
RESULTS Rapid preparation of genomic DNA Since only a small amount of material is needed for DNA extraction, sampling can be performed at the seedling stage of rice. To obtain genomic DNA for PCR amplification, about 0.01 g of rice leaf was sampled into a microcentrifuge tube, and the sample does not need to be weighed. After adding 500 μL of the solution C, 200 μL of chloroform and one steel bead (diameter about 5 mm), the sample was ground with a cell cracker (TissueLyser II). The supernatant can be directly used for PCR amplification after centrifugation. One person can manipulate as many as 96 samples for PCR in 10 min. Twenty
327
M
1
2
3
4
5
6
7
8
10.0 kb 1.5 kb 1.0 kb
Fig. 1. Prepared genomic DNAs from rice leaf tissues. M, Marker; Lanes 1 to 8, Prepared rice genomic DNA.
microliters crude genomic DNA from the supernatant was checked by means of agarose gel electrophoresis (Fig. 1). It shows that the preparation of genomic DNA from leaf tissues of rice is feasible, and most DNA fragments show high-quality and suitable for studies in which large DNA fragments need to be amplified. SSR/STS analysis To determine the reliability and applicability of this method, 34 pairs of simple sequence repeats (SSR) and sequence tagged site (STS) markers distributed on different linkage groups were selected for PCR amplification (Table 1). The PCR products were separated by electrophoresis on 3%–4% agarose gels, visualized by staining with ethidium bromide and viewed under Table 1. The developed primers used in this study. Primer RM3252
Pairs of primer (5′-3′ )
Size of product (bp) 153
GGTAACTTTGTTCCCATGCC GGTCAATCATGCATGCAAGC RM1247 183 TTCTCAGCTGCTTGTGCATC CCTCCAAGGTAAAGGGGTTC NB316 153 ATGTGTGCTTCGGTCGTGAT TTCTCACATCTGAACCTCTCC NB478 188 GGGCTGTCATTGTCACGAG GGCATCGACTCATCAGCC NB444 187 TCGTCCATCCATTGATGCTAATC TGCCATTTATCATTTGCCATTC NB876 147 TTGGAGAGACGAGCGAGAGAG AGTGTTGGTGAGCATAGCAGTTG NB231 185 AGAATAGAGTGCATCATCGTC AACCTGATAGGTGGAAGATGTAC NB342 128 ACCATGCCTCATGACATGTGG TGGTTTTGTGTAGCTCTGTCGG NB558 143 GCTCCACAGAAAAGCAAAGC TGCAACAGTAGCTGTAGCCG NB789 206 GAATGGGATTAGACGATTTG CCATGAGTGACATCAAAAGG NB678 87 CCTGGTTAGCACTACAGCTC TAGTTGGCTATGTCCACACC NB665 126 AAGTCGAAGGAGGAGTTGTC CACCGAAACTAAAGACGAG NB442 139 CTTTGTAGACCGTATCATTGTCC GAAACGTCTGGCGAGTTCC NB642 131 GCAGGAGTATATACGCAGGG ACTCAGCGTGCTCAACCTG NB942 130 ATCAGCAGCAGATTGGTGC TACCCTTAGTCTCCTATGTGTCC Other 19 pairs of SSR markers randomly selected from the Gramene database were RM7581, RM1361, RM3740, RM8213, RM17713, RM13, RM19234, RM1019, RM5055, RM6356, RM1328, RM5795, RM217, RM3183, RM5711, RM3819, RM1337, RM7376 and RM493.
328
Rice Science, Vol. 17, No. 4, 2010
Fig. 4. PCR products of RM1247 amplified with the template DNA stored at different temperatures. A, The template DNA stored at 4°C; B, The template DNA stored at -20°C.
Fig. 2. PCR amplification for 34 pairs of SSR and STS primers.
Fig. 3. PCR products of RM3252 for DNAs from different rice varieties and tissues. A, PCR products of RM3252 for DNAs from different varieties. Lanes 1 to 6 were genomic DNAs from Nipponbare, TN1, Chunjiang 06, Zhonghua 11, C-Bao and Jaimaica, respectively. B, PCR products of RM3252 for DNAs from different tissues. Lanes 7 to 12 were genomic DNAs from young leaf, old leaf, stem, sheath, panicle and root, respectively.
UV light (Fig. 2). The results showed that the amplicons from different primers were all clear and intensive, and the sizes of fragments were reasonable. In addition, the crude genomic DNAs from different rice varieties and tissues were used. The PCR amplicons were also specific and intensive (Fig. 3), which indicates that DNA extracted by this method is stable and suitable for PCR-based techniques. PCR analysis for stored DNA With this method, it is fairly easy to complete the screening of a large population with flanking PCR markers within a week, which significantly save time for selecting recombinants in a large mapping population. Thus, the crude genomic DNA does not need to be stored for long term. The crude DNA from 0.01 g of fresh leaf was halved and stored at 4°C and -20°C, respectively. On the 7th day, all the samples were used for PCR amplification. From the PCR products by agarose gel electrophoresis (Fig. 4), we could clearly see that the PCR amplicons amplified from the DNA stored at 4°C were as clear and intensive as those from -20°C. This indicates that the crude DNA stored at 4°C is reliable for PCR amplification within a week. DNA purity and yield During the screening in PCR analysis, high-quality DNA
Fig. 5. Quantity of DNA obtained from the stored samples at 4°C via precipitation.
should be extracted from some selected plants for other purposes. The crude genomic DNA is suitable for PCR amplification, and for refining high-quality DNA with ethanol as well. Fig. 5 shows the amount of DNA from the stored samples at 4°C after precipitation with ethanol. The amount of DNA was around 30 μg and the yield was stable during storage.
DISCUSSION Many methods for plant DNA extractions have been used in rice (Oryza sativa) including classic SDS method and CTAB method (Stewart and Via, 1993; Ausubel et al, 1996). In addition, some simple modified methods were also developed and used in rice such as modified SDS method (Wang H W et al, 2002), alkali boiling method (Wang X F et al, 2002), NaOH-Tris·HCl neutralized method (Chen et al, 2006), cutter and SDS method (Zhao et al, 2006), and miniprep extraction method (Qiu et al, 2006). Nevertheless, the bottleneck still exists due to efficiency, stability to PCR amplification or costs. Unlike the above mentioned plant DNA extraction protocols, the method in this study has several advantages. Firstly, it mixes the chloroform with extraction buffer to remove the containing protein during tissue grinding. The alteration significantly minimizes time and laboratory materials. One person can process as many as 96 samples within 10 min. Secondly, this method does not include the use of ethanol or isopropanol to precipitate DNA pellet. It reduces a variety of reagents in the process. Thirdly, the amount of crude genomic DNA isolated from 0.01 g of fresh leaf can be used for more than a hundred PCR
SUN Chuan, et al. A Simple Method for Preparation of Rice Genomic DNA amplifications. It also gains about 30 μg of high-quality DNA from fresh leaf via precipitation with ethanol. Moreover, since a small amount of material is enough for DNA extraction in this method, samples can be performed one week later after sowing. Furthermore, the crude DNA can not only be directly used for PCR amplification, but also be precipitated with ethanol for high-quality DNA. Finally, this method may also be available for other crops. DNA isolated from plants often contains certain compounds that inhibit PCR amplification (Kamalay et al, 1990; John, 1992). In this method, chloroform and β-mercaptoethanol were added in the extraction buffer to get rid of the contamination such as polysaccharides and polyphenols in leaf tissues which result in the inhibition of DNA amplification during PCR reactions (Sambrook and Russell, 2002). Additionally, the chloroformpartition step assures good DNA quality. High molecular DNA is obtained with relatively low partial degradation, and could be amplified by PCR. The addition of BSA in PCR buffer also improves the specificity in PCR amplification (Silvy et al, 2004). Notwithstanding, RNA was detected in crude genomic DNA, and no effect on PCR amplification was found, therefore, an RNase treatment was not necessary. The content of DNA precipitated with ethanol in this method is similar to the CTAB method, and the DNA is suitable for long-term storage. This method is suitable for varied rice tissues, such as root, culm and seed, and for other plants as well.
329
DNA extraction protocol for PCR analysis. Rice Sci, 13(1): 67–70. Dilworth E, Frey J E. 2000. A rapid method for high throughput DNA extraction from plant material for PCR amplification. Plant Mol Biol Rep, 18: 61–64. John M E. 1992. An efficient method for isolation of RNA and DNA from plants containing polyphenolics. Nucl Acids Res, 20(9): 2381. Kamalay J, Tejwani R, Keith R G. 1990. Isolation and analysis of genomic DNA from single seeds. Crop Sci, 30(5): 1079–1084. Mace E S, Buhariwalla H K, Crouch J H. 2003. A high-throughput DNA extraction protocol for tropical molecular breeding programs. Plant Mol Biol Rep, 21(4): 459a–459h. McCouch S R, Kochert G, Yu Z H, Wang Z Y, Khush G S, Coffman W R, Tanksley S D. 1988. Molecular mapping of rice chromosomes. Theor Appl Genet, 76: 815–829. Paris M, Carter M. 2000. Cereal DNA: A rapid high-throughput extraction method for marker-assisted selection. Plant Mol Biol Rep, 18(4): 357–360. Qiu F L, Wang H H, Chen J, Zhuang J Y, Heung H, Cheng S H, Wu J L. 2006. A rapid DNA mini-prep method for large-scale rice mutant screening. Rice Sci, 13(4): 299–302. Sambrook J, Russell D. 2002. Molecular Cloning: A Laboratory Manual. 3rd edn. translated by Huang P T. Beijing: Science Press. (in Chinese) Silvy M, Pic G, Gabert J, Picard C. 2004. Improvement of gene expression analysis by RQ-PCR technology: Addition of BSA. Leukemia, 18(5): 1022–1025. Steenkamp J, Wild I, Lourens A, Helden V P. 1991. Improved method for
ACKNOWLEDGEMENTS This work was supported by grants from the Ministry of Agriculture of China for transgenic research (Grant No. 2008ZX08009-003), the National Natural Science Foundation of China (Grant Nos. 30710103903 and 30771160) and the Natural Science Foundation of Zhejiang Province, China (Grant No. R3090023).
DNA extraction from Vitis vinifera. Am J Enol Vit, 45: 102–106. Stewart C N Jr, Via L E. 1993. A rapid CTAB DNA isolation technique useful for RAPD fingerprinting and other PCR applications. BioTechnique, 14(5): 748–750. Wang H W, Wu C, Zhao X Y, Wang J H, Zhang R Y, Wang Y F. 2002. A rapid method for preparation of PCR template using SDS. J Hebei Univ: Nat Sci, 22(2): 186–188. (in Chinese with English abstract) Wang L, Long Y M, Liu Y G. 2009. A method for rapid preparation of plant genomic DNA for PCR analysis. Mol Plant Breeding, 7(2): 425–428. (in Chinese with English abstract)
REFERENCES
Wang X F, Yang J B, Xiang T H, Li L, Ni D H. 2002. A new method for PCR reaction from alkali-treated rice leaf tissues. Chin J Rice Sci,
Aljanabi S M, Martinez I. 1997. Universal and rapid salt-extraction of high quality genomic DNA for PCR based techniques. Nucl Acids
16(1): 67–70. (in Chinese with English abstract) Yu S W, Liu Y B. 2003. Application of molecular marker techniques in rice genetics and breeding. Acta Agric Univ Jiangxi, 25(1): 111–116.
Res, 25: 4692–4693. Ausubel F M, Brent R, Kingston R E. 1996. Phenol/SDS method for plant RNA preparation. In: Current Protocols in Molecular Biology.
(in Chinese with English abstract) Zhao H X, Xie P, Huang Z J, Ju C M, Zhou Y. 2006. An improved method of extracting rice genomic DNA. J Hubei Univ: Nat Sci,
Vol.1. New York: John Wiley and Sons, Inc. Chen W Y, Cui H R, Bao J S, Zhou X S, Shu Q Y. 2006. A simplified rice
12(4): 389–392. (in Chinese with English abstract)
A Simple Method for Preparation of Rice Genomic DNA SUN Chuan1, 2, #, HE Ying-hong1, #, CHEN Gang1, 2, RAO Yu-chun1, ZHANG Guang-heng1, GAO Zhen-yu1, LIU Jian1, JU Pei-na1, HU Jiang1, GUO Long-biao1, QIAN Qian1, ZENG Da-li1 (1State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou 310006, China; 2Agricultural College, Yangzhou University, Yangzhou 225009, China; #These authors contributed equally to this paper)
Abstract: The extraction of DNA is often the most time consuming and laborious step in high-throughput molecular genetic analysis and marker assisted selection (MAS) programs. A simple method for preparation of rice genomic DNA was developed. A small amount (1–50 mg) of leaf tissue of rice seedling, 500 μL of extraction buffer, and one steel bead were put into a 2-mL microcentrifuge tube. After vigorously mashing for 2 min, 5 μL of supernatant was directly applied to PCR amplification. Otherwise, the supernatant was precipitated with two times volume of ethanol to obtain high quality genomic DNA. This method is simple, rapid, low cost, and reliable for PCR analysis. One person can manipulate as many as 96 samples for PCR in 10 min. It is especially suitable for genotyping of large number of samples. Key words: DNA extraction; high-throughput PCR; marker assisted selection; gene mapping; rice
PCR-based molecular marker technology has been widely used in rice gene mapping, gene cloning, marker assisted selection (MAS) and so on. In rice and most other crops, PCRbased markers such as simple sequence repeats (SSR or microsatellites) are preferable for MAS because of their high levels of polymorphism, reliability, technical simplicity, requirement for relatively small amount of DNA and low cost. Moreover, with the development of biotechnology, the completion of rice genome sequencing and the increasing number of functional genes identified, MAS is becoming more and more popular in crop improvement. The potential advantages of molecular breeding verified by numerous examples of MAS in rice and other crops have prompted many rice breeding and research institutions to establish biotechnology or DNA marker laboratories (Yu et al, 2003; Zhao et al, 2006; Wang et al, 2009). However, the preparation of DNA from plants is still a time-consuming, laborious and expensive work because of the multiple manipulation steps (Steenkamp et al, 1991; Aljanabi and Martinez, 1997; McCouch et al, 1998). The extracted DNA is only used in screening and identification, and most of remained DNA will be discarded as redundant. To overcome this problem, several DNA extraction protocols for different crops have been described, based on the use of 96-well microtiter plates (Dilworth and Frey, 2000; Paris and Carter, 2000; Mace et al, 2003) and the increasing number of relatively expensive commercial products available [e.g., DNeasy 96 Plant Kit (QIAGEN), Wizard Magnetic 96 DNA Plant System (Promega)]. Nevertheless, a bottleneck still exists.
Received: 22 July 2010; Accepted: 28 September 2010 Corresponding authors: QIAN Qian ([email protected]); ZENG Da-li ([email protected])
MATERIALS AND METHODS Plant materials Rice varieties such as Nipponbare, TN1, Chunjiang 06, Zhonghua 11, C-Bao and Jaimaica were used in this study. Rice seeds were germinated in an incubator for 2 to 3 days. After germination, the seeds were sown into paddy fields. Reagents and chemicals Solution A: 150 mmol/L sorbitol, 125 mmol/L Tris, 25 mmol/L EDTA-Na2, 500 mmol/L NaCl, 20 mmol/L Na2SO3, 0.8% (w/v) hexadecyl trimethyl ammonium bromide (CTAB), 2% (w/v) sarkosyl, pH 7.5. Solution B: 100 mmol/L Tris, 500 mmol/L KCl, 18 mmol/L MgCl2, 1% (w/v) Triton X-100, pH 9.0. Solution C (DNA extraction): Solution A, solution B and ddH2O at a ratio of 1:2:7, then add 0.2% (v/v) β-mercaptoethanol before using. Solution D (10×PCR buffer): 50 mmol/L Tris, 250 mmol/L KCl, 9 mmol/L MgCl2, 0.5% (w/v) Triton X-100, 10% (v/v) bovine serum albumin (BSA), pH 9.0. DNA isolation protocol The protocol for DNA isolation was as follows: 1) Add 500 μL solution C to a 2-mL microcentrifuge tube containing small pieces of young leaves (about 0.01 g rice samples), then add 200 μL chloroform and one steel bead (diameter about 5 mm). 2) Grind the samples in the collecting microcentrifuge tube for 2 min in a cell cracker (TissueLyser II, German) with
SUN Chuan, et al. A Simple Method for Preparation of Rice Genomic DNA 28 Hz. 3) Centrifuge the microcentrifuge tube at 8 000–10 000 r/min for 4–6 min at room temperature. 4) Transfer 5 μL of supernatant to a new 96-well plate for PCR amplification. To gain high quality genomic DNA, the process as followed should be held on. 5) According to the screening of PCR analysis, transfer 400 μL of supernatant from the step 3 to a new microcentrifuge tube, then add 400–800 μL of ethanol and shake gently, incubate for 30–60 min at room temperature. Centrifuge at 8 000–10 000 r/min for 10–15 min at room temperature, and then discard the supernatant. 6) Wash the pellet with 500 μL of 70% ethanol, centrifuge at 8 000–10 000 r/min for 10–15 min at room temperature, and discard the supernatant. 7) Air-dry the pellet, then dissolve the pellet in 200 μL of ddH2O and directly use as a template for PCR amplification or store the pellet at -20°C. PCR analysis PCR was performed in a total volume of 20 μL, containing 5 μL of crude DNA, 2 μL of the solution D as PCR buffer, 5 nmol/L each of dNTPs, 8 pmol/L primers and 1 U of Taq DNA polymerase. PCR reactions were run in 96-well thermal cycles (EASTWIN, Inc) under the following conditions: 1 cycle of 4 min at 94°C, 35 cycles of 1 min at 94°C, 45 s at 55°C and 45 s at 72°C, followed by a final extension at 72°C for 10 min. The PCR products were separated by electrophoresis on 3%–4% agarose gels. The gels were stained with ethidium bromide and detected under UV light. Assay of DNA yield and purity Absorbances (A) at 260 nm and 280 nm (and background absorbance at 320 nm) were measured using a Beckman Spectrophotometer (Model No. DU800, Beckman Coulter, Fullerton, California, USA), for determining the yield and purity of the DNA.
RESULTS Rapid preparation of genomic DNA Since only a small amount of material is needed for DNA extraction, sampling can be performed at the seedling stage of rice. To obtain genomic DNA for PCR amplification, about 0.01 g of rice leaf was sampled into a microcentrifuge tube, and the sample does not need to be weighed. After adding 500 μL of the solution C, 200 μL of chloroform and one steel bead (diameter about 5 mm), the sample was ground with a cell cracker (TissueLyser II). The supernatant can be directly used for PCR amplification after centrifugation. One person can manipulate as many as 96 samples for PCR in 10 min. Twenty
327
M
1
2
3
4
5
6
7
8
10.0 kb 1.5 kb 1.0 kb
Fig. 1. Prepared genomic DNAs from rice leaf tissues. M, Marker; Lanes 1 to 8, Prepared rice genomic DNA.
microliters crude genomic DNA from the supernatant was checked by means of agarose gel electrophoresis (Fig. 1). It shows that the preparation of genomic DNA from leaf tissues of rice is feasible, and most DNA fragments show high-quality and suitable for studies in which large DNA fragments need to be amplified. SSR/STS analysis To determine the reliability and applicability of this method, 34 pairs of simple sequence repeats (SSR) and sequence tagged site (STS) markers distributed on different linkage groups were selected for PCR amplification (Table 1). The PCR products were separated by electrophoresis on 3%–4% agarose gels, visualized by staining with ethidium bromide and viewed under Table 1. The developed primers used in this study. Primer RM3252
Pairs of primer (5′-3′ )
Size of product (bp) 153
GGTAACTTTGTTCCCATGCC GGTCAATCATGCATGCAAGC RM1247 183 TTCTCAGCTGCTTGTGCATC CCTCCAAGGTAAAGGGGTTC NB316 153 ATGTGTGCTTCGGTCGTGAT TTCTCACATCTGAACCTCTCC NB478 188 GGGCTGTCATTGTCACGAG GGCATCGACTCATCAGCC NB444 187 TCGTCCATCCATTGATGCTAATC TGCCATTTATCATTTGCCATTC NB876 147 TTGGAGAGACGAGCGAGAGAG AGTGTTGGTGAGCATAGCAGTTG NB231 185 AGAATAGAGTGCATCATCGTC AACCTGATAGGTGGAAGATGTAC NB342 128 ACCATGCCTCATGACATGTGG TGGTTTTGTGTAGCTCTGTCGG NB558 143 GCTCCACAGAAAAGCAAAGC TGCAACAGTAGCTGTAGCCG NB789 206 GAATGGGATTAGACGATTTG CCATGAGTGACATCAAAAGG NB678 87 CCTGGTTAGCACTACAGCTC TAGTTGGCTATGTCCACACC NB665 126 AAGTCGAAGGAGGAGTTGTC CACCGAAACTAAAGACGAG NB442 139 CTTTGTAGACCGTATCATTGTCC GAAACGTCTGGCGAGTTCC NB642 131 GCAGGAGTATATACGCAGGG ACTCAGCGTGCTCAACCTG NB942 130 ATCAGCAGCAGATTGGTGC TACCCTTAGTCTCCTATGTGTCC Other 19 pairs of SSR markers randomly selected from the Gramene database were RM7581, RM1361, RM3740, RM8213, RM17713, RM13, RM19234, RM1019, RM5055, RM6356, RM1328, RM5795, RM217, RM3183, RM5711, RM3819, RM1337, RM7376 and RM493.
328
Rice Science, Vol. 17, No. 4, 2010
Fig. 4. PCR products of RM1247 amplified with the template DNA stored at different temperatures. A, The template DNA stored at 4°C; B, The template DNA stored at -20°C.
Fig. 2. PCR amplification for 34 pairs of SSR and STS primers.
Fig. 3. PCR products of RM3252 for DNAs from different rice varieties and tissues. A, PCR products of RM3252 for DNAs from different varieties. Lanes 1 to 6 were genomic DNAs from Nipponbare, TN1, Chunjiang 06, Zhonghua 11, C-Bao and Jaimaica, respectively. B, PCR products of RM3252 for DNAs from different tissues. Lanes 7 to 12 were genomic DNAs from young leaf, old leaf, stem, sheath, panicle and root, respectively.
UV light (Fig. 2). The results showed that the amplicons from different primers were all clear and intensive, and the sizes of fragments were reasonable. In addition, the crude genomic DNAs from different rice varieties and tissues were used. The PCR amplicons were also specific and intensive (Fig. 3), which indicates that DNA extracted by this method is stable and suitable for PCR-based techniques. PCR analysis for stored DNA With this method, it is fairly easy to complete the screening of a large population with flanking PCR markers within a week, which significantly save time for selecting recombinants in a large mapping population. Thus, the crude genomic DNA does not need to be stored for long term. The crude DNA from 0.01 g of fresh leaf was halved and stored at 4°C and -20°C, respectively. On the 7th day, all the samples were used for PCR amplification. From the PCR products by agarose gel electrophoresis (Fig. 4), we could clearly see that the PCR amplicons amplified from the DNA stored at 4°C were as clear and intensive as those from -20°C. This indicates that the crude DNA stored at 4°C is reliable for PCR amplification within a week. DNA purity and yield During the screening in PCR analysis, high-quality DNA
Fig. 5. Quantity of DNA obtained from the stored samples at 4°C via precipitation.
should be extracted from some selected plants for other purposes. The crude genomic DNA is suitable for PCR amplification, and for refining high-quality DNA with ethanol as well. Fig. 5 shows the amount of DNA from the stored samples at 4°C after precipitation with ethanol. The amount of DNA was around 30 μg and the yield was stable during storage.
DISCUSSION Many methods for plant DNA extractions have been used in rice (Oryza sativa) including classic SDS method and CTAB method (Stewart and Via, 1993; Ausubel et al, 1996). In addition, some simple modified methods were also developed and used in rice such as modified SDS method (Wang H W et al, 2002), alkali boiling method (Wang X F et al, 2002), NaOH-Tris·HCl neutralized method (Chen et al, 2006), cutter and SDS method (Zhao et al, 2006), and miniprep extraction method (Qiu et al, 2006). Nevertheless, the bottleneck still exists due to efficiency, stability to PCR amplification or costs. Unlike the above mentioned plant DNA extraction protocols, the method in this study has several advantages. Firstly, it mixes the chloroform with extraction buffer to remove the containing protein during tissue grinding. The alteration significantly minimizes time and laboratory materials. One person can process as many as 96 samples within 10 min. Secondly, this method does not include the use of ethanol or isopropanol to precipitate DNA pellet. It reduces a variety of reagents in the process. Thirdly, the amount of crude genomic DNA isolated from 0.01 g of fresh leaf can be used for more than a hundred PCR
SUN Chuan, et al. A Simple Method for Preparation of Rice Genomic DNA amplifications. It also gains about 30 μg of high-quality DNA from fresh leaf via precipitation with ethanol. Moreover, since a small amount of material is enough for DNA extraction in this method, samples can be performed one week later after sowing. Furthermore, the crude DNA can not only be directly used for PCR amplification, but also be precipitated with ethanol for high-quality DNA. Finally, this method may also be available for other crops. DNA isolated from plants often contains certain compounds that inhibit PCR amplification (Kamalay et al, 1990; John, 1992). In this method, chloroform and β-mercaptoethanol were added in the extraction buffer to get rid of the contamination such as polysaccharides and polyphenols in leaf tissues which result in the inhibition of DNA amplification during PCR reactions (Sambrook and Russell, 2002). Additionally, the chloroformpartition step assures good DNA quality. High molecular DNA is obtained with relatively low partial degradation, and could be amplified by PCR. The addition of BSA in PCR buffer also improves the specificity in PCR amplification (Silvy et al, 2004). Notwithstanding, RNA was detected in crude genomic DNA, and no effect on PCR amplification was found, therefore, an RNase treatment was not necessary. The content of DNA precipitated with ethanol in this method is similar to the CTAB method, and the DNA is suitable for long-term storage. This method is suitable for varied rice tissues, such as root, culm and seed, and for other plants as well.
329
DNA extraction protocol for PCR analysis. Rice Sci, 13(1): 67–70. Dilworth E, Frey J E. 2000. A rapid method for high throughput DNA extraction from plant material for PCR amplification. Plant Mol Biol Rep, 18: 61–64. John M E. 1992. An efficient method for isolation of RNA and DNA from plants containing polyphenolics. Nucl Acids Res, 20(9): 2381. Kamalay J, Tejwani R, Keith R G. 1990. Isolation and analysis of genomic DNA from single seeds. Crop Sci, 30(5): 1079–1084. Mace E S, Buhariwalla H K, Crouch J H. 2003. A high-throughput DNA extraction protocol for tropical molecular breeding programs. Plant Mol Biol Rep, 21(4): 459a–459h. McCouch S R, Kochert G, Yu Z H, Wang Z Y, Khush G S, Coffman W R, Tanksley S D. 1988. Molecular mapping of rice chromosomes. Theor Appl Genet, 76: 815–829. Paris M, Carter M. 2000. Cereal DNA: A rapid high-throughput extraction method for marker-assisted selection. Plant Mol Biol Rep, 18(4): 357–360. Qiu F L, Wang H H, Chen J, Zhuang J Y, Heung H, Cheng S H, Wu J L. 2006. A rapid DNA mini-prep method for large-scale rice mutant screening. Rice Sci, 13(4): 299–302. Sambrook J, Russell D. 2002. Molecular Cloning: A Laboratory Manual. 3rd edn. translated by Huang P T. Beijing: Science Press. (in Chinese) Silvy M, Pic G, Gabert J, Picard C. 2004. Improvement of gene expression analysis by RQ-PCR technology: Addition of BSA. Leukemia, 18(5): 1022–1025. Steenkamp J, Wild I, Lourens A, Helden V P. 1991. Improved method for
ACKNOWLEDGEMENTS This work was supported by grants from the Ministry of Agriculture of China for transgenic research (Grant No. 2008ZX08009-003), the National Natural Science Foundation of China (Grant Nos. 30710103903 and 30771160) and the Natural Science Foundation of Zhejiang Province, China (Grant No. R3090023).
DNA extraction from Vitis vinifera. Am J Enol Vit, 45: 102–106. Stewart C N Jr, Via L E. 1993. A rapid CTAB DNA isolation technique useful for RAPD fingerprinting and other PCR applications. BioTechnique, 14(5): 748–750. Wang H W, Wu C, Zhao X Y, Wang J H, Zhang R Y, Wang Y F. 2002. A rapid method for preparation of PCR template using SDS. J Hebei Univ: Nat Sci, 22(2): 186–188. (in Chinese with English abstract) Wang L, Long Y M, Liu Y G. 2009. A method for rapid preparation of plant genomic DNA for PCR analysis. Mol Plant Breeding, 7(2): 425–428. (in Chinese with English abstract)
REFERENCES
Wang X F, Yang J B, Xiang T H, Li L, Ni D H. 2002. A new method for PCR reaction from alkali-treated rice leaf tissues. Chin J Rice Sci,
Aljanabi S M, Martinez I. 1997. Universal and rapid salt-extraction of high quality genomic DNA for PCR based techniques. Nucl Acids
16(1): 67–70. (in Chinese with English abstract) Yu S W, Liu Y B. 2003. Application of molecular marker techniques in rice genetics and breeding. Acta Agric Univ Jiangxi, 25(1): 111–116.
Res, 25: 4692–4693. Ausubel F M, Brent R, Kingston R E. 1996. Phenol/SDS method for plant RNA preparation. In: Current Protocols in Molecular Biology.
(in Chinese with English abstract) Zhao H X, Xie P, Huang Z J, Ju C M, Zhou Y. 2006. An improved method of extracting rice genomic DNA. J Hubei Univ: Nat Sci,
Vol.1. New York: John Wiley and Sons, Inc. Chen W Y, Cui H R, Bao J S, Zhou X S, Shu Q Y. 2006. A simplified rice
12(4): 389–392. (in Chinese with English abstract)