- Email: [email protected]
A Single-Amino-Acid Substitution in the C Terminus of PhoP Determines DNA-Binding Specificity of the Virulence-Associated Response Regulator from Mycobacterium tuberculosis
doi:10.1016/j.jmb.2010.03.056
J. Mol. Biol. (2010) 398, 647–656
Available online at www.sciencedirect.com
COMMUNICATION
A Single-Amino-Acid Substitution in the C Terminus of PhoP Determines DNA-Binding Specificity of the Virulence-Associated Response Regulator from Mycobacterium tuberculosis Arijit Kumar Das†, Anuj Pathak†, Akesh Sinha, Manish Datt, Balvinder Singh, Subramanian Karthikeyan and Dibyendu Sarkar⁎ Institute of Microbial Technology (CSIR), Sector-39A, Chandigarh-160036, India Received 19 December 2009; received in revised form 24 March 2010; accepted 27 March 2010 Available online 2 April 2010
The Mycobacterium tuberculosis PhoP–PhoR two-component system is essential for virulence in animal models of tuberculosis. Genetic and biochemical studies indicate that PhoP regulates the expression of more than 110 genes in M. tuberculosis. The C-terminal effector domain of PhoP exhibits a winged helix–turn–helix motif with the molecular surfaces around the recognition helix (α8) displaying strong positive electrostatic potential, suggesting its role in DNA binding and nucleotide sequence recognition. Here, the relative importance of interfacial α8–DNA contacts has been tested through rational mutagenesis coupled with in vitro bindingaffinity studies. Most PhoP mutants, each with a potential DNA contacting residue replaced with Ala, had significantly reduced DNA binding affinity. However, substitution of nonconserved Glu215 had a major effect on the specificity of recognition. Although lack of specificity does not necessarily correlate with gross change in the overall DNA binding properties of PhoP, structural superposition of the PhoP C-domain on the Escherichia coli PhoB C-domain–DNA complex suggests a base-specific interaction between Glu215 of PhoP and the ninth base of the DR1 repeat motif. Biochemical experiments corroborate these results, showing that DNA recognition specificity can be altered by as little as a single residue change of the protein or a single base change of the DNA. The results have implications for the mechanism of sequence-specific DNA binding by PhoP. © 2010 Elsevier Ltd. All rights reserved.
Edited by M. Yaniv
Keywords: direct repeats; DNA recognition specificity; M. tuberculosis PhoP; recognition helix; response regulator
Much of the reason for the success of Mycobacterium tuberculosis as an intracellular pathogen lies in its ability to adapt to its host environments through signal transduction leading to switching on of complex transcriptional programs. 1 It is now known that the major response of the bacterium to environmental changes is through classical two-
*Corresponding author. E-mail address: [email protected]. † A.D. and A.P. contributed equally to this work. Abbreviations used: EMSA, electrophoretic mobility shift assay; GdnHCL, guanidine hydrochloride.
component regulatory systems via histidine–aspartate phosphorelay between the sensor kinase and the response regulator.2 A number of recent studies revealed that PhoP of the PhoPR system controls a variety of functions including synthesis of complex pathogenic lipids, hypoxia response through DosR cross-talking, respiratory metabolism, secretion of the major T-cell antigen ESAT-6, and stress response3–9 (for a review, see Ref. 10 ). Further supporting the role of PhoP in regulation of M. tuberculosis virulence, two recent articles suggest that a point mutation in PhoP contributes to avirulence and also accounts for the absence of polyketide-derived acyltrehaloses in M. tuberculosis H37Ra.11,12
0022-2836/$ - see front matter © 2010 Elsevier Ltd. All rights reserved.
648 PhoP, a member of the OmpR/PhoB subfamily of response regulators, is composed of two functional domains, an N-terminal receiver domain (PhoPN) and a C-terminal effector domain (PhoPC), involved in DNA binding. The only reported interaction of PhoP from M. tuberculosis H37Rv involves binding of the regulator to its own promoter leading to autoregulation.8 This observation was extended to show that the primary interaction believed to promote autoregulation involves sequence-specific recognition of two PhoP protomers to the target DNA comprising a 9-bp direct repeat motif (present within the phoP promoter region).13 Moreover, biochemical evidences suggest head-to-head binding of two molecules of full-length PhoP monomers on a direct repeat motif projecting their N-termini toward one another.13 Although global gene expression profiling shows that 44 genes are up-regulated and another 70 genes are down-regulated by PhoP in M. tuberculosis,5 the origins of DNA binding affinity and sequence specificity of the regulator remain largely unknown. The crystal structure of PhoPC clearly shows that the primary DNA binding of the protein involves a winged helix–turn–helix motif14 [Protein Data Bank (PDB ID) 2PMU] and the surface around the PhoP residues that constitute the recognition helix (residues Asn212–Tyr224 of α8) display strong positive electrostatic potential, indicating that these residues are likely to be critical in DNA binding and nucleotide sequence recognition. To this end, we used structure-guided mutagenesis to obtain single alanine substitutions of 10 solvent-exposed residues spanning α8. Our results of rational mutagenesis coupled with a study of the DNA binding affinity of the α8–DNA interface in the complex formed by PhoP and its cognate DNA demonstrate that most PhoP mutants have significantly reduced DNA binding affinity while possessing near-wild-type stability. However, alanine substitution of Glu215 of α8 shows a major effect on the specificity of DNA recognition. Using structural insights coupled with biochemical analyses, we found that Glu215 of PhoP appears to establish a base-specific interaction with (G/C)9 of the upstream repeat motif (DR1 of DR1,2) to contribute significantly to the recognition specificity of the regulator. Amino acid mutagenesis of the PhoP–DNA interface To decipher the origins of binding affinity and sequence specificity, we set out to identify amino acid residues of α8 that are important for sequencespecific DNA binding of PhoP. The three-dimensional structure of M. tuberculosis PhoPC (residues 144–247) and the modeled structure of the PhoPC– DNA complex14 served as a guide for selection of amino acid residues to be mutated. Substitution sites of amino acid residues (as shown in Fig. 1a) with solvent-exposed side chains were selected, since these residues are expected to form base-specific
DNA Binding Specificity of M. tuberculosis PhoP
hydrogen bonds, ionic interactions, or van der Waals contacts with the DNA duplex and are therefore likely to contribute to the level of DNA binding affinity and recognition specificity. Wild-type and mutant PhoP proteins from M. tuberculosis H37Rv (Table 1) were purified as fusion proteins containing an N-terminal polyhistidine tag. To examine the effect of Ala substitution of PhoP on the overall structure and/or fold, mutant proteins were compared for their stability. To this effect, equilibrium denaturation of PhoP and PhoP mutants by guanidine hydrochloride (GdnHCl) was monitored by change in CD ellipticity at 220 nm. Expectedly, both wild-type and mutant proteins underwent loss of structure (native to denatured) with increasing GdnHCl concentration. The values for free energy of denaturation in the absence of GdnHCl (ΔGuH20) and the change in free energy with GdnHCl (m) obtained from multiple denaturation experiments are listed in Table 2. Eight of the 10 mutants have ΔGuH20 values within ± 0.5 kcal/mol of wild-type PhoP. Of the other two mutants, PhoPS219A and PhoPR222A showed a reduction in stability of 0.9 and 0.7 kcal/mol, respectively, compared to the wild-type protein. We next investigated DNA binding of purified wild-type and mutant proteins by electrophoretic mobility shift assay (EMSA) using an oligonucleotide-based DR1,2 probe consisting of two direct repeat units (DR1 and DR2). To this effect, His tags were cleaved using Thrombin Clean Cleavage kit from Sigma. When incubated with end-labeled DR1,2 DNA, the majority of the point mutants (7 out of 10) under the conditions examined showed at least 10-fold reduced DNA binding affinity (based on the limits of detection in this assay and based on other gels; not shown) (Fig. 2). However, PhoPE215A (lanes 8–10, Fig. 2a), PhoPS216A (lanes 11–13, Fig. 2a), and PhoPY217A (lanes 2–4, Fig. 2b) formed a single retarded band stable to gel electrophoresis. As reference, wild-type PhoP at identical protein concentrations bound efficiently to the end-labeled DR1,2 probe (lanes 8–10, Fig. 2c). It should be noted that over a range of protein concentrations, the three mutant proteins (PhoPE215A, PhoPS216A, and PhoPY217A) showed wild-type PhoP-like DNA-binding properties with comparable affinity. From these results, we conclude that (i) most of the amino acid residues of the PhoP recognition helix with exposed side chains (residues Asn212, Val213, Ser219, Tyr220, Tyr222, Tyr223, and Lys224) are critical affinity determinants for PhoP–DNA interactions, and (ii) residues Glu215, Ser216, and Tyr217 do not appear to have any significant role in determining the DNA binding affinity of M. tuberculosis PhoP. Specificity changes when PhoP residue Glu215 is substituted To ascertain whether amino acids 215–217 contribute to the specificity of DNA recognition, the binding of PhoP and the three mutant proteins
DNA Binding Specificity of M. tuberculosis PhoP
649
Fig. 1. Rational mutagenesis of the PhoP–DNA complex. (a) Amino acid residues of the recognition helix (α8) of PhoPC14 (residues 144–247; PDB ID 2PMU) that were mutated are labeled. These residues are solvent-exposed and are therefore expected to contribute to the level of DNA binding affinity and/or specificity. (b) Ten PhoP mutants each having a single potential α8 helix DNA contacting residue replaced with Ala were expressed in E. coli BL21(DE3), purified using immobilized metal-affinity [NiNTA (nitrilotriacetic acid), Qiagen] chromatography as described previously, 13 and analyzed by SDS-PAGE (2 μg per lane) followed by Coomassie blue staining. Lane 1, molecular mass markers in kilodaltons. The purity of the protein preparation was ≥95% as judged by SDS-PAGE. Protein concentration was determined by the bicinchoninic acid (BCA) protein assay (Pierce) with bovine serum albumin as standard.
PhoPE215A, PhoPS216A, and PhoPY217A to a nonspecific DNA probe was examined by EMSA using an end-labeled nonspecific DNA (hereinafter referred to as NSP, sequence as described previously13). NSP represents a heterologous nonbinding sequence that lacks a consensus PhoP binding site but has comparable base composition. In agreement with our previous report on specific DNA binding by PhoP,13 wild-type PhoP (lanes 2–4, Fig. 3a) as well as the two mutants PhoPS216A (lanes 8–10) and PhoPY217A (lanes 11–13) failed to generate a complex stable to gel electrophoresis even
at the highest protein concentrations examined (based on the limits of detection in this assay). In sharp contrast, at identical conditions PhoPE215A (lanes 5–7) bound efficiently to end-labeled NSP to form a retarded complex stable to gel electrophoresis. Clearly, these results demonstrate that PhoPE215A shares comparable DNA binding affinity with either DR1,2 or NSP DNA (compare lanes 8–10, Fig. 2a, and lanes 5–7, Fig. 3). In agreement with these results, while PhoP failed to show any detectable DNA binding with end-labeled NSP DNA (Fig. 3a), there is only ≈ 2.2-fold difference in dissociation
650
DNA Binding Specificity of M. tuberculosis PhoP
Table 1. Primes and plasmids used in this work Primersa FPN212A RPN212A FPV213A RPV213A FPE215A RPE215A FPS216A RPS216A FPY217A RPY217A FPS219A RPS219A FPY220A RPY220A FPR222A RPR222A FPR223A RPR223A FPK224A RPK224A Plasmids pET-phoP pET-PhoPN212A pET-PhoPV213A pET-PhoPE215A pET-PhoPS216A pET-PhoPY217A pET-PhoPS219A pET-PhoPY220A pET-PhoPR222A pET-PhoPR223A pET-PhoPK224A
Sequence (5′–3′) or description
Reference
GGTGGTGATGTCGCTGTCGTCGAG CTCGACGACAGCGACATCACCACC GGTGATGTCAACGCTGTCGAGTCC GGACTCGACAGCGTTGACATCACC AACGTCGTCGCCTCCTACGTGTCG CGACACGTAGGAGGCGACGACGTT AACGTCGTCGAGGCTTACGTGTCG CGACACGTAAGCCTCGACGACGTT GTCGTCGAGTCCGCTGTGTCGTAT ATACGACACAGCGGACTCGACGAC GAGTCCTACGTGGCTTATCTGCGC GCGCAGATAAGCCACGTAGGACTC TCCTACGTGTCTGCTCTGCGCCGC GCGGCGCAGAGCAGACCGTAGGA TCGTATCTGGCCCGCAAGATCGAC GTCGATCTTGCGGGCCAGATACGA TATCTGCGCTCAAAGATCGACACT AGTGTCGATCTTTGAGCGCAGATA CTGCGCCGCGCCATCGACACTGGG CCCAGTGTCGATGGCGCGGCGCAG
This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study
PhoP residues 1–247 cloned in pET15b Asn212 codon mutated to Ala in pET-phoP Val213 codon mutated to Ala in pET-phoP Glu215 codon mutated to Ala in pET-phoP Ser216 codon mutated to Ala in pET-phoP Tyr217 codon mutated to Ala in pET-phoP Ser219 codon mutated to Ala in pET-phoP Tyr220 codon mutated to Ala in pET-phoP Arg222 codon mutated to Ala in pET-phoP Arg223 codon mutated to Ala in pET-phoP Lys224 codon mutated to Ala in pET-phoP
This study This study This study This study This study This study This study This study This study This study
13
All enzymatic manipulations of DNA were performed with standard procedures.15 Site-directed mutagenesis of individual PhoP residues was carried out in the phoP gene of pET-phoP by PCR-based two-stage overlap extension method16 using complementary oligonucleotides with the mutated codon and Deep Vent DNA polymerase (New England Biolabs). Plasmid DNA isolation, recovery, and purification of DNA fragments or PCR products were carried out with Qiagen spin columns and procedures (Qiagen, Germany). All mutants were verified by DNA sequence analysis to confirm the presence of the desired mutation and the absence of any unintentional mutations. E. coli DH5α was used for all cloning procedures. a FP, forward primer; RP, reverse primer.
Table 2. Stability of PhoP and PhoP mutants by equilibrium GdnHCl denaturation Protein Wild-type PhoP PhoPN212A PhoPV213A PhoPE215A PhoPS216A PhoPY217A PhoPS219A PhoPY220A PhoPR222A PhoPR223A PhoPK224A
20 ΔGH (kcal/mol) u
1.8 ± 0.1 1.3 ± 0.2 1.9 ± 0.1 2.1 ± 0.3 1.4 ± 0.2 1.5 ± 0.1 0.9 ± 0.3 1.6 ± 0.1 1.1 ± 0.1 1.5 ± 0.1 1.6 ± 0.1
m (kcal/mol M) 1.1 ± 0.1 0.9 ± 0.2 1.0 ± 0.2 1.4 ± 0.1 0.9 ± 0.1 1.1 ± 0.1 0.5 ± 0.2 1.0 ± 0.1 0.8 ± 0.3 0.8 ± 0.1 0.9 ± 0.1
Equilibrium denaturation experiments of PhoP and PhoP mutants by GdnHCl were performed at 25 °C in 50 mM Hepes–Na+ (pH 7.20), 100 mM NaCl, and 10% (v/v) glycerol. Unfolding due to increasing GdnHCl concentration was followed by changes in CD ellipticity at 220 nm. Experiments were carried out in a Jasco J-810 spectropolarimeter with 2.5 μM wild-type or mutant proteins; the denaturant starting solution contained 8 M GdnHCl (Pierce). The results for free energy of denaturation in the absence 20 of GdnHCl (ΔGH u ) and the change in free energy with GdnHCl (m) obtained from multiple experiments are listed. Values and standard deviations are shown as results of a simultaneous fit to multiple experiments.
constant values of PhoPE215A for DR1,2 DNA (K d = 1.7 ± 0.15 μM) and NSP DNA (K d = 3.8 ± 0.2 μM). Note that under identical conditions, wildtype PhoP binds to DR1,2 DNA with a Kd of 2.1 ± 0.15 μM. From these results, we conclude that Glu215 of the α8 recognition helix of M. tuberculosis PhoP is an important residue that critically contributes to DNA recognition specificity of the regulator. To determine the contributions of Glu215 to specific and nonspecific DNA binding, unlabeled DR1,2 DNA (as specific competitor) and herring sperm DNA (as nonspecific competitor) were used to compete for binding of wild-type PhoP or the PhoPE215A mutant to radiolabeled DR1,2 DNA. Figure 3b clearly shows that herring-sperm DNA competes relatively poorly for wild-type PhoP binding compared to unlabeled DR1,2 DNA. In contrast, both specific and nonspecific DNA compete for PhoPE215A binding to DR1,2 with comparable efficiency (Fig. 3c). Thus, substitution of Glu215 with Ala dramatically reduces the ability of PhoP to discriminate between specific DR1,2 and nonspecific DNA, thereby playing an important role in determining DNA binding specificity.
DNA Binding Specificity of M. tuberculosis PhoP
Fig. 2. DNA binding by Ala mutants of PhoP. PhoP and PhoP mutants were examined for their DNA binding affinity by EMSA using 20 nM end-labeled oligonucleotide-based DR1,2. Assay buffer contained 20 mM Hepes– Na+ (pH 7.5), 50 mM NaCl, bovine serum albumin (0.20 mg/ml), 10% glycerol, and 1 mM dithiothreitol. Increasing concentrations of PhoP proteins were incubated for 10 min at 20 °C with labeled probe in a 20 -μl binding mix. Bound and free DNA were separated by electrophoresis on a nondenaturing 7% polyacrylamide gel in Tris– EDTA (ethylenediaminetetraacetic acid) buffer. Following electrophoresis and gel drying, radioactive bands were quantified with a PhosphorImager (Fuji, Japan). Data were converted to fraction of labeled DNA bound as a function of protein concentration. Open arrows indicate origins of the native polyacrylamide gel, and filled arrows indicate band shifts produced in the presence of PhoP. The gels are representative of at least three independent experiments. The 60-bp oligonucleotide-based DR1,2 DNA (PAGEpurified, Sigma) comprising two 9-bp direct repeat sites were used to assess sequence-specific DNA binding by PhoP or its variants. This sequence of the phoP upstream region is within the PhoP-protected DNaseI footprint.8,13,17 The target binding sites in each set of oligonucleotides were flanked by matching nonspecific sequences, chosen to avoid fortuitous binding. 5′-32P labeling of oligonucleotide probes were carried out with T4 polynucleotide kinase and [γ-32P]ATP. Unincorporated nucleotides and labeled oligonucleotide were separated with a SephadexG50 quick spin column (GE Healthcare). DNA probes for EMSA were generated by annealing the labeled strand to its unlabeled complement in 10 mM Tris (pH 8.0) containing 50 mM NaCl following slow cooling to room temperature after heating to 95 °C for 5 min. Annealing efficiency was verified by native PAGE.
651 Structural data from two members of the PhoP family of response regulators, DrrD18 and DrrB,19 indicate that in the unphosphorylated state the recognition helix is freely exposed to the solvent, which would make it available for DNA binding. In agreement with these findings, the crystal structure of PhoPC suggests that side chains of residues Asn212, Val213, Glu215, Ser216, Tyr217, Ser219, Tyr220, Arg222, Arg223, and Lys224 of the recognition helix (α8) are solvent-exposed and likely to participate in DNA binding and/or recognition.14 According to the results of the mutagenesis study, the majority of the PhoP mutants exhibited substantially reduced DNA binding affinity. The importance of solvent-exposed residues of α8 in DNA binding is consistent with the proposed model, where DNA recognition involves insertion of α8 into the major groove of DNA.14 However, as seen above, most of the Ala substitutions have little effect on protein stability (Table 2). This is in agreement with the PhoPC structure, since the side chains of the amino acid residues of α8 that participate as DNA contacting residues are largely solvent-exposed and, therefore, do not contribute significantly to the overall stability of the protein. Thus, we could not find an apparent correlation between the protein stability and DNA binding affinity. As an example, both mutant PhoPV213A and PhoPY222A exhibited strongly reduced DR1,2 binding affinity with no detectable complex formation (lanes 5–7, Fig. 2a, and lanes 11–13, Fig. 2b, respectively), yet the former displays wild-type PhoP-like stability, while the latter has a reduced stability by 0.7 kcal/mol compared to that of the wild-type protein (Table 2). Thus, the reduced DNA binding affinity is not attributable to protein destabilization by the mutations that render the protein compromised for DNA binding. Specificity change correlates with the ability of PhoP residue Glu215 to participate in a base-specific interaction with (G/C)9 of the DR1 repeat motif A previous structural analysis suggests that PhoPC is similar to the DNA-binding domain of E. coli PhoB (PhoBC) in the structure of the core, transactivation loop, wing, and surface electrostatic potentials,14 suggesting that it is likely to bind DNA in a similar way to the E. coli PhoBC.20 To examine the location of Glu215 in the DNA–protein interface, we generated the PhoPC–DNA complex by superposing the PhoPC monomer (PDB ID 2PMU) and modeled B-DNA onto the E. coli PhoBC–DNA complex (PDB ID 1GXP) (Fig. 4). The r.m.s.d. for the superposition of 89 Cα atoms of PhoPC onto the PhoBC monomer is about 1.36 Å, suggesting that the binding of DNA does not cause a drastic conformational change of the protein. The superposition of the modeled PhoPC-DNA complex onto the crystal structure of PhoBC-DNA complex is shown in Supplementary Fig. 1. Interestingly, in the structural model, the side chain of Glu215 appears to be closest (4.3 Å) to the
652
Fig. 3. Nonspecific DNA binding by Ala mutants of PhoP. (a) The mutant proteins at indicated concentrations were examined for their DNA-binding ability by EMSA with end-labeled NSP (≈ 20 nM) DNA probe. The reaction condition was as described in the legend to Fig. 2. Protein– DNA complexes were visualized by autoradiography. (b and c) Competition of unlabeled specific (filled circles) and nonspecific (open circles) DNA for (b) wild-type PhoP and (c) PhoPE215A binding to 32P-labeled DR1,2 DNA. Competition was assayed by the reduction in binding of protein to the labeled DNA in EMSA experiments and each point is an average of two independent experiments.
G 9 residue of the DR1 repeat (Fig. 4c). This observation suggests that the exposed side chain of Glu215 of α8 is capable of interacting with DNA. This is in agreement with the PhoPC structure where Glu215 of the α8 recognition helix has been suggested as one of the residues likely to participate in DNA–protein interaction.14 Likewise, the structural model shows that the side chain of Glu215 of the second PhoPC molecule was most proximal to C5′ (5.1 Å) of the DR2 repeat motif (Fig. 4d). From these results, we suggest that the side chain of Glu215 is likely to be involved in base-specific contacts with (G/C)9 of the DR1 repeat motif and/ or (C/G)5 of the DR2 repeat motif, respectively. We next examined the contribution of (C/G)9 of the DR1 repeat motif in determining DNA recognition specificity by M. tuberculosis PhoP. To this effect,
DNA Binding Specificity of M. tuberculosis PhoP
oligonucleotide was synthesized where (C/G)9 was modified to (A/T)9 in DR1, leaving the rest of the DR1,2 sequence unaltered, and used in binding assays with wild-type PhoP. To examine the specificity of DNA recognition, PhoP binding to DR1,2 and to mutant substrate were compared both in the absence or in the presence of herring sperm DNA (50 μg/ml) as a nonspecific competitor (Fig. 5). In the absence of nonspecific herring sperm DNA, substitution of C9 with A9 in DR1 showed 1.45 ± 0.14-fold lower efficiency of DNA binding by PhoP (compare lanes 2–4 and lanes 6–8, Fig. 5a). On the contrary, a striking inhibition of PhoP binding was observed with the mutant DNA compared to the wild-type DR1,2 site when the binding mix contained herring sperm DNA (50 μg/ml; compare lanes 2–4 and lanes 6–8, Fig. 5b). Clearly, PhoP binding to DR1(C9A)DR2 is inhibited by 3.5- to 5-fold in the presence of herring-sperm DNA. However, under identical conditions, PhoP at the highest protein concentration examined (4 μM) exhibited 56 ± 1% and 51.5 ± 0.8% of DR1,2 binding in the absence or presence of herring sperm DNA, respectively, suggesting a 1.2 ± 0.1-fold difference in the extent of binding. As control experiments, under the conditions examined, substitution of C2 of DR1 by A2 (Fig. 5c) or C9 of DR2 by A9 (Fig. 5d) of DR1,2 DNA did not display any significant change in PhoP binding efficiency in the absence or presence of herring sperm DNA. Quantification of the binding data shows 1.2 ± 0.2- and 1.3 ± 0.4-fold difference in PhoP binding efficiency to DR1(C2A)DR2 and DR1DR2(C9A), respectively, in the absence or presence of herring sperm DNA (50 μg/ml). Thus, the (G/C)9 of DR1 repeat motif appears to contribute to sequence-specific PhoP–DNA interactions. However, substitution of G5 of DR2 by T5 (Fig. 5e) did not reveal any significant difference in PhoP binding efficiency in the absence (lanes 2–4) or presence (lanes 5–7) of herring sperm DNA. As expected, PhoPE215A binding of the mutant DNA substrate is almost comparable to that of wild-type PhoP in the absence of nonspecific competitor DNA. However, we observed a strong ≈ 3.5-fold inhibition of binding when nonspecific herring sperm DNA was included in the binding mix (data not shown). Although we have previously shown that the conserved adenines (A1 of DR1 and A7 of DR2) are important for forming a PhoP–DNA complex stable to gel electrophoresis,13 here we demonstrate the importance of a single base pair [(G/C)9 base-pair of DR1] in determining DNA recognition specificity of the regulator. The observation that substitution of Glu215 to Ala has a significant effect on sequence-specific DNA binding (Fig. 3) led us to speculate that basespecific contacts with the side chain of Glu215 are possibly involved in PhoP–DNA interactions leading to PhoP's DNA recognition specificity. In agreement with this proposal, (G/C)9 of the DR1 repeat motif was found to be proximal to the solvent-exposed Glu215 in the PhoPC–DNA structural model (Fig. 4). Finally, a single substitution at
DNA Binding Specificity of M. tuberculosis PhoP
653
Fig. 4. Modeled PhoPC–DNA complex. (a) Sequence of the 23-bp core binding region comprising two direct repeat motifs DR1 and DR2 (sequence noted in uppercase letters) with 5-bp intervening spacer region (sequence noted in lowercase letters). The nucleotides in both repeat motifs are numbered from 5′ to 3′ (at the bottom), and the nucleotides conserved in both repeat motifs are indicated by gray shadings. (b) The model of PhoPC–DNA complex was generated first by superposing the monomer of PhoPC (PDB ID 2PMU) onto each monomer of PhoBC of E. coli (PDB ID 1GXP) to form a dimer with the LSQMAN21 program. The Cα tracing for each monomer is represented as cartoon diagram shown in blue and green. Subsequently the B-DNA model for the DR1–DR2 sequence was generated using the server at http:// hydra.icgeb.trieste.it/dna/ and superposed on the DNA bound to the PhoBC domain of E. coli (PDB ID 1GXP). The superposed dimer on the modeled DNA structure for M. tuberculosis PhoPC–DNA complex was used for further analysis. The molecular image was generated using PYMOL.22 (c) Enlarged view of the interface between the E215 side chain of PhoP with G9 of the DR1 sequence in one monomer; (d) close-up view of interaction between the E215 side chain of the other monomer with C5′ of the DR2 sequence. Broken lines indicate proposed interactions between Glu215 of PhoP and color-coded bases of DR1 (c) and DR2 (d), respectively.
(G/C)9 of the DR1 repeat motif has been shown to strongly influence sequence-specific DNA recognition of PhoP. The fact that G5 of DR2 sequence does
not appear to influence sequence-specific PhoP– DR1,2 interaction suggests that DR1 is the primary site of interaction which contributes to DNA-
654
DNA Binding Specificity of M. tuberculosis PhoP
Fig. 5. Role of (G/C)9 of the DR1 repeat motif in sequence-specific PhoP–DNA interactions. EMSA of end-labeled DNA probes with indicated concentrations of PhoP using wild-type DR1,2 DNA (lanes 2–4) or duplexes carrying substitutions at the C9 of the DR1 motif (lanes 6–8) either in the absence (a) or in the presence (b) of herring sperm DNA (50 μg/ml). For experiments shown in (c) to (e), PhoP binding at indicated concentrations to duplex DNA probes carrying substitutions at the C2 of the DR1 motif (c), C9 of the DR2 motif (d), and G5 of the DR2 motif (e) of DR1,2 both in the absence (lanes 2–4) or in the presence of herring sperm DNA [lanes 6–8, (c) and (d); lanes 5–7 (e)], respectively. Directrepeat specific substitutions in the top strand are indicated above each panel. Protein–DNA complexes were analyzed as described in the legend to Fig. 2.
recognition specificity of PhoP. This is in agreement with our previous data suggesting that recruitment of two PhoP protomers occurs only on DNA such that binding of a PhoP molecule to the DR1 site assists the binding of a second PhoP molecule to the DR2 site.23 Together, these results suggest that base-specific interaction involving Glu215 of PhoP α8-helix and the (G/C) 9 of DR1 is critically important in determining DNA recognition specificity of the regulator. Protein–nucleic acid recognition plays a critical role in the mechanisms that regulate transcription of DNA. Extensive biochemical and structural studies have established that the vast majority of the sequence-specific DNA binding proteins interact with their cognate binding sites through autonomously folded domains, which in many cases insert an α-helix into the major groove of the target DNA. Although structure of M. tuberculosis PhoP DNA
binding domain has been determined and the structural basis of DNA recognition is established, DNA–protein interfaces have not been studied to ascertain the determinants that govern the affinity and specificity of binding. Thus, biochemical studies are required to decipher the origins of binding affinity and specificity. To this effect, structureguided mutations were introduced in PhoPC, and major base-specific interactions governing DNA binding specificity of the protein were identified by structural superposition of PhoPC on the PhoB– DNA complex. Results reported here validate and expand upon the crystal structure and provide new insights into the DNA recognition specificity of PhoP that is not available from the structural data alone. Given the effect of Glu215 mutation on the specificity of DNA binding but not on the affinity of interaction (compare lanes 8–10, Fig. 2a, and lanes
655
DNA Binding Specificity of M. tuberculosis PhoP
5–7, Fig. 3), it is likely that Glu215 of α8 helix participates in base-specific contacts. This prediction was strengthened by structural superposition of PhoPC on the PhoBC–DNA complex14 to identify a likely interaction that contributes to recognition specificity. We provide evidence suggesting that the side chain of Glu215 likely participates in a basespecific contact with the ninth guanine (G9) residue of the DR1 repeat (Fig. 4), which is critically required for PhoP–DNA sequence-specific interactions (Fig. 5). Together, these results demonstrate that Glu215 contributes preferentially within the context of sequence-specific recognition. Most of the other Ala substitutions, however, were for positively charged Lys or Arg residues. These residues are capable of forming energetically favorable, but nonspecific electrostatic interactions, with the phosphate moieties of the DNA backbone. In the PhoPC structure, the conserved Arg222 has been predicted to interact with the DNA phosphate backbone.14 Structural superposition of PhoPC on the PhoBC– DNA complex also indicates that the side chain of Arg223 is analogous to the side chain of Arg200 of the DNA binding domain of PhoB, the E. coli orthologue of M. tuberculosis PhoP, and this residue might be interacting with a phosphate.14 According to the structural alignment, the side chain of Lys224 is also capable of interacting with the backbone atoms of DNA. Since none of the Ala mutants replacing the basic amino acids exhibited any detectable DNA binding under our experimental condition, our results are consistent with the previously proposed DNA binding mechanism of PhoP.14 However, whether these amino acid side chains contribute to binding in a nonspecific fashion (e.g., with the DNA backbone) or via direct basespecific contacts remains to be determined. The contribution of presumably nonspecific backbone contacts to DNA binding specificity has been reported previously.24 However, our present data do not rule out the possible involvement of any other amino acid–base interaction that could be important to determining DNA recognition specificity. In addition to forming direct contacts with the DNA, it is possible that additional hydrogenbonding networks involving side chains of the DNA contacting residues orient the side chains for optimal DNA contact, and thereby contribute to DNA recognition. In conclusion, our results identify a novel basespecific interaction of PhoP with its cognate DNA, which provides new insights into the substrate specificity of the important regulator. Whereas the structural data of the PhoP DNA binding domain could only predict some of the amino acids of α8 as the likely residues conferring affinity and/or sequence specificity, results reported here identify amino acid residues of α8 that contribute to PhoP's DNA binding affinity and highlight Glu215 as a single critical residue that appears to establish a basespecific contact with the ninth residue of the DR1 motif to contribute to DNA recognition specificity of the regulator.
Acknowledgements The authors thank Sharanjeet Kaur and Dr. Purnananda Guptasarma for CD studies, Renu Sharma and Mahendra Yadav for excellent technical assistance, and Renu Sharma for her help with the preparation of the manuscript. This work was supported, in part, by CSIR (Network Project NWP-5 and Supra Institutional Project SIP-10) and by research grants (to D.S.) from the Department of Science and Technology (SR/SO/BB-16/2007) and Department of Biotechnology (BT/PR8545/Med/ 14/1262/2006), Government of India. A.D., A.P., and M.D. are predoctoral students supported by research fellowships from CSIR. A.S. is supported by CSIR Network Project NWP-5.
Supplementary Data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/ j.jmb.2010.03.056
References 1. Fontan, P. A., Walters, S. & Smith, I. (2004). Cellular signaling pathways and transcriptional regulation in Mycobacterium tuberculosis: stress control and virulence. Curr. Sci. 86, 122–134. 2. Av-Gay, Y. & Deretic, V. (2005). Two-component systems, protein kinases, and signal transduction in Mycobacterium tuberculosis. In Tuberculosis and the Tubercle Bacillus (Cole, S. T., ed.), pp. 359–367, ASM Press, Washingon, DC. 3. Perez, E., Samper, S., Bordas, Y., Guilhot, C., Gicquel, B. & Martin, C. (2001). An essential role for phoP in Mycobacterium tuberculosis virulence. Mol. Microbiol. 41, 179–187. 4. Soto, C. Y., Menendez, M. C., Perez, E., Samper, S., Gomaz, A. B., Garcia, N. J. & Martin, C. (2004). IS6110 mediates increased transcription of the phoP virulence gene in a multi drug-resistant clinical isolate responsible for tuberculosis outbreaks. J. Clin. Microbiol. 42, 212–219. 5. Walters, S. B., Dubnau, E., Kolesnikova, I., Laval, F., Daffe, M. & Smith, I. (2006). The Mycobacterium tuberculosis PhoPR two-component system regulates genes essential for virulence and complex lipid biosynthesis. Mol. Microbiol. 60, 312–330. 6. Gonzalo-Asensio, J., Maia, C., Ferrer, N. L., Barilone, N., Larval, F., Soto, C. Y. et al. (2006). The virulenceassociated two-component PhoP-PhoR system controls the biosynthesis of polyketide-derived lipids in Mycobacterium tuberculosis. J. Biol. Chem. 281, 1313–1316. 7. Gonzalo-Asensio, J., Mostowy, S., Harders-Westerveen, J., Huygen, K. et al. (2008). PhoP: a missing piece in the intricate puzzle of Mycobacterium tuberculosis virulence. PloS ONE, 3, e3496. 8. Gonzalo-Asensio, J., Soto, C. Y., Arbues, A., Sancho, J, del Carmen Menéndez, M, García, M. J. et al. (2008). M. tuberculosis phoPR operon is positively autoregulated in the virulent strain H37Rv. J. Bacteriol. 190, 7068–7078.
656 9. Frigui, W., Bottai, D., Majlessi, L., Monot, M., Josselin, E., Brodin, P. et al. (2008). Control of M. tuberculosis ESAT-6 secretion and specific T cell recognition by PhoP. PLoS Pathog. 4, e33. 10. Ryndak, M., Wang, S. & Smith, I. (2008). PhoP, a key player in Mycobacterium tuberculosis virulence. Trends Microbiol. 11, 528–534. 11. Lee, J. S., Krause, R., Schreiber, J., Mollenkopf, H. J., Kowall, J., Stein, R. et al. (2008). Mutation in the transcriptional regulator PhoP contributes to avirulence of Mycobacterium tuberculosis H37Ra strain. Cell Host Microbe, 3, 97–103. 12. Chesne-Seck, M. L., Barilone, N., Boudou, F., Gonzalo Asensio, J. G., Kolattukudy, P. E., Martin, C. et al. (2007). A point mutation in the two-component regulator PhoP-PhoR accounts for the absence of polyketide-derived acyltrehaloses but not that of phthiocerol dimycocerosates in Mycobacterium tuberculosis H37Ra. J. Bacteriol. 190, 1329–1334. 13. Gupta, S., Pathak, A., Sinha, A. & Sarkar, D. (2009). Mycobacterium tuberculosis PhoP recognizes two adjacent direct-repeat sequences to form head-to-head dimers. J. Bacteriol. 191, 7466–7476. 14. Wang, S., Engohang-Ndong, J. & Smith, I. (2007). Structure of the DNA-binding domain of the response regulator PhoP from Mycobacterium tuberculosis. Biochemistry, 46, 14751–14761. 15. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 16. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K. & Pease, L. R. (1989). Site directed mutagenesis by
DNA Binding Specificity of M. tuberculosis PhoP
17.
18.
19.
20.
21. 22. 23.
24.
overlap extension using the polymerase chain reaction. Gene, 77, 51–59. Gupta, S., Sinha, A. & Sarkar, D. (2006). Transcriptional autoregulation of Mycobacterium tuberculosis PhoP involves recognition of novel direct repeat sequences in the regulatory region of the promoter. FEBS Lett. 580, 5328–5338. Buckler, D. R., Zhou, Y. & Stock, A. M. (2002). Evidence of intradomain and interdomain flexibility in an OmpR/PhoB homolog from Thermotoga maritima. Structure, 10, 153–164. Robinson, V. L., Wu, T. & Stock, A. M. (2003). Structural analysis of the domain interface in DrrB, a response regulator of the OmpR/PhoB subfamily. J. Bacteriol. 185, 4186–4194. Blanco, A. G., Sola, M., Gomis-Ruth, F. X. & Coll, M. (2002). Tandem DNA recognition by PhoB, a twocomponent signal transduction transcriptional activator. Structure, 10, 701–713. Kleywegt, G. J. (1996). Use of non-crystallographic symmetry in protein structure refinement. Acta Crystallogr., Sect. D: Biol. Crystallogr. 52, 842–857. DeLano, W. L. (2002). The PyMOL User's Manual. DeLano Scientific, Palo Alto, CA. Sinha, A., Gupta, S., Bhutani, S., Pathak, A. & Sarkar, D. (2007). PhoP-PhoP interaction on adjacent PhoP binding sites is influenced by protein phosphorylation. J. Bacteriol. 190, 1317–1328. Schildbach, J. F., Karzai, A. W., Raumann, B. E. & Sauer, R. T. (1999). Origins of DNA-binding specificity: role of protein contacts with the DNA backbone. Proc. Natl Acad. Sci. USA, 96, 811–817.
J. Mol. Biol. (2010) 398, 647–656
Available online at www.sciencedirect.com
COMMUNICATION
A Single-Amino-Acid Substitution in the C Terminus of PhoP Determines DNA-Binding Specificity of the Virulence-Associated Response Regulator from Mycobacterium tuberculosis Arijit Kumar Das†, Anuj Pathak†, Akesh Sinha, Manish Datt, Balvinder Singh, Subramanian Karthikeyan and Dibyendu Sarkar⁎ Institute of Microbial Technology (CSIR), Sector-39A, Chandigarh-160036, India Received 19 December 2009; received in revised form 24 March 2010; accepted 27 March 2010 Available online 2 April 2010
The Mycobacterium tuberculosis PhoP–PhoR two-component system is essential for virulence in animal models of tuberculosis. Genetic and biochemical studies indicate that PhoP regulates the expression of more than 110 genes in M. tuberculosis. The C-terminal effector domain of PhoP exhibits a winged helix–turn–helix motif with the molecular surfaces around the recognition helix (α8) displaying strong positive electrostatic potential, suggesting its role in DNA binding and nucleotide sequence recognition. Here, the relative importance of interfacial α8–DNA contacts has been tested through rational mutagenesis coupled with in vitro bindingaffinity studies. Most PhoP mutants, each with a potential DNA contacting residue replaced with Ala, had significantly reduced DNA binding affinity. However, substitution of nonconserved Glu215 had a major effect on the specificity of recognition. Although lack of specificity does not necessarily correlate with gross change in the overall DNA binding properties of PhoP, structural superposition of the PhoP C-domain on the Escherichia coli PhoB C-domain–DNA complex suggests a base-specific interaction between Glu215 of PhoP and the ninth base of the DR1 repeat motif. Biochemical experiments corroborate these results, showing that DNA recognition specificity can be altered by as little as a single residue change of the protein or a single base change of the DNA. The results have implications for the mechanism of sequence-specific DNA binding by PhoP. © 2010 Elsevier Ltd. All rights reserved.
Edited by M. Yaniv
Keywords: direct repeats; DNA recognition specificity; M. tuberculosis PhoP; recognition helix; response regulator
Much of the reason for the success of Mycobacterium tuberculosis as an intracellular pathogen lies in its ability to adapt to its host environments through signal transduction leading to switching on of complex transcriptional programs. 1 It is now known that the major response of the bacterium to environmental changes is through classical two-
*Corresponding author. E-mail address: [email protected]. † A.D. and A.P. contributed equally to this work. Abbreviations used: EMSA, electrophoretic mobility shift assay; GdnHCL, guanidine hydrochloride.
component regulatory systems via histidine–aspartate phosphorelay between the sensor kinase and the response regulator.2 A number of recent studies revealed that PhoP of the PhoPR system controls a variety of functions including synthesis of complex pathogenic lipids, hypoxia response through DosR cross-talking, respiratory metabolism, secretion of the major T-cell antigen ESAT-6, and stress response3–9 (for a review, see Ref. 10 ). Further supporting the role of PhoP in regulation of M. tuberculosis virulence, two recent articles suggest that a point mutation in PhoP contributes to avirulence and also accounts for the absence of polyketide-derived acyltrehaloses in M. tuberculosis H37Ra.11,12
0022-2836/$ - see front matter © 2010 Elsevier Ltd. All rights reserved.
648 PhoP, a member of the OmpR/PhoB subfamily of response regulators, is composed of two functional domains, an N-terminal receiver domain (PhoPN) and a C-terminal effector domain (PhoPC), involved in DNA binding. The only reported interaction of PhoP from M. tuberculosis H37Rv involves binding of the regulator to its own promoter leading to autoregulation.8 This observation was extended to show that the primary interaction believed to promote autoregulation involves sequence-specific recognition of two PhoP protomers to the target DNA comprising a 9-bp direct repeat motif (present within the phoP promoter region).13 Moreover, biochemical evidences suggest head-to-head binding of two molecules of full-length PhoP monomers on a direct repeat motif projecting their N-termini toward one another.13 Although global gene expression profiling shows that 44 genes are up-regulated and another 70 genes are down-regulated by PhoP in M. tuberculosis,5 the origins of DNA binding affinity and sequence specificity of the regulator remain largely unknown. The crystal structure of PhoPC clearly shows that the primary DNA binding of the protein involves a winged helix–turn–helix motif14 [Protein Data Bank (PDB ID) 2PMU] and the surface around the PhoP residues that constitute the recognition helix (residues Asn212–Tyr224 of α8) display strong positive electrostatic potential, indicating that these residues are likely to be critical in DNA binding and nucleotide sequence recognition. To this end, we used structure-guided mutagenesis to obtain single alanine substitutions of 10 solvent-exposed residues spanning α8. Our results of rational mutagenesis coupled with a study of the DNA binding affinity of the α8–DNA interface in the complex formed by PhoP and its cognate DNA demonstrate that most PhoP mutants have significantly reduced DNA binding affinity while possessing near-wild-type stability. However, alanine substitution of Glu215 of α8 shows a major effect on the specificity of DNA recognition. Using structural insights coupled with biochemical analyses, we found that Glu215 of PhoP appears to establish a base-specific interaction with (G/C)9 of the upstream repeat motif (DR1 of DR1,2) to contribute significantly to the recognition specificity of the regulator. Amino acid mutagenesis of the PhoP–DNA interface To decipher the origins of binding affinity and sequence specificity, we set out to identify amino acid residues of α8 that are important for sequencespecific DNA binding of PhoP. The three-dimensional structure of M. tuberculosis PhoPC (residues 144–247) and the modeled structure of the PhoPC– DNA complex14 served as a guide for selection of amino acid residues to be mutated. Substitution sites of amino acid residues (as shown in Fig. 1a) with solvent-exposed side chains were selected, since these residues are expected to form base-specific
DNA Binding Specificity of M. tuberculosis PhoP
hydrogen bonds, ionic interactions, or van der Waals contacts with the DNA duplex and are therefore likely to contribute to the level of DNA binding affinity and recognition specificity. Wild-type and mutant PhoP proteins from M. tuberculosis H37Rv (Table 1) were purified as fusion proteins containing an N-terminal polyhistidine tag. To examine the effect of Ala substitution of PhoP on the overall structure and/or fold, mutant proteins were compared for their stability. To this effect, equilibrium denaturation of PhoP and PhoP mutants by guanidine hydrochloride (GdnHCl) was monitored by change in CD ellipticity at 220 nm. Expectedly, both wild-type and mutant proteins underwent loss of structure (native to denatured) with increasing GdnHCl concentration. The values for free energy of denaturation in the absence of GdnHCl (ΔGuH20) and the change in free energy with GdnHCl (m) obtained from multiple denaturation experiments are listed in Table 2. Eight of the 10 mutants have ΔGuH20 values within ± 0.5 kcal/mol of wild-type PhoP. Of the other two mutants, PhoPS219A and PhoPR222A showed a reduction in stability of 0.9 and 0.7 kcal/mol, respectively, compared to the wild-type protein. We next investigated DNA binding of purified wild-type and mutant proteins by electrophoretic mobility shift assay (EMSA) using an oligonucleotide-based DR1,2 probe consisting of two direct repeat units (DR1 and DR2). To this effect, His tags were cleaved using Thrombin Clean Cleavage kit from Sigma. When incubated with end-labeled DR1,2 DNA, the majority of the point mutants (7 out of 10) under the conditions examined showed at least 10-fold reduced DNA binding affinity (based on the limits of detection in this assay and based on other gels; not shown) (Fig. 2). However, PhoPE215A (lanes 8–10, Fig. 2a), PhoPS216A (lanes 11–13, Fig. 2a), and PhoPY217A (lanes 2–4, Fig. 2b) formed a single retarded band stable to gel electrophoresis. As reference, wild-type PhoP at identical protein concentrations bound efficiently to the end-labeled DR1,2 probe (lanes 8–10, Fig. 2c). It should be noted that over a range of protein concentrations, the three mutant proteins (PhoPE215A, PhoPS216A, and PhoPY217A) showed wild-type PhoP-like DNA-binding properties with comparable affinity. From these results, we conclude that (i) most of the amino acid residues of the PhoP recognition helix with exposed side chains (residues Asn212, Val213, Ser219, Tyr220, Tyr222, Tyr223, and Lys224) are critical affinity determinants for PhoP–DNA interactions, and (ii) residues Glu215, Ser216, and Tyr217 do not appear to have any significant role in determining the DNA binding affinity of M. tuberculosis PhoP. Specificity changes when PhoP residue Glu215 is substituted To ascertain whether amino acids 215–217 contribute to the specificity of DNA recognition, the binding of PhoP and the three mutant proteins
DNA Binding Specificity of M. tuberculosis PhoP
649
Fig. 1. Rational mutagenesis of the PhoP–DNA complex. (a) Amino acid residues of the recognition helix (α8) of PhoPC14 (residues 144–247; PDB ID 2PMU) that were mutated are labeled. These residues are solvent-exposed and are therefore expected to contribute to the level of DNA binding affinity and/or specificity. (b) Ten PhoP mutants each having a single potential α8 helix DNA contacting residue replaced with Ala were expressed in E. coli BL21(DE3), purified using immobilized metal-affinity [NiNTA (nitrilotriacetic acid), Qiagen] chromatography as described previously, 13 and analyzed by SDS-PAGE (2 μg per lane) followed by Coomassie blue staining. Lane 1, molecular mass markers in kilodaltons. The purity of the protein preparation was ≥95% as judged by SDS-PAGE. Protein concentration was determined by the bicinchoninic acid (BCA) protein assay (Pierce) with bovine serum albumin as standard.
PhoPE215A, PhoPS216A, and PhoPY217A to a nonspecific DNA probe was examined by EMSA using an end-labeled nonspecific DNA (hereinafter referred to as NSP, sequence as described previously13). NSP represents a heterologous nonbinding sequence that lacks a consensus PhoP binding site but has comparable base composition. In agreement with our previous report on specific DNA binding by PhoP,13 wild-type PhoP (lanes 2–4, Fig. 3a) as well as the two mutants PhoPS216A (lanes 8–10) and PhoPY217A (lanes 11–13) failed to generate a complex stable to gel electrophoresis even
at the highest protein concentrations examined (based on the limits of detection in this assay). In sharp contrast, at identical conditions PhoPE215A (lanes 5–7) bound efficiently to end-labeled NSP to form a retarded complex stable to gel electrophoresis. Clearly, these results demonstrate that PhoPE215A shares comparable DNA binding affinity with either DR1,2 or NSP DNA (compare lanes 8–10, Fig. 2a, and lanes 5–7, Fig. 3). In agreement with these results, while PhoP failed to show any detectable DNA binding with end-labeled NSP DNA (Fig. 3a), there is only ≈ 2.2-fold difference in dissociation
650
DNA Binding Specificity of M. tuberculosis PhoP
Table 1. Primes and plasmids used in this work Primersa FPN212A RPN212A FPV213A RPV213A FPE215A RPE215A FPS216A RPS216A FPY217A RPY217A FPS219A RPS219A FPY220A RPY220A FPR222A RPR222A FPR223A RPR223A FPK224A RPK224A Plasmids pET-phoP pET-PhoPN212A pET-PhoPV213A pET-PhoPE215A pET-PhoPS216A pET-PhoPY217A pET-PhoPS219A pET-PhoPY220A pET-PhoPR222A pET-PhoPR223A pET-PhoPK224A
Sequence (5′–3′) or description
Reference
GGTGGTGATGTCGCTGTCGTCGAG CTCGACGACAGCGACATCACCACC GGTGATGTCAACGCTGTCGAGTCC GGACTCGACAGCGTTGACATCACC AACGTCGTCGCCTCCTACGTGTCG CGACACGTAGGAGGCGACGACGTT AACGTCGTCGAGGCTTACGTGTCG CGACACGTAAGCCTCGACGACGTT GTCGTCGAGTCCGCTGTGTCGTAT ATACGACACAGCGGACTCGACGAC GAGTCCTACGTGGCTTATCTGCGC GCGCAGATAAGCCACGTAGGACTC TCCTACGTGTCTGCTCTGCGCCGC GCGGCGCAGAGCAGACCGTAGGA TCGTATCTGGCCCGCAAGATCGAC GTCGATCTTGCGGGCCAGATACGA TATCTGCGCTCAAAGATCGACACT AGTGTCGATCTTTGAGCGCAGATA CTGCGCCGCGCCATCGACACTGGG CCCAGTGTCGATGGCGCGGCGCAG
This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study
PhoP residues 1–247 cloned in pET15b Asn212 codon mutated to Ala in pET-phoP Val213 codon mutated to Ala in pET-phoP Glu215 codon mutated to Ala in pET-phoP Ser216 codon mutated to Ala in pET-phoP Tyr217 codon mutated to Ala in pET-phoP Ser219 codon mutated to Ala in pET-phoP Tyr220 codon mutated to Ala in pET-phoP Arg222 codon mutated to Ala in pET-phoP Arg223 codon mutated to Ala in pET-phoP Lys224 codon mutated to Ala in pET-phoP
This study This study This study This study This study This study This study This study This study This study
13
All enzymatic manipulations of DNA were performed with standard procedures.15 Site-directed mutagenesis of individual PhoP residues was carried out in the phoP gene of pET-phoP by PCR-based two-stage overlap extension method16 using complementary oligonucleotides with the mutated codon and Deep Vent DNA polymerase (New England Biolabs). Plasmid DNA isolation, recovery, and purification of DNA fragments or PCR products were carried out with Qiagen spin columns and procedures (Qiagen, Germany). All mutants were verified by DNA sequence analysis to confirm the presence of the desired mutation and the absence of any unintentional mutations. E. coli DH5α was used for all cloning procedures. a FP, forward primer; RP, reverse primer.
Table 2. Stability of PhoP and PhoP mutants by equilibrium GdnHCl denaturation Protein Wild-type PhoP PhoPN212A PhoPV213A PhoPE215A PhoPS216A PhoPY217A PhoPS219A PhoPY220A PhoPR222A PhoPR223A PhoPK224A
20 ΔGH (kcal/mol) u
1.8 ± 0.1 1.3 ± 0.2 1.9 ± 0.1 2.1 ± 0.3 1.4 ± 0.2 1.5 ± 0.1 0.9 ± 0.3 1.6 ± 0.1 1.1 ± 0.1 1.5 ± 0.1 1.6 ± 0.1
m (kcal/mol M) 1.1 ± 0.1 0.9 ± 0.2 1.0 ± 0.2 1.4 ± 0.1 0.9 ± 0.1 1.1 ± 0.1 0.5 ± 0.2 1.0 ± 0.1 0.8 ± 0.3 0.8 ± 0.1 0.9 ± 0.1
Equilibrium denaturation experiments of PhoP and PhoP mutants by GdnHCl were performed at 25 °C in 50 mM Hepes–Na+ (pH 7.20), 100 mM NaCl, and 10% (v/v) glycerol. Unfolding due to increasing GdnHCl concentration was followed by changes in CD ellipticity at 220 nm. Experiments were carried out in a Jasco J-810 spectropolarimeter with 2.5 μM wild-type or mutant proteins; the denaturant starting solution contained 8 M GdnHCl (Pierce). The results for free energy of denaturation in the absence 20 of GdnHCl (ΔGH u ) and the change in free energy with GdnHCl (m) obtained from multiple experiments are listed. Values and standard deviations are shown as results of a simultaneous fit to multiple experiments.
constant values of PhoPE215A for DR1,2 DNA (K d = 1.7 ± 0.15 μM) and NSP DNA (K d = 3.8 ± 0.2 μM). Note that under identical conditions, wildtype PhoP binds to DR1,2 DNA with a Kd of 2.1 ± 0.15 μM. From these results, we conclude that Glu215 of the α8 recognition helix of M. tuberculosis PhoP is an important residue that critically contributes to DNA recognition specificity of the regulator. To determine the contributions of Glu215 to specific and nonspecific DNA binding, unlabeled DR1,2 DNA (as specific competitor) and herring sperm DNA (as nonspecific competitor) were used to compete for binding of wild-type PhoP or the PhoPE215A mutant to radiolabeled DR1,2 DNA. Figure 3b clearly shows that herring-sperm DNA competes relatively poorly for wild-type PhoP binding compared to unlabeled DR1,2 DNA. In contrast, both specific and nonspecific DNA compete for PhoPE215A binding to DR1,2 with comparable efficiency (Fig. 3c). Thus, substitution of Glu215 with Ala dramatically reduces the ability of PhoP to discriminate between specific DR1,2 and nonspecific DNA, thereby playing an important role in determining DNA binding specificity.
DNA Binding Specificity of M. tuberculosis PhoP
Fig. 2. DNA binding by Ala mutants of PhoP. PhoP and PhoP mutants were examined for their DNA binding affinity by EMSA using 20 nM end-labeled oligonucleotide-based DR1,2. Assay buffer contained 20 mM Hepes– Na+ (pH 7.5), 50 mM NaCl, bovine serum albumin (0.20 mg/ml), 10% glycerol, and 1 mM dithiothreitol. Increasing concentrations of PhoP proteins were incubated for 10 min at 20 °C with labeled probe in a 20 -μl binding mix. Bound and free DNA were separated by electrophoresis on a nondenaturing 7% polyacrylamide gel in Tris– EDTA (ethylenediaminetetraacetic acid) buffer. Following electrophoresis and gel drying, radioactive bands were quantified with a PhosphorImager (Fuji, Japan). Data were converted to fraction of labeled DNA bound as a function of protein concentration. Open arrows indicate origins of the native polyacrylamide gel, and filled arrows indicate band shifts produced in the presence of PhoP. The gels are representative of at least three independent experiments. The 60-bp oligonucleotide-based DR1,2 DNA (PAGEpurified, Sigma) comprising two 9-bp direct repeat sites were used to assess sequence-specific DNA binding by PhoP or its variants. This sequence of the phoP upstream region is within the PhoP-protected DNaseI footprint.8,13,17 The target binding sites in each set of oligonucleotides were flanked by matching nonspecific sequences, chosen to avoid fortuitous binding. 5′-32P labeling of oligonucleotide probes were carried out with T4 polynucleotide kinase and [γ-32P]ATP. Unincorporated nucleotides and labeled oligonucleotide were separated with a SephadexG50 quick spin column (GE Healthcare). DNA probes for EMSA were generated by annealing the labeled strand to its unlabeled complement in 10 mM Tris (pH 8.0) containing 50 mM NaCl following slow cooling to room temperature after heating to 95 °C for 5 min. Annealing efficiency was verified by native PAGE.
651 Structural data from two members of the PhoP family of response regulators, DrrD18 and DrrB,19 indicate that in the unphosphorylated state the recognition helix is freely exposed to the solvent, which would make it available for DNA binding. In agreement with these findings, the crystal structure of PhoPC suggests that side chains of residues Asn212, Val213, Glu215, Ser216, Tyr217, Ser219, Tyr220, Arg222, Arg223, and Lys224 of the recognition helix (α8) are solvent-exposed and likely to participate in DNA binding and/or recognition.14 According to the results of the mutagenesis study, the majority of the PhoP mutants exhibited substantially reduced DNA binding affinity. The importance of solvent-exposed residues of α8 in DNA binding is consistent with the proposed model, where DNA recognition involves insertion of α8 into the major groove of DNA.14 However, as seen above, most of the Ala substitutions have little effect on protein stability (Table 2). This is in agreement with the PhoPC structure, since the side chains of the amino acid residues of α8 that participate as DNA contacting residues are largely solvent-exposed and, therefore, do not contribute significantly to the overall stability of the protein. Thus, we could not find an apparent correlation between the protein stability and DNA binding affinity. As an example, both mutant PhoPV213A and PhoPY222A exhibited strongly reduced DR1,2 binding affinity with no detectable complex formation (lanes 5–7, Fig. 2a, and lanes 11–13, Fig. 2b, respectively), yet the former displays wild-type PhoP-like stability, while the latter has a reduced stability by 0.7 kcal/mol compared to that of the wild-type protein (Table 2). Thus, the reduced DNA binding affinity is not attributable to protein destabilization by the mutations that render the protein compromised for DNA binding. Specificity change correlates with the ability of PhoP residue Glu215 to participate in a base-specific interaction with (G/C)9 of the DR1 repeat motif A previous structural analysis suggests that PhoPC is similar to the DNA-binding domain of E. coli PhoB (PhoBC) in the structure of the core, transactivation loop, wing, and surface electrostatic potentials,14 suggesting that it is likely to bind DNA in a similar way to the E. coli PhoBC.20 To examine the location of Glu215 in the DNA–protein interface, we generated the PhoPC–DNA complex by superposing the PhoPC monomer (PDB ID 2PMU) and modeled B-DNA onto the E. coli PhoBC–DNA complex (PDB ID 1GXP) (Fig. 4). The r.m.s.d. for the superposition of 89 Cα atoms of PhoPC onto the PhoBC monomer is about 1.36 Å, suggesting that the binding of DNA does not cause a drastic conformational change of the protein. The superposition of the modeled PhoPC-DNA complex onto the crystal structure of PhoBC-DNA complex is shown in Supplementary Fig. 1. Interestingly, in the structural model, the side chain of Glu215 appears to be closest (4.3 Å) to the
652
Fig. 3. Nonspecific DNA binding by Ala mutants of PhoP. (a) The mutant proteins at indicated concentrations were examined for their DNA-binding ability by EMSA with end-labeled NSP (≈ 20 nM) DNA probe. The reaction condition was as described in the legend to Fig. 2. Protein– DNA complexes were visualized by autoradiography. (b and c) Competition of unlabeled specific (filled circles) and nonspecific (open circles) DNA for (b) wild-type PhoP and (c) PhoPE215A binding to 32P-labeled DR1,2 DNA. Competition was assayed by the reduction in binding of protein to the labeled DNA in EMSA experiments and each point is an average of two independent experiments.
G 9 residue of the DR1 repeat (Fig. 4c). This observation suggests that the exposed side chain of Glu215 of α8 is capable of interacting with DNA. This is in agreement with the PhoPC structure where Glu215 of the α8 recognition helix has been suggested as one of the residues likely to participate in DNA–protein interaction.14 Likewise, the structural model shows that the side chain of Glu215 of the second PhoPC molecule was most proximal to C5′ (5.1 Å) of the DR2 repeat motif (Fig. 4d). From these results, we suggest that the side chain of Glu215 is likely to be involved in base-specific contacts with (G/C)9 of the DR1 repeat motif and/ or (C/G)5 of the DR2 repeat motif, respectively. We next examined the contribution of (C/G)9 of the DR1 repeat motif in determining DNA recognition specificity by M. tuberculosis PhoP. To this effect,
DNA Binding Specificity of M. tuberculosis PhoP
oligonucleotide was synthesized where (C/G)9 was modified to (A/T)9 in DR1, leaving the rest of the DR1,2 sequence unaltered, and used in binding assays with wild-type PhoP. To examine the specificity of DNA recognition, PhoP binding to DR1,2 and to mutant substrate were compared both in the absence or in the presence of herring sperm DNA (50 μg/ml) as a nonspecific competitor (Fig. 5). In the absence of nonspecific herring sperm DNA, substitution of C9 with A9 in DR1 showed 1.45 ± 0.14-fold lower efficiency of DNA binding by PhoP (compare lanes 2–4 and lanes 6–8, Fig. 5a). On the contrary, a striking inhibition of PhoP binding was observed with the mutant DNA compared to the wild-type DR1,2 site when the binding mix contained herring sperm DNA (50 μg/ml; compare lanes 2–4 and lanes 6–8, Fig. 5b). Clearly, PhoP binding to DR1(C9A)DR2 is inhibited by 3.5- to 5-fold in the presence of herring-sperm DNA. However, under identical conditions, PhoP at the highest protein concentration examined (4 μM) exhibited 56 ± 1% and 51.5 ± 0.8% of DR1,2 binding in the absence or presence of herring sperm DNA, respectively, suggesting a 1.2 ± 0.1-fold difference in the extent of binding. As control experiments, under the conditions examined, substitution of C2 of DR1 by A2 (Fig. 5c) or C9 of DR2 by A9 (Fig. 5d) of DR1,2 DNA did not display any significant change in PhoP binding efficiency in the absence or presence of herring sperm DNA. Quantification of the binding data shows 1.2 ± 0.2- and 1.3 ± 0.4-fold difference in PhoP binding efficiency to DR1(C2A)DR2 and DR1DR2(C9A), respectively, in the absence or presence of herring sperm DNA (50 μg/ml). Thus, the (G/C)9 of DR1 repeat motif appears to contribute to sequence-specific PhoP–DNA interactions. However, substitution of G5 of DR2 by T5 (Fig. 5e) did not reveal any significant difference in PhoP binding efficiency in the absence (lanes 2–4) or presence (lanes 5–7) of herring sperm DNA. As expected, PhoPE215A binding of the mutant DNA substrate is almost comparable to that of wild-type PhoP in the absence of nonspecific competitor DNA. However, we observed a strong ≈ 3.5-fold inhibition of binding when nonspecific herring sperm DNA was included in the binding mix (data not shown). Although we have previously shown that the conserved adenines (A1 of DR1 and A7 of DR2) are important for forming a PhoP–DNA complex stable to gel electrophoresis,13 here we demonstrate the importance of a single base pair [(G/C)9 base-pair of DR1] in determining DNA recognition specificity of the regulator. The observation that substitution of Glu215 to Ala has a significant effect on sequence-specific DNA binding (Fig. 3) led us to speculate that basespecific contacts with the side chain of Glu215 are possibly involved in PhoP–DNA interactions leading to PhoP's DNA recognition specificity. In agreement with this proposal, (G/C)9 of the DR1 repeat motif was found to be proximal to the solvent-exposed Glu215 in the PhoPC–DNA structural model (Fig. 4). Finally, a single substitution at
DNA Binding Specificity of M. tuberculosis PhoP
653
Fig. 4. Modeled PhoPC–DNA complex. (a) Sequence of the 23-bp core binding region comprising two direct repeat motifs DR1 and DR2 (sequence noted in uppercase letters) with 5-bp intervening spacer region (sequence noted in lowercase letters). The nucleotides in both repeat motifs are numbered from 5′ to 3′ (at the bottom), and the nucleotides conserved in both repeat motifs are indicated by gray shadings. (b) The model of PhoPC–DNA complex was generated first by superposing the monomer of PhoPC (PDB ID 2PMU) onto each monomer of PhoBC of E. coli (PDB ID 1GXP) to form a dimer with the LSQMAN21 program. The Cα tracing for each monomer is represented as cartoon diagram shown in blue and green. Subsequently the B-DNA model for the DR1–DR2 sequence was generated using the server at http:// hydra.icgeb.trieste.it/dna/ and superposed on the DNA bound to the PhoBC domain of E. coli (PDB ID 1GXP). The superposed dimer on the modeled DNA structure for M. tuberculosis PhoPC–DNA complex was used for further analysis. The molecular image was generated using PYMOL.22 (c) Enlarged view of the interface between the E215 side chain of PhoP with G9 of the DR1 sequence in one monomer; (d) close-up view of interaction between the E215 side chain of the other monomer with C5′ of the DR2 sequence. Broken lines indicate proposed interactions between Glu215 of PhoP and color-coded bases of DR1 (c) and DR2 (d), respectively.
(G/C)9 of the DR1 repeat motif has been shown to strongly influence sequence-specific DNA recognition of PhoP. The fact that G5 of DR2 sequence does
not appear to influence sequence-specific PhoP– DR1,2 interaction suggests that DR1 is the primary site of interaction which contributes to DNA-
654
DNA Binding Specificity of M. tuberculosis PhoP
Fig. 5. Role of (G/C)9 of the DR1 repeat motif in sequence-specific PhoP–DNA interactions. EMSA of end-labeled DNA probes with indicated concentrations of PhoP using wild-type DR1,2 DNA (lanes 2–4) or duplexes carrying substitutions at the C9 of the DR1 motif (lanes 6–8) either in the absence (a) or in the presence (b) of herring sperm DNA (50 μg/ml). For experiments shown in (c) to (e), PhoP binding at indicated concentrations to duplex DNA probes carrying substitutions at the C2 of the DR1 motif (c), C9 of the DR2 motif (d), and G5 of the DR2 motif (e) of DR1,2 both in the absence (lanes 2–4) or in the presence of herring sperm DNA [lanes 6–8, (c) and (d); lanes 5–7 (e)], respectively. Directrepeat specific substitutions in the top strand are indicated above each panel. Protein–DNA complexes were analyzed as described in the legend to Fig. 2.
recognition specificity of PhoP. This is in agreement with our previous data suggesting that recruitment of two PhoP protomers occurs only on DNA such that binding of a PhoP molecule to the DR1 site assists the binding of a second PhoP molecule to the DR2 site.23 Together, these results suggest that base-specific interaction involving Glu215 of PhoP α8-helix and the (G/C) 9 of DR1 is critically important in determining DNA recognition specificity of the regulator. Protein–nucleic acid recognition plays a critical role in the mechanisms that regulate transcription of DNA. Extensive biochemical and structural studies have established that the vast majority of the sequence-specific DNA binding proteins interact with their cognate binding sites through autonomously folded domains, which in many cases insert an α-helix into the major groove of the target DNA. Although structure of M. tuberculosis PhoP DNA
binding domain has been determined and the structural basis of DNA recognition is established, DNA–protein interfaces have not been studied to ascertain the determinants that govern the affinity and specificity of binding. Thus, biochemical studies are required to decipher the origins of binding affinity and specificity. To this effect, structureguided mutations were introduced in PhoPC, and major base-specific interactions governing DNA binding specificity of the protein were identified by structural superposition of PhoPC on the PhoB– DNA complex. Results reported here validate and expand upon the crystal structure and provide new insights into the DNA recognition specificity of PhoP that is not available from the structural data alone. Given the effect of Glu215 mutation on the specificity of DNA binding but not on the affinity of interaction (compare lanes 8–10, Fig. 2a, and lanes
655
DNA Binding Specificity of M. tuberculosis PhoP
5–7, Fig. 3), it is likely that Glu215 of α8 helix participates in base-specific contacts. This prediction was strengthened by structural superposition of PhoPC on the PhoBC–DNA complex14 to identify a likely interaction that contributes to recognition specificity. We provide evidence suggesting that the side chain of Glu215 likely participates in a basespecific contact with the ninth guanine (G9) residue of the DR1 repeat (Fig. 4), which is critically required for PhoP–DNA sequence-specific interactions (Fig. 5). Together, these results demonstrate that Glu215 contributes preferentially within the context of sequence-specific recognition. Most of the other Ala substitutions, however, were for positively charged Lys or Arg residues. These residues are capable of forming energetically favorable, but nonspecific electrostatic interactions, with the phosphate moieties of the DNA backbone. In the PhoPC structure, the conserved Arg222 has been predicted to interact with the DNA phosphate backbone.14 Structural superposition of PhoPC on the PhoBC– DNA complex also indicates that the side chain of Arg223 is analogous to the side chain of Arg200 of the DNA binding domain of PhoB, the E. coli orthologue of M. tuberculosis PhoP, and this residue might be interacting with a phosphate.14 According to the structural alignment, the side chain of Lys224 is also capable of interacting with the backbone atoms of DNA. Since none of the Ala mutants replacing the basic amino acids exhibited any detectable DNA binding under our experimental condition, our results are consistent with the previously proposed DNA binding mechanism of PhoP.14 However, whether these amino acid side chains contribute to binding in a nonspecific fashion (e.g., with the DNA backbone) or via direct basespecific contacts remains to be determined. The contribution of presumably nonspecific backbone contacts to DNA binding specificity has been reported previously.24 However, our present data do not rule out the possible involvement of any other amino acid–base interaction that could be important to determining DNA recognition specificity. In addition to forming direct contacts with the DNA, it is possible that additional hydrogenbonding networks involving side chains of the DNA contacting residues orient the side chains for optimal DNA contact, and thereby contribute to DNA recognition. In conclusion, our results identify a novel basespecific interaction of PhoP with its cognate DNA, which provides new insights into the substrate specificity of the important regulator. Whereas the structural data of the PhoP DNA binding domain could only predict some of the amino acids of α8 as the likely residues conferring affinity and/or sequence specificity, results reported here identify amino acid residues of α8 that contribute to PhoP's DNA binding affinity and highlight Glu215 as a single critical residue that appears to establish a basespecific contact with the ninth residue of the DR1 motif to contribute to DNA recognition specificity of the regulator.
Acknowledgements The authors thank Sharanjeet Kaur and Dr. Purnananda Guptasarma for CD studies, Renu Sharma and Mahendra Yadav for excellent technical assistance, and Renu Sharma for her help with the preparation of the manuscript. This work was supported, in part, by CSIR (Network Project NWP-5 and Supra Institutional Project SIP-10) and by research grants (to D.S.) from the Department of Science and Technology (SR/SO/BB-16/2007) and Department of Biotechnology (BT/PR8545/Med/ 14/1262/2006), Government of India. A.D., A.P., and M.D. are predoctoral students supported by research fellowships from CSIR. A.S. is supported by CSIR Network Project NWP-5.
Supplementary Data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/ j.jmb.2010.03.056
References 1. Fontan, P. A., Walters, S. & Smith, I. (2004). Cellular signaling pathways and transcriptional regulation in Mycobacterium tuberculosis: stress control and virulence. Curr. Sci. 86, 122–134. 2. Av-Gay, Y. & Deretic, V. (2005). Two-component systems, protein kinases, and signal transduction in Mycobacterium tuberculosis. In Tuberculosis and the Tubercle Bacillus (Cole, S. T., ed.), pp. 359–367, ASM Press, Washingon, DC. 3. Perez, E., Samper, S., Bordas, Y., Guilhot, C., Gicquel, B. & Martin, C. (2001). An essential role for phoP in Mycobacterium tuberculosis virulence. Mol. Microbiol. 41, 179–187. 4. Soto, C. Y., Menendez, M. C., Perez, E., Samper, S., Gomaz, A. B., Garcia, N. J. & Martin, C. (2004). IS6110 mediates increased transcription of the phoP virulence gene in a multi drug-resistant clinical isolate responsible for tuberculosis outbreaks. J. Clin. Microbiol. 42, 212–219. 5. Walters, S. B., Dubnau, E., Kolesnikova, I., Laval, F., Daffe, M. & Smith, I. (2006). The Mycobacterium tuberculosis PhoPR two-component system regulates genes essential for virulence and complex lipid biosynthesis. Mol. Microbiol. 60, 312–330. 6. Gonzalo-Asensio, J., Maia, C., Ferrer, N. L., Barilone, N., Larval, F., Soto, C. Y. et al. (2006). The virulenceassociated two-component PhoP-PhoR system controls the biosynthesis of polyketide-derived lipids in Mycobacterium tuberculosis. J. Biol. Chem. 281, 1313–1316. 7. Gonzalo-Asensio, J., Mostowy, S., Harders-Westerveen, J., Huygen, K. et al. (2008). PhoP: a missing piece in the intricate puzzle of Mycobacterium tuberculosis virulence. PloS ONE, 3, e3496. 8. Gonzalo-Asensio, J., Soto, C. Y., Arbues, A., Sancho, J, del Carmen Menéndez, M, García, M. J. et al. (2008). M. tuberculosis phoPR operon is positively autoregulated in the virulent strain H37Rv. J. Bacteriol. 190, 7068–7078.
656 9. Frigui, W., Bottai, D., Majlessi, L., Monot, M., Josselin, E., Brodin, P. et al. (2008). Control of M. tuberculosis ESAT-6 secretion and specific T cell recognition by PhoP. PLoS Pathog. 4, e33. 10. Ryndak, M., Wang, S. & Smith, I. (2008). PhoP, a key player in Mycobacterium tuberculosis virulence. Trends Microbiol. 11, 528–534. 11. Lee, J. S., Krause, R., Schreiber, J., Mollenkopf, H. J., Kowall, J., Stein, R. et al. (2008). Mutation in the transcriptional regulator PhoP contributes to avirulence of Mycobacterium tuberculosis H37Ra strain. Cell Host Microbe, 3, 97–103. 12. Chesne-Seck, M. L., Barilone, N., Boudou, F., Gonzalo Asensio, J. G., Kolattukudy, P. E., Martin, C. et al. (2007). A point mutation in the two-component regulator PhoP-PhoR accounts for the absence of polyketide-derived acyltrehaloses but not that of phthiocerol dimycocerosates in Mycobacterium tuberculosis H37Ra. J. Bacteriol. 190, 1329–1334. 13. Gupta, S., Pathak, A., Sinha, A. & Sarkar, D. (2009). Mycobacterium tuberculosis PhoP recognizes two adjacent direct-repeat sequences to form head-to-head dimers. J. Bacteriol. 191, 7466–7476. 14. Wang, S., Engohang-Ndong, J. & Smith, I. (2007). Structure of the DNA-binding domain of the response regulator PhoP from Mycobacterium tuberculosis. Biochemistry, 46, 14751–14761. 15. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 16. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K. & Pease, L. R. (1989). Site directed mutagenesis by
DNA Binding Specificity of M. tuberculosis PhoP
17.
18.
19.
20.
21. 22. 23.
24.
overlap extension using the polymerase chain reaction. Gene, 77, 51–59. Gupta, S., Sinha, A. & Sarkar, D. (2006). Transcriptional autoregulation of Mycobacterium tuberculosis PhoP involves recognition of novel direct repeat sequences in the regulatory region of the promoter. FEBS Lett. 580, 5328–5338. Buckler, D. R., Zhou, Y. & Stock, A. M. (2002). Evidence of intradomain and interdomain flexibility in an OmpR/PhoB homolog from Thermotoga maritima. Structure, 10, 153–164. Robinson, V. L., Wu, T. & Stock, A. M. (2003). Structural analysis of the domain interface in DrrB, a response regulator of the OmpR/PhoB subfamily. J. Bacteriol. 185, 4186–4194. Blanco, A. G., Sola, M., Gomis-Ruth, F. X. & Coll, M. (2002). Tandem DNA recognition by PhoB, a twocomponent signal transduction transcriptional activator. Structure, 10, 701–713. Kleywegt, G. J. (1996). Use of non-crystallographic symmetry in protein structure refinement. Acta Crystallogr., Sect. D: Biol. Crystallogr. 52, 842–857. DeLano, W. L. (2002). The PyMOL User's Manual. DeLano Scientific, Palo Alto, CA. Sinha, A., Gupta, S., Bhutani, S., Pathak, A. & Sarkar, D. (2007). PhoP-PhoP interaction on adjacent PhoP binding sites is influenced by protein phosphorylation. J. Bacteriol. 190, 1317–1328. Schildbach, J. F., Karzai, A. W., Raumann, B. E. & Sauer, R. T. (1999). Origins of DNA-binding specificity: role of protein contacts with the DNA backbone. Proc. Natl Acad. Sci. USA, 96, 811–817.