A single amino acid substitution in movement protein of tomato torrado virus influences ToTV infectivity in Solanum lycopersicum

Virus Research 213 (2016) 32–36

Contents lists available at ScienceDirect

Virus Research journal homepage: www.elsevier.com/locate/virusres

Short communication

A single amino acid substitution in movement protein of tomato torrado virus influences ToTV infectivity in Solanum lycopersicum ∗ ˛ ˛ Przemysław Wieczorek, Aleksandra Obrepalska-St eplowska Interdepartmental Laboratory of Molecular Biology-National Research Institute, 20 WładysławaW˛egorka St, Pozna´ n 60-318, Poland

a r t i c l e

i n f o

Article history: Received 28 July 2015 Received in revised form 4 November 2015 Accepted 4 November 2015 Available online 10 November 2015 Keywords: Tomato torrado virus Pathogenicity determinant Movement protein Mutation Symptom expression Plant response

a b s t r a c t Tomato torrado virus (ToTV), which is a tomato-infecting member of the genus Torradovirus, induces severe systemic necrosis in Solanum lycopersicum cv. Beta Lux as well as leaf malformation and chlorosis in Nicotiana benthamiana. To date, neither the tomato gene conferring resistance to the pathogen nor the ToTV-encoded necrosis determinant have been characterized. We herein revealed that the phenylalanine 210 residue in the movement protein domain encoded by ToTV RNA2 is a necrosis-inducing pathogenicity determinant during tomato infection. Using a ToTV infectious RNA2 clone, we performed site-directed mutagenesis of the phenylalanine 210 residue, confirming its importance during ToTV infection and symptom manifestation in S. lycopersicum cv. Beta Lux, but not in N. benthamiana. © 2015 Elsevier B.V. All rights reserved.

Tomato torrado virus (ToTV) of the family Secoviridae and genus Torradovirus (Sanfac¸on et al., 2009) infects Solanum lycopersicum causing severe necrosis of leaves and stems. Importantly, ToTV also infects Nicotiana benthamiana inducing leaf malformations and chlorosis in the host (Pospieszny et al., 2010). In favorable environmental conditions, torrado disease might result in plant death. Therefore, ToTV is considered to be an increasingly important plant pathogen and has been on the European and Mediterranean Plant Protection Organization Alert List (2009–2013, www.eppo.int). ToTV presents in infected cells as spherical particles encapsidating the polyadenylated viral genetic material: RNA1 (approximately 7800 nucleotides encoding genes involved in ToTV replication) and RNA2 (approximately 5400 nucleotides encoding a movement protein (3A), capsid subunits, and ORF1 of unknown function) (Budziszewska et al., 2008; Verbeek et al., 2007). The RNA serves as a template for the translation of polyproteins that are processed to functional proteins. Compared with RNA2, RNA1 is highly heterogenic in terms of length within its 3 untranslated region (Budziszewska et al., 2014). Sequence data for all torradoviruses indicate a high genetic diversity between tomato-infecting viruses and the other members (including proposed members) of the genus (Seo et al., 2015; Verbeek et al., 2014). Although intra-species

∗ Corresponding author. E-mail addresses: [email protected], [email protected] ˛ ˛ (A. Obrepalska-St eplowska). http://dx.doi.org/10.1016/j.virusres.2015.11.008 0168-1702/© 2015 Elsevier B.V. All rights reserved.

genetic similarity is characteristic of torradoviruses, there is a lack of information regarding pathogenicity mechanisms mediating ToTV infection of tomato. Moreover, a mild isolate of ToTV (i.e., one that does not cause necrosis in tomato) has not been described. Therefore, it is difficult to explain the correlation between ToTV genetic diversity and its pathogenicity in S. lycopersicum. The identification of ToTV-encoded candidate pathogenicity determinants may require random mutagenesis of the infectious viral clones or a gene-by-gene knockout analysis of the genome. We herein report new details regarding ToTV infectivity in tomato by describing the pathogenicity-related functional potential of its 3A domain, particularly the importance of phenylalanine 210 (F210). By screening several novel ToTV infectious RNA2 clones, we identified a new pathotype (variant). The infectious clone differs from the original wild-type ToTV-Kra by having a leucine (L) in place of F210. The new virus variant, named ToTV-Kra-L, could not infect S. lycopersicum cv. Beta Lux, but retained its infectivity and spreading potential in N. benthamiana. The ToTV-Kra isolate was maintained in N. benthamiana and S. lycopersicum cv. Beta Lux. A ToTV infectious RNA2 clone was generated as previously described (Wieczorek et al., 2015). Several plasmid clones (p35Kra2-2015) consisting of a full-length RNA2 copy cloned downstream of the 35S cauliflower mosaic virus promoter were transformed into Agrobacterium tumefaciens strain GV3101 (with the pSoup plasmid). After 2–3 days of incubation at 28 ◦ C, the transformants were cultured in liquid Luria-Bertani (LB) medium with kanamycin (50 ␮g/ml) and tetracycline (5 ␮g/ml)

P. Wieczorek, A. Obr˛epalska-St˛eplowska / Virus Research 213 (2016) 32–36

for 24 h at 28 ◦ C. The bacteria were harvested by centrifugation (3000 × g, 15 min) and re-suspended in infiltrating buffer [10 mM MES (2-(N-morpholino) ethanesulfonic acid) pH 5.8, 0.5 ␮M acetosyringone, and 10 mM MgCl2 ] followed by incubation at room temperature for at least 2 h. The optical density of the bacterial solutions was measured and adjusted to OD600nm 1.0. A plasmid corresponding to the full-length copy of ToTV-Kra RNA1 (p35Kra1), described previously by Wieczorek et al. (2015), was used to transform A. tumefaciens. This plasmid encodes ToTV proteins essential for virus replication (e.g., RNA-dependent RNA polymerase). Therefore, here and during subsequent steps, the inoculum was prepared by mixing equal amounts of A. tumefaciens with the p35Kra1 construct and A. tumefaciens suspensions carrying p35Kra2–2015. The mixture was infiltrated into two leaves of 3–4 week old N. benthamiana and S. lycopersicum cv. Beta Lux seedlings, with five plants per infiltration. Plants were kept separately based on variant in a greenhouse at 25 ◦ C. Symptoms of systemic infection were monitored

33

starting from the 7th day post infiltration (dpi). Systemic leaves were collected for RNA extraction with TriReagent (Life Technologies). The RNA (approximately 2 ␮g) was subsequently used for cDNA synthesis with 100 ng random hexamers and 200 U RevertAid Reverse Transcriptase (Thermo Scientific) according to the manufacturer’s protocol. The resulting cDNA was used for polymerase chain reaction (PCR) with primers 2TT5/2TT6 (Budziszewska et al., 2008). Macroscopic observations of symptoms in infiltrated plants revealed several individuals with symptoms characteristic of ToTV infection (Fig. 1). The N. benthamiana plants infiltrated with wildtype ToTV-Kra infectious clones developed leaf malformations and chloroses. S. lycopersicum cv. Beta Lux plants infiltrated with the same infectious clones developed a characteristic burn-like severe necrosis in leaves. However, of the remaining 10 ToTV RNA2 clones, eight did not induce any symptoms of infection in N. benthamiana or S. lycopersicum and were not included in the subsequent sequence analyses. Moreover, two clones (p35Kra2.1 and p35Kra2.2) induced

Fig.1. Symptoms induced by tomato torrado virus-Kra wild type (ToTV-Kra-wt), ToTV-Kra-L, and their mutants (ToTV-Kra-wt → F210L and ToTV-Kra-L → L210F) in Solanum lycopersicum cv. Beta Lux and Nicotiana benthamiana. Plants infiltrated with empty vector were included.

Fig. 2. Analysis of reverse transcription-PCR amplification products in an agarose gel. Solanum lycopersicum cv. Beta Lux and Nicotiana benthamiana plants infected with ToTV-Kra-L, ToTV-Kra-wt, ToTV-Kra-F210L and ToTV-Kra-L-L210F variants. RNA extracted from infiltrated pants was analysed by reverse transcription-PCR. Non infiltrated plants were also included. NTC—no template control. The specific amplification product is represented by DNA band of ca. 600 nucleotide base pairs. Below each gel internal control is shown, EF1␣ for tomato (SlEF1␣) and actin for Nicotiana benthamiana (Nbact).

34

P. Wieczorek, A. Obr˛epalska-St˛eplowska / Virus Research 213 (2016) 32–36

symptoms in N. benthamiana that were similar to those induced by the wild-type ToTV (Fig. 1). However, in the presence of only p35Kra2.2, severe necrosis developed in S. lycopersicum cv. Beta Lux. Clone p35Kra2.1 did not produce burn-like symptoms in S. lycopersicum cv. Beta Lux and all plants infiltrated with this clone remained symptomless (up to 30 dpi). Reverse transcription-PCR analysis of the plants infiltrated with ToTV-Kra-L (i.e., virus derived from the p35Kra1 and p35Kra2.1 clones) gave products of the expected size only in N. benthamiana (Fig. 2). The results indicated that ToTV-Kra-L could not infect S. lycopersicum cv. Beta Lux as efficiently as the wild-type virus, but remained infectious to N. benthamiana. To assess whether the virulence potential of ToTV-Kra-L corresponded to any nucleotide/amino acid changes, the entire RNA2-encoding insert in p35Kra2.1 was sequenced using a primer-walking strategy. The resulting sequence contigs were assembled, in silico translated, and compared with the wild-type RNA2 from ToTV-Kra. Comparative analysis revealed a nucleotide change T1329C resulting in the F210L mutation (Fig. 3). This amino acid change occurred in the 3A domain of ToTV. To further investigate whether F210 is a determinant of host-specific ToTV infectivity potential, we performed site-directed mutagenesis to replace F210 with L210 in the wildtype ToTV-Kra. We also performed reverse mutagenesis to convert L210 back to F210 in the p35Kra2.1 clone. Site-directed mutagenesis was done using the QuikChange II XL Site-Directed Mutagenesis protocol (Agilent Technologies) with mutagenic primers designed by the QuikChange® Primer Design Program (Agilent Technologies). Primer sequences were as follows: To2F210L.1: and TCCTGTCTGTCTTGTAAAAATTGAGGTCGGTGAAGAGC To2F210L.2: GCTCTTCACCGACCTCAATTTTTACAAGACAGACAGGA (bold and underlined sequence results in F210 → L210); To2L210F.1: TCCTGTCTGTCTTGGAAAAATTGAGGTCGGTGAAGAGC and To2L210F.2: GCTCTTCACCGACCTCAATTTTTCCAAGACAGACAGGA (bold and underlined sequence results in L210 → F210). The conversion of the p35Kra2.2 clone (wild type) to p35Kra2.1 was completed using 25 ng template (p35Kra2.2), 125 ng To2F210L.1 and To2F210L.2, and PfuUltra II Fusion HS DNA Polymerase (Agilent Technologies). The p35Kra2.1 clone was mutated with primers To2L210F.1 and To2L210F.2. The resulting samples were subjected to DpnI-mediated template plasmid digestion (Thermo Scientific) and used for Escherichia coli TOP10 strain (Life Technologies) transformation. Plasmid DNA was extracted from the transformed bacteria (Macherey-Nagel). To verify their integrity, plasmids were digested with EcoRI restriction enzyme (Thermo Scientific). Four individual clones (for each p35Kra2.1-L210F and p35Kra2F210L construct) were used to transform A. tumefaciens strain GV3101 (with the pSoup plasmid). The transformed bacteria were plated on LB-agar medium with 50 ␮g/ml kanamycin and 5 ␮g/ml tetracycline and grown for 2–3 days at 28 ◦ C. Single colonies were grown separately in liquid LB medium supplemented with kanamycin and tetracycline. Bacteria were then harvested by centrifugation (3000 × g, 15 min) and re-suspended in infiltrating buffer. After incubating for at least 2 h at room temperature, the bacterial solutions were adjusted to OD600nm 1.0 and mixed with equal amounts of A. tumefaciens carrying p35Kra1 (wild type). The mixtures were infiltrated in N. benthamiana and S. lycopersicum cv. Beta Lux seedlings (four plants for each infiltration). Plants were grown at 25 ◦ C in a greenhouse. Symptoms of infection started to develop 6 dpi in N. benthamiana plants infiltrated with ToTV-Kra-F210L (derived from p35Kra1 + p35Kra2-F210L) and ToTV-Kra-L-L210F (derived from p35Kra1 + p35Kra2.1 − L210F). Infiltrated plants exhibited symptoms (leaf malformations and chlorosis) similar to those induced by wild-type ToTV. In plants infected with ToTV-Kra-L-L210F, necrosis started to appear within the main vein of leaflets and spread gradually, ultimately leading to severe necrosis (Fig. 1). Impor-

tantly, the characteristic symptoms of torrado disease appeared only in plants infiltrated with the mutated p35Kra2.1-L210F. Plants infiltrated with p35Kra2-F210L remained symptomless (Fig. 1). Control plants infiltrated with the mixture of A. tumefaciens carrying wild-type p35Kra1 and p35Kra2 developed necrosis at the same time as plants infected with ToTV-Kra-L-L210F. Additionally, plants infiltrated with either p35Kra1 or p35Kra2 remained symptomless (data not shown). To further assess the presence of ToTV mutants in infiltrated plants, RNA from systemic leaves were reverse transcribed and used for PCR with primers specific for ToTV RNA2 (2TT5/2TT6). As shown in Fig. 2, conversion of ToTV-Kra (wild type) to ToTV-Kra-F210L did not affect ToTV infectivity in N. benthamiana, but it did abort ToTV virulence in S. lycopersicum cv. Beta Lux. Necrosis did not develop in S. lycopersicum plants, which remained symptomless (Fig. 1). In contrast, converting ToTV-Kra-L to ToTV-Kra-L-L210F resulted in ToTV clones that had recovered the potential to infect S. lycopersicum (Fig. 2) as evidenced by the severe necrosis in leaves and symptoms that were similar to those induced by wild-type ToTV-Kra (Fig. 1). These results demonstrate the importance of the F210 residue in the ToTV 3A domain during infection. The F210L substitution negatively correlates with ToTV virulence in S. lycopersicum cv. Beta Lux. Tomato torrado virus is considered to be an important and emerging tomato pathogen. Importantly, in addition to S. lycopersicum, ToTV is able to infect other economically-important solanaceous crops, including pepper, eggplant (Amari et al., 2008), and potato (Budziszewska et al., 2015) as well as weeds (AlfaroFernández et al., 2008). This indicates that ToTV can adapt to a wide range of hosts. To verify the genetic nature of the host-specific ToTV adaptation, a new variant of RNA2 was isolated from a population of newly engineered ToTV infectious clones. The engineered clones consisted of full-length RNA2 under the control of the 35S cauliflower mosaic virus promoter and the nopaline synthase terminator. Out of ten tested RNA2 variants, one proved to be infectious (in the presence of ToTV RNA1) in N. benthamiana and S. lycopersicum cv. Beta Lux and induced symptoms similar to those produced by the wild-type virus. Another variant, with L210 replacing F210, did not induce necrosis in S. lycopersicum. Restoring the wild-type amino acid resulted in recovered ToTV infectivity in S. lycopersicum cv. Beta Lux. Conversely, introducing L210 in wild-type RNA2 produced a ToTV variant (ToTV-Kra-F210L) unable to induce necrosis in S. lycopersicum. In silico comparative analysis of the 3A amino acid sequences from known ToTV isolates and other torradoviruses indicated that F210 is highly conserved within tomato-infecting members of the genus (Fig. 3). A Metaserver-based secondary structure prediction (Kurowski and Bujnicki, 2003) indicated that the residue creates part of an ␣-helix within the 3A domain, and the F210L substitution might lead to a slight structural modification of the motif (Fig. 3) that influences 3A function. It has been reported that the secondary structure (␣-helix motif) of the melon necrotic spot virus movement protein is important for virus cellto-cell transport (Genovés et al., 2011). Furthermore, 3A homologs of torradoviruses unable to infect tomato lack the F residue at the position corresponding to F210 in ToTV RNA2. Instead, an L residue (carrot torrado virus and cassava torrado-like virus) or a valine (motherwort yellow mottle virus and lettuce necrotic leaf curl virus) is present at this position (Fig. 3). This might indicate the adaptive potential of the locus (residue) during ToTV (and possibly other tomato-infecting torradoviruses) evolution and spread to new hosts. Many studies have reported that a single amino acid substitution can influence virus pathogenicity. For example, a point mutation (aspartic acid to tyrosine) within the helper component of zucchini yellow mosaic virus reduced the symptoms induced by the virus in zucchini squash (Desbiez et al., 2010). Mutation of the helper com-

P. Wieczorek, A. Obr˛epalska-St˛eplowska / Virus Research 213 (2016) 32–36

35

Fig. 3. Comparative sequence analysis of p35Kra2 (wild-type) and p35Kra2.1 plasmid. (A) The mutated T1329C nucleotide and deduced amino acid sequence comparisons in p35Kra2 and p35Kra2.1 are shown. The F210 in p35Kra2 and L210 in p35Kra2.1 are indicated. (B) Multiple alignment analysis of partial 3A sequences of known torradoviruses and potential torradoviruses (ToTV: tomato torrado virus, ToMarV: tomato marchitez virus, ToChV: tomato chocolàte virus, CaTV: carrot torrado virus, MYMoV: motherwort yellow mottle virus, LNLCV: lettuce necrotic leaf curl virus, and CsTLV: cassava torrado-like virus). A conserved F210 residue is indicated by an arrowhead. (C) Comparative analysis of a 3A fragment surrounding the region of the F210L mutation. Motifs of possible RNA-protein interactions and ␣-helices are included (Metaserver prediction).

ponent region in another potyvirus, potato virus Y, was responsible for the vein necrosis phenotype in tobacco (Hu et al., 2009). It is important to consider that while handling infectious clones (transcripts) of viruses with long genomic RNA strands, some mutations may be inadvertently introduced during reverse transcription or PCR amplification. Spetz et al. (2008) reported that a single insertion of a cytosine within the gene encoding the carboxyl end of the coat protein-coding sequence produced a final protein that was nine amino acids shorter than that of the wild-type poinsettia mosaic virus. This change resulted in a clone that could not infect its natural host, but could still infect N. benthamiana. Systemic infections involve short- and long-distance viral movement in the infected plant. Coat proteins and movement proteins are viral factors that might be crucial in transportation-mediated virus pathogenicity. Movement proteins have been described in cucumber mosaic virus (CMV) studies of virulence against cmv1mediated resistance in melon (Cucumis melo). Guiu-Aragonés et al. (2015) identified four amino acids in the CMVmovement protein that are important for breaking resistance (controlled at the level of CMV long-distance movement) in CMV-resistant melon. We have previously focused on the ToTV coat protein as a factor determining ToTV virulence/pathogenicity in S. lycopersicum cv. Beta Lux and N. benthamiana (unpublished data, Wieczorek et al., 2015, manuscript being revised). In the present study, we focused on F210 in the 3A-encoding domain of ToTV-Kra as a potential hostspecific symptom determinant. However, the necrosis-inducing function of ToTV 3A requires further research. Future studies will need to focus first on determining the actual 3A product that is generated after ToTV polyprotein processing during virus replication. Because the F210L substitution might slightly change the ␣-helical structure within 3A (Fig. 3), mapping the F210 residue on the

protein surface and determining the host molecular partners interacting with the protein will also provide important information. Additionally, identifying the tomato gene conferring resistance to ToTV may also be of value. Although S. lycopersicum cv. Emotion and Raisa (Pospieszny et al., 2010) are resistant to ToTV, the specific genetic basis as well as the molecular and biochemical mechanisms involved in protecting the plants from ToTV have yet to be described.

Acknowledgment This work was supported by the Polish National Science Centre (grant no UMO-2011-N-NZ9-07131).

References Alfaro-Fernández, A., Córdoba-Sellés, C., Cebrián, M.C., Herrera-Vásquez, J.A., Sánchez-Navarro, J.A., Juárez, M., Espino, A., Martín, R., Jordá, C., 2008. First report of Tomato torrado virus on weed hosts in Spain. Plant Dis. 92, 831. Amari, K., Gonzalez-Ibeas, D., Gómez, P., Sempere, R., Sanchez-Pina, M., Aranda, M., Diaz-Pendon, J., Navas-Castillo, J., Moriones, E., Blanca, J., 2008. Tomato torrado virus is transmitted by Bemisiatabaci and infects pepper and eggplant in addition to tomato. Plant Dis. 92, 1139. Budziszewska, M., Obrepalska-Steplowska, A., Wieczorek, P., Pospieszny, H., 2008. The nucleotide sequence of a Polish isolate of Tomato torradovirus. Virus Genes37, 400–406. Budziszewska, M., Pospieszny, H., Obrepalska-Steplowska, A., 2015. Genome characteristics, phylogeny, and varying host specificity of Polish Kra and Ros isolates of Tomato torrado virus. J. Phytopathol., http://dx.doi.org/10.1111/jph. 12417. ˛ ˛ eplowska, Budziszewska, M., Wieczorek, P., Zhang, Y., Frishman, D., Obrepalska-St A., 2014. Genetic variability within the Polish Tomato torrado virus Kra isolate caused by deletions in the 3’-untranslated region of genomic RNA1. Virus Res. 185, 47–52.

36

P. Wieczorek, A. Obr˛epalska-St˛eplowska / Virus Research 213 (2016) 32–36

Desbiez, C., Girard, M., Lecoq, H., 2010. A novel natural mutation in HC-Pro responsible for mild symptomatology of Zucchini yellow mosaic virus (ZYMV, Potyvirus) in cucurbits. Arch. Virol. 155, 397–401. Genovés, A., Pallás, V., Navarro, J.A., 2011. Contribution of topology determinants of a viral movement protein to its membrane association, intracellular traffic, and viral cell-to-cell movement. J. Virol. 85, 7797–7809. Guiu-Aragonés, C., Díaz-Pendón, J.A., Martín-Hernández, A.M., 2015. Four sequence positions of the movement protein of Cucumber mosaic virus determine the virulence against cmv1-mediated resistance in melon. Mol. Plant Pathol. 16, 675–684. Hu, X., Meacham, T., Ewing, L., Gray, S.M., Karasev, A.V., 2009. A novel recombinant strain of Potato virus Y suggests a new viral genetic determinant of vein necrosis in tobacco. Virus Res. 143, 68–76. Kurowski, M.A., Bujnicki, J.M., 2003. GeneSilico protein structure prediction meta-server. Nucleic Acids Res. 31, 3305–3307. Pospieszny, H., Budziszewska, M., Hasiów-Jaroszewska, B., Obrepalska-Steplowska, A., Borodynko, N., 2010. Biological and molecular characterization of polish isolates of Tomato torrado virus. J. Phytopathol. 158, 56–62. Sanfac¸on, H., Wellink, J., Le Gall, O., Karasev, A., van der Vlugt, R., Wetzel, T., 2009. Secoviridae: a proposed family of plant viruses within the order Picornavirales

that combines the families Sequiviridae and Comoviridae, the unassigned genera Cheravirus and Sadwavirus, and the proposed genus Torradovirus. Arch Virol 154, 899–907. Seo, J.K., Kang, M., Kwak, H.R., Kim, M.K., Kim, C.S., Lee, S.H., Kim, J.S., Choi, H.S., 2015. Complete genome sequence of motherwort yellow mottle virus, a novel putative member of the genus Torradovirus. Arch. Virol. 160, 587–590. Spetz, C., Moe, R., Blystad, D.R., 2008. Symptomless infectious cDNA clone of a Norwegian isolate of Poinsettia mosaic virus. Arch. Virol. 153, 1347–1351. Verbeek, M., Dullemans, A.M., van den Heuvel, J.F., Maris, P.C., van der Vlugt, R.A., 2007. Identification and characterisation of Tomato torrado virus, a new plant picorna-like virus from tomato. Arch. Virol. 152, 881–890. Verbeek, M., Dullemans, A.M., van Raaij, H.M., Verhoeven, J.T., van der Vlugt, R.A., 2014. Lettuce necrotic leaf curl virus, a new plant virus infecting lettuce and a proposed member of the genus Torradovirus. Arch. Virol. 159, 801–805. ˛ ˛ Wieczorek, P., Budziszewska, M., Obrepalska-St eplowska, A., 2015. Construction of infectious clones of Tomato torrado virus and their delivery by agroinfiltration. Arch.Virol. 160, 517–521.