A single predominantly expressed polymorphic immunoglobulin VH gene family, related to mammalian group, I, clan, II, is identified in cattle

Molecular Immunology, Vol. 34, No. S/9, pp. 641-651, 1997 18 1997 Elsevier Science Ltd. All rights reserved Printed in Great Britain 0161-5890/97 $17.00 + 0.00

Pergamon PII: SO161-5890(97)00055-2

A SINGLE PREDOMINANTLY EXPRESSED POLYMORPHIC IMMUNOGLOBULIN VH GENE FAMILY, RELATED TO MAMMALIAN GROUP, I, CLAN, II, IS IDENTIFIED IN CATTLE* SURINDER

S. SAINI,?

WAYNE

R. HEINS and AZAD KAUSHIKI-5 tDepartment of Pathobiology, University of Guelph, Guelph, Ontario NlG 2W1, Canada; $Basel Institute of Immunology, Basel, Switzerland (First received 2 December 1996; accepted in revised,form Abstract-In

order to understand

the generation

of antibody

diversity

30 April 1997) in cattle, seven cDNAs,

from

heterohybridomas secreting bovine IgM and IgGl antibodies, were cloned and structurally analyzed for rearranged bovine VDJ genes. All of the seven bovine VH genes, together with four available bovine VH gene sequences,shared a high nucleotide sequence homology (84.2-93.5%). Based upon the criteria of nucleic acid homology >80%, all of the bovine V, gene sequences isolated from the expressedantibody repertoire constitute a single V, gene family, which we have designated as bovine VHl (Bov VH1). An analysis of 44 bovine IgM-secreting

mouse x cattle heterohybridomas,

originating

from polyclonally-activated PBLs from bovine leukemia virus-infected cattle, revealed that all of these expressed Bov V,l (100%) based upon DNA sequencing and Northern dot blot. The bovine V, genes showed highest DNA sequence similarity, ranging between 8 1.5 and 87.6%, with a single sheep VH gene family (related to human V,4) and are, thus, closest to the V, genes from another ruminant species. The Bov V,l gene family is most homologous to the murine V, Q-52 (71.8-78%)

and human V,4 (67.669.8%) gene families, which belong to mammalian group, I, clan, 11,V, genes. The CDR3 length of rearranged

bovine VDJ genes is characteristically

long (15-23 amino acids). The

bovine JH gene segments were most homologous to human J,4 (82.1-87.2%) and J,5 (84X&89.7%) genes, suggesting the existence of at least two JH gene segments. An analysis of CDRs provides evidence that somatic hypermutations contribute significantly to the generation of antibody diversity in cattle. Southern

blot analysis of BamH I, EcoR I and Hind III digested genomic DNA

from four

cattle breeds (Holstein, Jersey, Hereford and Charolais) revealed three RFLP patterns; the genomic complexity of Bov V,l ranged between 13 and 15 genes. These observations provide evidence for polymorphism at the bovine Ig-V, locus, similar to that seen in mice and humans. c 1997 Elsevier ScienceLtd. Key wwrds: bovine V, genes, CDR3 length, group I V, genes, human V,,4 genes, murine Q-52 genes.

pairings. The variable region antibody diversity is primarily determined by two factors: (a) the The antibody diversity in the vertebrate immune system is number and sequence diversity of germline genes, and (b) generated through rearrangement of separated germline somatic diversity, resulting from rearrangements, juncgene segments (i.e. variable (V,), diversity (D) and jointional deletions and additions (N or P nucleotides) and ing (JH) for the heavy chain and V,, and Jtiii for the light somatic mutations (Tonegawa, 1983). chains) and through subsequent heavy and light chain The process of gene rearrangement is common to all the vertebrates, but the number and sequence diversity *Supported by operating NSERC Canada and OMAFRA of V, gene segments varies across the species. Based on grants to Dr A. Kaushik. The sequencesare available from nucleotide homology of >80%, about 100 human VH the GenBank accession numbers: U36823. U36824, genes are grouped into seven VH gene families (Berman AFOOO012, AFOOO013, AFOOO014, AFOOOO15 and AF et al., 1988; Van Dijk et al., 1993) while 100-500 murine 000016. VH genes are classified into 15 VH gene families (Brodeur $Author to whom correspondence should be addressed. Fax: and Riblet, 1984; Kofler et al., 1992; Mainville et al., (519)767 0809; E-mail: [email protected] 1996). The human and murine VH genes are further classiAbbreviations: BLV, bovine leukemia virus; FW, frame work; fied into three major groups, group I (humanV,2, VH4, CDR, complementarity determining region; Ig, immuVn6, murine V, 3609, V, 3660 and V, Q-52), group II noglobulin; PBL, peripheral blood lymphocytes; RFLP, (Human Vnl, V”5, murine VH 5558 and V,VGam 3-8) restricted fragment length polymorphism; V,, heavy chain variable region. and group III (humanV,3, murine V,7183, V,S107, VH 641

INTRODUCTION

642

S. S. SAINI et al.

5606 and VnX24), according to evolutionary divergence across species (Tutter and Riblet, 1988a, 1989; KoAer et al., 1992). In general, group III Vn genes are conserved during evolution and have been suggested to constitute an obligatory component of heavy chain loci in widely divergent mammalian and non-mammalian lineages (Tutter and Riblet, 1988a, 1989). In contrast to the mouse and to humans, chickens have approximately 100 Vn genes, but only one VH gene, proximal to the D genes, is functional; it contributes to antibody diversity via gene conversion in the bursa of Fabricious (Reynaud et al., 1989, 1994). Similarly, the rabbit has a germline pool of at least 100 V, genes, corresponding to the human Vn3 gene family, but approximately half of these are functional (Becker and Knight, 1990; Knight, 1992). However, a single 3’ VH gene is preferentially rearranged and undergoes gene conversion and somatic hypermutations in the appendix leading to the generation of antibody diversity (Weinstein et al., 1994). The swine VH genes expressed in the peripheral antibody repertoire also belong to one VH gene family and, like the rabbit, are closest to human V,3 genes (Sun et al., 1994). In sheep, a single Vn gene family, a homologue of the human Vn4 gene family, is consistently isolated from the immunoglobulin variable region heavy chain repertoire (Dufour et al., 1996). The i-light chain repertoire in sheep is diversified via somatic hypermutations in the ileal Peyer’s patches during fetal and neonatal life (Reynaud et al., 1991, 1995). Thus, multiple divergent Vn gene families contribute to the generation of antibody diversity in the primary antibody repertoire of mice and humans but few VH genes appear to generate antibody diversity in other species such as the chicken, rabbit. sheep and pig. In order to understand the development of humoral immunity during evolution, studies of V, genes of other species are necessary. The bovine immune system develops in the absence of any influence from maternal antibodies due to the presence of a syndesmochorial type of placentation (Tizard, 1992). Additionally, a majority of the peripheral B lymphocytes are CDS’(Naessens and Williams, 1992) similar to murine B-l cells, which are suggested to constitute a separate B cell lineage (Herzenberg et al., 1986). Homologues of the murine V, 5558 gene family, which constitute up to 50% of mouse V,, genes, do not exist in the bovine genome (Tutter and Riblet, 1989). The bovine Cyl and Cy2 genes have been cloned and sequenced (Symons et al., 1989; Jackson et al., 1992). The bovine V,, light chain genes have been characterized and grouped into two families, V.1 and V12, where Vi1 predominates in the expressed antibody repertoire (Sinclair et al., 1995). The primary A-light chain repertoire in cattle has been suggested to be diversified by gene conversion (Parng et al., 1996). Few DNA sequences of bovine V, genes are available (Jackson et al., 1992; Armour et al., 1994) but further studies are essential to characterize the VDJ gene rearrangements in the bovine peripheral antibody repertoire. This will help to elucidate the mechanisms involved in the generation of antibody diversity in the bovine immune system.

We have analysed seven cDNA sequences from mouse x cattle heterohybridomas secreting bovine 1gM and IgGl antibody. The studies outlined here provide evidence that all the bovine Vn genes isolated so far from different sources constitute a single Vn gene family, which is most homologous to human Vn4 and murine Q-52 gene families and belongs to mammalian group I (Tutter and Riblet, 1988a; Tutter and Riblet, 1989; Kofler et al., 1992) or clan II (Kirkham et al., 1992) V, genes. We have designated this bovine VH gene family as Bov Vnl, comprising 13315 genes. The FR4 of the bovine lg variable region is encoded by J, genes, which are most homologous to human Jn4 and JH5 gene segments. Further, the heavy chain CDR3 length of rearranged bovine VH genes is unusually long (15523 amino acids) and somatic hypermutations appear to contribute significantly to the generation of antibody diversity in cattle. Finally, the Bov Vnl gene family is polymorphic, its genomic complexity varies between 13 and 15 genes, and it is predominantly expressed in the peripheral blood lymphocytes.

MATERIALS

AND METHODS

B-cell heterohybridomas Two mouse x cattle heterohybridomas, alphaBL5C2.870005 (HB-9907) and alpha-BL5C2.870009 (HB-9908) secreting anti-bovine herpesvirus 1 IgGl antibody, were obtained from ATCC (Rockville, MD, U.S.A.). The heterohybridomas were grown in RPM1 1460 medium supplemented with 20% heat inactivated horse serum, 5 mM sodium pyruvate, 1 mM glutamine, 0.5 mM MEM non-essential amino acids, 1% 100 x antibiotic-antimycotic solution and 5 x 10m5M 2-mercaptoethanol (all from, GIBCO, BRL, Gaithersburg, MD, U.S.A.). Additional mouse x cattle heterohybridomas were developed by somatically fusing bovine PBLs, stimulated in citro for 48 hr with 25 pg/ml of lipopolysaccharide from Escherichia coli serotype 0127:B8 (Sigma Chemical Co., St. Louis, MO, U.S.A.) and 300ng/ml of phorbol 12myristate 13-acetate (Sigma Chemical Co.), with nonimmunoglobulin secreting P3x-63.Ag8.653 mouse myeloma cells under limiting dilution conditions as described earlier (Kaushik et al., 1988). The PBLs were obtained from a two year old Holstein heifer suffering from persistent lymphocytosis as a result of BLV infection. Of the heterohybridomas thus developed 44 tested positive for bovine IgM secretion in a sandwich ELISA using unlabeled murine monoclonal anti-bovine IgM antibody (Sigma Chemical Co.), biotin conjugated murine monoclonal anti-bovine IgM antibody (Sigma Chemical Co.) and avidin conjugated with alkaline phosphatase (Pierce, Rockford, IL, U.S.A.). Various methodological and positive and negative controls were included in each test. The optical densities were measured at 405 using an ELISA reader (Ceres UV 900 Hdi, Bio-Tek Instruments Inc., Winooski, VT, U.S.A.).

Bovine V, genes cDNA synthesis, PCR ampl$catio~l rearranged bovine VDJ genes

and cloning

of

Total RNA was extracted from two bovine IgGlsecreting and seven IgM-secreting heterohybridomas following the method of Chomczynski and Sacchi (1987). The cDNA was synthesized from 7~8 of total RNA using polydT primer (Pharmacia LKB Biotechnology, Uppsala, Sweden) and amplified with PCR (Perkin Elmer, Branchburg, NJ, U.S.A.) using 5’ primer (SAGCTCGAGATGAACCCACTGTG 3’) from the leader sequence and 3’ primer from either the conserved 5’ sequence of CH 1 region of bovine Cyl (Jackson et al., 1992) (5’ AGACTAGTGGCTGTGGTGGAGGC 3’) or from the 3’ sequences of bovine Jn gene segments (5’ AGACTAGTGAGGAGACGGTGACC 3’). The 5’ and 3’ primers have built-in restriction sites for Xho I and Spe I endonucleases, respectively, and were synthesized at the Biotechnology Centre, University of Toronto, Ontario, Canada. The PCR steps involved a hot start at 95-C for 2 min, denaturation at 95°C for 1 min and combined annealing and extension steps at 72 C for 2.5 min, up to a total of 30 cycles. The reaction conditions included 1.5 mM MgCl, concentration, 0.8 PM of each primer and 2.5 U of Taq polymerase in 100 ~1 volume. The rearranged bovine VDJ gene amplification was confirmed in an agarose gel electrophoresis and Southern blot by hybridization with a [c(-j2P]dCTP (Amersham Canada Ltd., Oakville, Ontario, Canada) radiolabeled DNA probe specific for sheep VH gene. The sheep VH gene specific DNA probe was a 255 bp Pst I and Eco52 I fragment from clone 4839 VH2 (Dr W.R. Hein, Base1 Institute of Immunology, Basel, Switzerland). The PCR product was digested with Xho I and Spe I., fractionated by gel electophoresis, purified with Gene Clean II (Bio 101, Vista, CA, U.S.A.) and ligated into the dephosphorylated (calf intestinal alkaline phosphatase from Boehringer Mannheim, Germany) multiple cloning site of Bluescript KS + / - vector (Stratagene, La Jolla, CA, U.S.A.) as described (Reininger et al., 1988; Emara et al., 1995; Lipsanen et al., 1997). High efficiency E. coli, DHlOB cells (GIBCO, BRL) were transformed with the ligated DNA by electroporation (GIBCO, BRL). The bacterial colonies were screened in a Southern blot of restriction enzyme-digested plasmid DNA (Sambrook et al., 1989) by hybridizing with a sheep Vu gene specific DNA probe radiolabeled with [a-“P]dCTP by random priming (Boehringer Mannheim). Briefly, the restriction-digested plasmid DNA was transferred onto a nitrocellulose membrane (Schleicher and Schuell Inc., Keene, NH, U.S.A.) and UV cross-linked. The membranes were pre-hybridized for 6 hr at 42 C followed by overnight hybridization in 50% formamide, 5 x Denhardt’s solution, 5 x SSPE, 0.1% sodium dodecyl sulfate (SDS), 100 pg/ml sonicated and denatured salmon sperm DNA and 1Ohdpm of radiolabeled DNA probe/ml. The membranes were washed three times in 2 x SSC, 0.1% SDS at 2O’C; once in 1 x SSC, 0.1% SDS for lo-15 min at 65°C; and finally in 0.1 x SSC, 0.1% SDS for 15520 min at 65’ C. The autoradiography was performed using XAR-5 films (Eastman Kodak Company, Rochester, NY, U.S.A.).

643

DNA sequencing and structural analysis The recombinant plasmids extracted from at least two clones originating from each heterohybridoma were purified on mini-affinity columns (Qiagen Inc., U.S.A.) and sequenced in both directions with T7 and T3 primers, using an automated DNA sequencing facility at, MOBIX (McMaster University, Hamilton, Ontario, Canada). The clone p4H9.1 has a restriction site for SpeI enzyme at the 5’ end of CDR3; its nucleotide sequence was thus determined by sequencing with T3 and T7 primers from nucleotide 1 to 291 from the recombinant plasmid, and the remaining sequence was obtained by direct sequencing of the PCR product. The nucleotide sequences of all the rearranged Vu genes were analysed for the FWs and CDRs, and numbered according to Kabat (Kabat et al., 1991). The DNA sequences were compared with nucleotide sequences from other species using the Genbank BLAST program (Altschul et al., 1990) and the amino acid analysis was performed using the GPMAW (version 2.1) program (Kyte and Doolittle, 1982). Southern blot hybridization Genomic DNA was extracted from the peripheral blood of Holstein Friesian, Jersey, Hereford and Charolais breeds of cattle using a DNA extraction kit (Stratagene, La Jolla, CA, U.S.A.). Approximately l&l 5 pg of, D.N.A., digested to completion with BamH I, EcoR I and Hind III restriction enzymes, was electrophoresed at 18 V for 36 hr in 0.8% agarose gel. The DNA was depurinated in 0.2 N HCl for 30 min and transferred onto maximum strength nytran membrane (Schleicher and Schuell Inc.) using an alkaline transfer method (I M NaOH) by VacuGene (Pharmacia LKB Biotechnology). The membranes were pre-hybridized overnight at 42°C followed by hybridization (50% formamide, 5x Denhardt’s solution, 5 x SSPE, 0.5% SDS, lOOpg/ml sonicated and denatured salmon sperm DNA and 2.55 3.0 x lO”dpm of [a-3’P]dCTP radiolabeled Bov Vu1 gene family-specific DNA probe/ml.). The Bov V,l gene family-specific DNA probe was prepared from recombinant plasmid pB7S2 by double restriction digestion. First, a 463 bp fragment containing rearranged VDJ genes was isolated by restriction digestion with Xlzo I and Xba I enzymes; following purification, it was further digested with Hae III enzyme to obtain a 248 bp Vu specific DNA probe spanning nucleotides 23-270. The bovine V, specific DNA probe was radiolabeled by random priming (Boehringer Mannheim). Following overnight hybridization, the membranes were washed three times in 2 x SSC, 0.1% SDS solution at room temperature; once in I x SSC, 0.1% SDS for lo-15 min at 65 C; and finally in 0.1 x SSC, 0.1% SDS at 65’C for IO-1 5 min. The membranes were exposed to XAR-5 films (Eastman Kodak Company) for 2-5 days at - 70’ C. RNA dot-blot The total RNA was extracted from all heterohybridomas using Trizol reagent (GIBCO, BRL)

S. S. SAINI et al. according to manufacturer’s instructions (Chomczynski and Sacchi, 1987). The RNA was blotted at the concentration of 1, 3 and 5pg on to a nitrocellulose membrane and UV cross-linked. The RNAs from a bovine IgGl-secreting heterohybridoma (HB 9907) and nonsecreting fusion partner (P3 x Ag8.653) as well as from non-secreting heterohybridomas (BL2Gll and BL6A2) were included in the assay as positive and negative controls, respectively. The RNA blots were hybridized with a [c(-32P]dCTP radiolabeled Bov V,l gene-specific DNA probe, followed by stringent washing as described (Kaushik et al., 1990). The filters were exposed to XAR5 films (Eastman Kodak Company) overnight at - 70°C. The specificity of RNA dot-blot assay was confirmed by cloning and sequencing cDNAs prepared from seven

(a)

randomly selected RNAs which showed nucleotide sequence homology 2 80% with pB7S2 clone.

RESULTS Structural analysis of rearranged bovine Ig variable region heavy chain genes The cDNAs prepared from seven mouse x cattle heterohybridomas, two secreting bovine IgGl antibody against bovine herpesvirus 1 (pB7S2 and pBSS1) and five secreting bovine IgM antibody, derived from polyclonally-activated PBLs from BLV-infected cattle (p2C7.5, p4H9.1, p5H4.1, p7B7.2 and p7G1.5), were cloned and structurally analysed for rearranged bovine

1

pB7SZ pBSS1

10 CAG GTG CAG CTG CGG GAG TCG GGC CCC AGC CTG GTG AAG CCC TCA -____ ---__ --------_ ___ ___ ___ ___ ___ ___ ___

p2C7.5

---

---

-_-

___

___

___

__-

___

___

_--

---

-__

---

--_

p4Ii9.1 p5H4.1 p7B7.2 p7G1.5

___ ___ ___ ___

___ ___ ___ ___

___ ___ --A ___

___ -__ ___ ___

_-___ _-_--

--___ ----A

_---A _-_ __-

___ ___ ___ ___

__-__ ____-

--_ ___ -__ -T-

___ ___ --A ___

___ _-_ ___ ___

___ ___ ___ __-

___ ___ ___ -__

TTC ___ ___ ___ ___ ___ ___

TCA TTA ___ e-G ___ e-G ___ m-G ___ v-G ___ e-(-J ___ v-0

30 AGC -A___ ___ _____ ___

GGT A-C MC A-C A-C A-C A-C

AAT Tw T-m T-m T-m T-m T-e

AQT GTA GGC a-----(;Ic- ___ ___ TC- _-TAm T,-& ___ DC- w-0 CTDC- ___ -A-

WA --------e-c ---

ACC ACA

QAC! -00 A-T -0s T-q Aa -G-

TAT -__ -____ __--__-

MC m-0 ___ C-m ___ --___

CCA WC! ___ ___ _-___ ___ --___ ___ u-0 A-0-s ___

ACA ACT ___ -G___ ___ ___ ___ ___ C-e ___ m-0 ___ ___

GAG e-c ___ ___ ___ --A ___

GAC ACG GCC ACA TAC ___ --_-_-_ ___ ___ ----_-_ ___ ___ ----_-_ ___ ___ ----___ ___ ___ ------_-_ ___ ___ __- _-_ ___

a

----0-T --_ 0-m _--

b

c

AGC ___ ___ ___ --G ___ ___

AGC GTA ___ m-G ___ --G ___ w-G ___ w-G ___ e-G ___ w-G

hij GGT --M---

TAT GGC-C A--

. . . CTC -A-

20 CTC ACC TGC ACG GTC TCT ___ __- ___ ___ e-G ___

_--

--_

__-

--C

-__

___

___

C-w

___

A--

___

___

___ -__ ____-

___ ___ -__ .--

___ _-___ ___

e-c w-c e-c e-c

___ ___ ___ ___

___ -__ _-___

___ ___ ___ ___

___ ___ ___ _-_

___ T-e ___ ___

A-_-_ ___ A--

___ ___ ___ ___

___ ___ ___ ___

CCA GGA AAG GCG CTG GAG TGG CTC ___ --G -__ ___ e-T __- m-T e-T -__ e-G ___ _-___ --A AT- -Cm ___ w-G ___ ___ __- ___ m-T --‘I m-G w-G --_ --A ___ ___ --G-T ___ --_ ___ A-___ _--AC G-T __- m-(-j ___ --A ___ ___ ___ e-T

GGT ___ ___ ___ -Cm ___ ___

MC G-T 0-w MT Ga (MT w-f

AT0

GAT A,& A& A,-& ----A--

GGT A-A-___ CC-CAA-

ATA -AT MT -aT &!T OAT -CT

40

TGG GTC CGC CAG ACT ___ ___ ----_ G-___ ___ ___ ___ G-m ___ ___ - _ _ _ _ _ _ _ _ ___ ___ ___ --_ G-m ___ __- -_-__ G-m ___ ___ ___ ___ G-e

60

TA-a__(J,+ WCD-

CAG ACC CTG TCC -__ ___ e-c ___

50

TCC ___ ___ ___ --___ ---

SO

. . . . . . . . . . . . 'SC- TAT

. .. . .. . ..

n o . . . . . . . . . . . . GAT TAT GCT TAC OTC --. . . . . . . . . . . . --TCC TAC CTC ... ---

CTC AGC ___ ___ ___ ___ _--__ ___ ___ _-_ -__ ___ ___

ATC ACC AAG GAC AAC ___-_ n;___ ___ ___ ___ ___ ___ ___ G-w -G- ___ _--____ ___ -__ ___ ___ ___ ___ --A ___ --_ ___ G-m ----___

TCC AAA --A C-G ___ m-G -__ e-G ___ e-G -__ m-G ___ -GG

AGC ___ _____ ___ ___ ___

CAA ___ ___ w-G ___ ___ ___

GTC TCT ___ ___ ___ ___ ___ ___ ___ ___ ___ _-_ ___ ___

CTA TCA CTG e-G ___ ___ e-G ___ A-e-G ___ G-e-G ___ G-m --f-j ___ G-m e-T ___ G-e

TAT w-c w-c e-c m-c e-c w-c

TGT ___ ___ ___ ___ ___ ___

AAG TGT ACT --A -Cm a---A-----a ---CA GAC TAC --A &A- T-G ___ -----

TAT WC -CGCAGA-w-

100 TQC -TA-T m 0-T 0-m GA-

a TGG A-T G-T -AT -AT aT CGT

b AGG G-C TTC w-T -AA G-T w.f

c TTT wC-m A(3C-m (3AC W-

e GAC ET ___ TaT TGa Ta -(JT

. . . . . . . . .

. . . . . . . . .

. .. . .. . . .

-C-C-Cm

TGG GGC CAA ----G---------_ -._ ___

5AC

82

COG ___ --A ___ ___ ___ ___

90

klm . .. . .. OTT (313 TAT CGC TTT Gm

--A --A --A --A ,&A --A

70

CTQ AM ___ ___ --A ___ ----_ ___ ___ _-_ ___ ___ ___

GGA ___

. . . ...

-G--A

-T-T-

--___

--___

--___

. . .

---

-C-

---

---

---

GCG -T___ ___ A---A ___

GGA CTC ___ --___ ---____ --___ ___ ___ ---

Fig. l-continued

GGT A-TAA-A-WA TT-

GCT ATA-G -o-GTT-G-

CTG GTC -G___

110 ACC GTC ___ ___

___

---

--___ --_

___ ___ ___

___

___ ___ ___

d OAT -GT,JAaAC-CC TG-

f GCl' -a -GA(iAa-0s TA-

g TAT (3T(3 w-c DCG-i-C Cw af..

TCC ___

TCG --A

pB7S2 pBBS1

[Bovine [Bovine

IgGl]

*

IgGll

*

---

---

----___ ___

----___ ___

--A --A --A --A --A

p2C7.5 P4H9.1 p5H4.1 p7B7.2 p7G1.5

[Bovine [Bovine [Bovine [Bovine [Bovine

IgM]** IgMl** IgMl** IgMl** IgM]**

overleaf.

Fig. 1. The nucleotide sequences of seven rearranged bovine VDJ genes cloned from *anti-bovine herpesvirus 1 IgGl-secreting heterohybridomas and **bovine IgM-secreting heterohybridomas from polyclonally-activated PBLs. The codons are numbered according to Kabat et al. (1991). The CDRs are shown in bold letters. The sequences presented here are available from GenBank accession numbers: U36823 (pB7S2), U36824 (pB8Sl), AFOOO012(p2C7.5), AF000013 (p4H9.1), AF000014 (p5H4.1), AF000015 (p7B7.2) and AF000016 (p7Gl.5) (a). The deduced amino acid sequencesof rearranged bovine VDJ genes are presented in three-letter codes (b). The PI values were determined by GPMAW (version 2.1) programme (Kyte and Doolittle, 1982).

Bovine V, genes

(b)

1

pB7S2

Gln

Val

Gln

Leu

Arg

Glu

____

Ser

Gly

Pro

10 Ser

Leu

Val

______

645

Lys

Pro

Ser

Gln

Thr

Leu

Ser

20 Leu

_

_

_

_

_

_

_

_

_____

Thr

Cys

Thr

Val

Ser

_

11~

_

__

-Ilee ser _ _ _ _ Ile

_ _

__ -_ __

-

--

Asp

Qly

11s

Ser

Aen

Set -

Qly

Ile 118 Val 11s

Ser Ser Ser -

Pro

Am

Ala Asn

Gly Asp Thr

Ser _ _ _ _ _

SO Leu Ser _ _ _ _ _ _ _ _ _ _

82 Leu __ Met Val Val Val Val

e Asp Cya C!ys Trp Cys Gly

g Tyr Val -Ala Val Arg

pB,jSl

__

p2C7.5

_

_

_

_

_

_

_

_

_

_

_

_

_

_

_

_

_

_

_

_

_

PJH9.1 p5H4,1 p7B7.2 p7G1.5

_ _ _ _______ _ _

_

_

_

_

-

_

_

_

_

_

-

_

1le

_

-

_ _ _

_ _ _

_ _ _

_ _ _

_ _ _

_ _ -

_ _ -

_ _ __ _

_ _

_

_ _____ _ _

Qly Ser

Am

Trp

Ser Qly

Val -

Qly -

Trp -

Val -

Am Ser Ser

Tyr !t+ Tyr

Ala Ala Ala

Sar

Tyr -

-

-

Ser

Tyr

Ala

-

-

-

Ala

-

Lsu Asp

-

-

Arg _ _ _

Gln _ _ _

40 Thr Ala Ala Ala Ala Ala

Pro _ _ _ _

Gly _ _ _ _ _

Lys _ _ _ _ -

Ala _ _ _ _ Thr -

Leu _ _ _ _ _

Glu _ _ _ _

Trp Cys Met Cys _ Tyr _

Leu Gly _ _ Pro Val Ala Val _ _

Asp Asp Gly Ala Qly Gly

Leu _ _ _ _

Lys _ _

Sar _ _

Arg _ _ _

Leu _ _ _

Ser _ _ _ _

Ile _ Val _ _ _

70 Thr Lys - Trp _ _ Ser _ _ _ Ala -

Asp _ _ -

Asn _ _ -

Ser _ _ _ -

Lys Gln _ _ _ -g

Ser _ _ _ _

Gln _ _ _ _ _

Val _ _ _ _

a

Thr -

Tyr -

Tyr -

Cys Ala - Val

Lys -

Cys Thr Ser Gly Wr Ser Asp Tyr Am Ser _ -

Gly Ser Tyr Ser Ser Leu phe

Ala Tyr 11s Qly Thr Ser Qly Ala Gly Ser Phe Am Gly Qly

b c d Arg Phe Asp Qly Qly Qly Phe Leu Cys

Leu _

30 Ser Asn _

_ _

_ _

_ _

_ _

_

_

_

_

Set

Tyr

Gly -

Thr Wr Ser

Thr _

Asp

Am

Pro

Lye

-

Ala

Tyr _ -

_ Hi# _

_ _ _ Ala

Ala _ _ e _

Thr Ser

Glu Asp

Asp -

Thr -

Ala -

pro

-

-

_

-

-----_

_

_

_

Thr

Thr

_

_

_

_

_

_

_

_

_

_

_

Asp Ala Ala Ala Val Val Ala

Trp _ _ _

Gly _ _ _ _

Gln Glu _ _ _ _

60

-

-

Qly

-

hg

a

Qly

-

As* Qly Tyr

-

Qly

QlyAlabg

b

90

c

Se? Ser Val Thr ----_-_-----__ ------__ Arg ________-______ _ _ _ hij GlyTyr - Gly Asn Hi6 - Aen . .. . . . Leu . . . Asp Ala

klm . . Val Ala l'yr Arg Phe Ala . .. .. . . .. .. . Tyr .. .

. Tyr . . . Ser . .. . .. . . .

.

n .

Ala

Tyr

.. . .. . Tyr Leu . . . . . . . . . .. . . .. . . .

o . Asp Val . . . . . . . . . Ql,, . . . Glu .. . -

100

Gly _ _ _ _

__

kg _ _ _

50

Ser _

Phe _

_

Gly

Leu _ _ _

Leu Arg

_ _ _

Val _ _ _ _

100 Thr _ _ _ _ _

Val _ _ _ _ _

C!ys Trp Pho Ser Ser Qly Ala Tyr Qly Tyr Qly Asp Asp Arg

Ser _ _ _ _ _

Ser _ _ _ _ _

Asn

Met Ile Ile

Ser

Ser

Ser

Lya Qly Gly

Leu Asp Gly

Thr Ala Cys

pB7S2 PBSSl P2C7.5 p4H9.1 P5H4.1 P7B7.2 P7G1.5

(PI (PI (PI (PI (PI (PI (PI

f Ala Gly Gly Ser

Ser Qly Tyr

Ser

Arg

5.04) 7.77) 9.04) 8.20) 8.66) 7.92) 6.55)

Fig. I-continued. VDJ genes (Fig. 1). A high nucleotide sequence homology

(84.2-93.5%) was observed among all the cloned bovine V, genes and four other available bovine V n genes (Fig. 2). As the nucleotide sequences of all the bovine V,

U49773b

genes from different sources analysed thus far shared a nucleotide homology of 280%, these correspond to a single bovine VH gene family which we have designated as Bov Vnl. In addition, an analysis of 44 bovine IgM-

92.4

B-11 c

93.5 92.1

Fig. 2. Percent nucleotide homologies between cloned and available rearranged bovine sequences spanning the 5’ end of FRl to the 3’ end of FR3. “GenBank U49772, bGenBank “GenBank U 11629 and dJackson et al. (1992).

V, gene U49773,

646

S. S. SAINI

et al. Clone No.

RNA Cone

BL8G4 BLBHI BL9A7 BL9B8 BL9C12 BL9F2 BL9H3 BLlOAll BLlOElZ BLlOH2 BLlOH8 BLl IF3

Fig. 3. RNA dot blot analysesof RNA from bovine IgM-secreting mouse x cattle heterohybridomas probed with a [c(-32P]dCTP radiolabeled Bov V,l gene family specific DNA probe (pB7S2). *RNA from bovine IgGl secreting heterohybridoma HB-9907 (positive control), **RNA from P3xAg8.653, mouse myeloma fusion partner (negative control) and ***RNA from non-Ig secreting heterohybridomas (negative controls). The nucleotide sequences for five clones (p2C7.5, p4H9.1. p5H4. I, p7B7.2 and p7Gl.5) are presented in Fig. la.

secreting mouse x cattle heterohybridomas prepared from polyclonally activated PBLs from a BLV infected cattle revealed that Bov V, 1 gene family was expressed in 100% of IgM-secreting heterohybridomas (Fig. 3). It should be noted that nucleotide sequences analysed from five cloned cDNAs from randomly selected Bov V, 1 + RNAs (Fig. 3) confirmed their classification in Bov Vu1 gene family (Fig. la). Further, an analysis of of 22 DNA sequences from Bov Vu1 + RNAs confirmed that these expressed Bov V,l gene family (data not shown). Other V,, genes may exist in the bovine genome. Some faintly hybridizing restriction fragments of genomic DNA were noted in Southern blots (Fig. 4) which may reflect divergent bovine V, gene sequences. An analysis Table 1, Comparative

analysis of nucleotide

Species

Clone Number

pB7S2

pB8Sl

Sheep Sheep Sheep Mouse Mouse Human

V5a (germline) VR-22 SHp7 PCGl-I N-92 58 P2

86.2 83.2 82.8 78.0 75.6 69.4

87.3 84.9 81.5 73.2 74.2 67.4

of deduced amino acid sequences revealed extensive amino acid substitutions in the CDRl and CDR2 of both IgM and IgGl antibodies (Fig. lb), which is consistent with the somatic hypermutations which appear to significantly contribute to generation of antibody diversity in cattle. However, a comparison of rearranged bovine V, genes with the germline VH gene sequences is essential to confirm these observations. The bovine VH genes shared 87.9~86.5% nucleotide homology with the sheep 4839 VH2 gene, and overall nucleotide homology of 81.886.6% with other rearranged VDJ genes from sheep (Table 1). Interestingly, a high nucleotide homology (85.687.6%) of bovine V, genes was noted with the germline sequence

sequences of the cloned bovine V, genes with other species

Percent Homology p2C7.5 p4H9.1 p5H4.1 86.2 84.5 82.5 75.3 76.6 68.4

85.6 83.5 81.8 74.9 16.6 68.7

86.6 83.2 81.8 72.9 74.9 69.8

p7B7.2

p7G1.5

Reference

86.6 83.4 83.5 71.8 13.5 67.6

87.6 85.6 83.2 74.2 76.3 69.4

Dufour et cd. (1996) Genbank 249157 Patri and Nau (1992) Stenzel-Poore et al. (1987) Czerwinski et al. (I 994) Schroeder et ul. (1987)

Bovine V, genes

641

Fig. 4. Southern blot hybridization of cattle genomic DNA from (1) Holstein Friesian, (2) Jersey, (3) Hereford, and (4) Charolais breeds. Genomic DNA digested with Ban?H I (A), EcoR I (B) and Hind III (C) restriction enzymes was subjected to electrophoresis, transferred to nytran membrane and hybridized with a [rA-3ZP]dCTP radiolabeled Bov V,l gene family specific DNA probe (pB7S2). The arrows indicate polymorphic bands. The size of molecular weight standards is shown in kilobase pairs.

of the sheep V5a V, gene (Dufour et al., 1996). The bovine V, genes shared a nucleotide sequence homology of between 71.8 and 78% with the murine PCGl-I (Stenzel-Poore et al., 1987) and N-92 (Czerwinski et al., 1994) VH genes (Table 1), the members of murine Q-52 gene family and protein sub-group 1B (Kabat et al., 1991), and 67.469.8% nucleotide homology (Table 1) with human 58-P2 V, gene (Schroeder et al., 1987) a member of the humanV, 4 gene family. Thus, the predominantly expressed single Bov Vnl gene family described here is a homologue of the murine V, Q-52 and human Vn4 gene families, which belong to the concensus mammalian group I (Tutter and Riblet, 1988a, 1989) and clan II (Kirkham et al., 1992) Vn genes. The bovine VH genes showed a conserved CDRl length of five amino acids, similar to murine VH genes. However, the CDR2 length comprised 16 amino acid residues, longer than that of murine Q-52 genes, with a CDR2 length of 11 amino acids, but similar to the CDR2 length of the human V,4 gene family (Kabat et al., 1991). In contrast to the murine CDR3 length distribution of 7-12 amino acid residues (Kabat et al., 1991) the bovine CDR3 length of rearranged VDJ genes ranged between 15 (p5H4.1) and 23 amino acids (pB8Sl). The published CDR3 length of other rearranged bovine VDJ genes

ranged between 14 and 25 amino acids (Jackson et al., 1992; Armour et al., 1994), which is consistent with our observation. The exceptionally long CDR3 length (similar to that of humans) of rearranged bovine Vn genes reflects unique characteristics of rearranged bovine Ig variable region heavy chain genes; because of the limited germline diversity in cattle, these appear to be important in antigen recognition and in the development of antibody combining sites. The contribution of heavy chain D gene segments to the CDR3 length must await the identification of bovine D genes as both germline and rearranged nucleotide sequences become available. The bovine JH gene sequence showed highest nucleotide similarity with the human Jr,4 (82.1-87.8%) human JH5 (84.689.7%), murine JH1 (74.479.5%) and murine Jn4 (74.3376.9%) genes (Table 2). When compared with the sheep JH gene sequence, the bovine J, genes shared nucleotide homology ranging between 82.1 and 87.2%. All the bovine J, gene segments shared a relatively low level of nucleotide homology with the single swine Jn gene segment (66.7-69.2%). These observations suggest that the FR4 of rearranged bovine VDJ sequences is probably encoded by at least two Jn gene segments, which are closest to human Jn4 and Jn5 gene segments. Amino acid analysis of all of the antibodies revealed

S. S. SAINI

648

et al.

Table 2. Comparative analysis of nucleotide sequencesof bovine J, gene segments with other species Species Sheep Ji, Pig JH Mouse J,l Mouse J,4 Human J,,5 Human J,4

Clone Number Vr 15 Consensus MEP 203 MEP 203 -

pB7S2

pB8Sl

87.2 66.7 74.4 76.9 84.6 87.2

82.1 66.7 79.5 74.4 84.6 82.1

Percentage Homology p2C7.5 p4H9.1 P5H4.1 84.6 69.2 76.9 76.9 89.7 87.2

that serine, leucine, threonine and glycine contributed most to the Ig heavy chain variable regions of bovine antibodies. The amino acids methionine and histidine were rarely used. Four of the seven antibodies, both IgM and IgGl, had arginine (pB7S2, p2C7.5, p7B7.2 and p7G1.5) while six of these had cysteine (pB7S2, pB8SI,p2C7.5, p4H9.1, p7B7.2 and p7G1.5) in their CDR3 (Fig. lb). The clone pB7S2 had two cysteine residues at positions 95 and 100, intervened by threonine, glycine, alanine and tyrosine. This feature, similar to humans, appears to contribute to the rigidity of CDR3. A higher degree of hydrophilicity, especially in FR3, was clearly evident in the protein sequences of all the antibodies. The PI values of these antibodies ranged between 5.04 and 9.04. The differences in PI values noted in pB7S2 (PI 5.04) and pB8Sl (PI 8.2) are probably related to the heterogenous epitopes on bovine herpesvirus 1 recognized by these antibodies. For polyclonally activated IgM antibodies the PI value ranged between 7.92 and 9.04 (Fig. lb).

Genomic complexity and polymorphism gene family

in the Boz; V,l

The genomic complexity of cloned Bov V,l gene (pB7S2) was determined in a Southern blot using BamH I, EcoR I and Nind III digested genomic DNA from cattle. A maximum number of Hind III digested DNA fragments, ranging from 13 to 15, hybridized with the Bov Vnl gene family specific DNA probe (Fig. 4). In order to determine whether bovine V, genes are polymorphic, the genomic DNA from four different breeds of cattle (Holstein, Jersey, Hereford and Charolais) was analysed. Three polymorphic RFLP patterns were evident in all the four cattle breeds studied that involved either deletion or addition of VH gene segments. Such polymorphism may be associated with inter- or intrabreed recombination as a result of cattle breeding practices. These observations provide evidence that bovine VH genes, similar to murine and human VH genes, are polymorphic and the genomic complexity of the Bov VH 1 gene family varies between 13 and 15 genes. DISCUSSION

The human and murine variable region genes of both heavy and light chains are grouped into a number of multi-gene families based on the criteria of 3 80% nucle-

84.6 69.2 76.9 76.9 89.7 87.2

82.1 69.2 76.9 74.3 84.6 84.6

p7B7.2

p7G1.5

84.6 69.2 76.9 76.9 87.8 87.8

84.6 69.2 76.9 76.9 89.7 87.2

Reference Dufour et al. (1996) Sun et al. (1994) Czerwinski et al. (1994) Czerwinski et al. (1994) Schroeder et al. (1987) Schroeder et al. (1987)

otide homology among the members of a gene family (Brodeur and Riblet, 1984; Berman et al., 1988; Kofler et al., 1992; Van Dijk et al., 1993; Mainville et al., 1996). However, certain other vertebrate species such as the chicken (Reynaud et al., 1989, 1994), rabbit (Becker and Knight, 1990; Knight, 1992), sheep (Dufour et al., 1996) and pig (Sun et al., 1994) predominantly utilize a single Vn gene family in the expressed antibody repertoire. For these reasons, elucidation of the structure and organization of Ig loci from phylogenetically distant species is essential to understand the development of antibody diversity and the evolution of the complex multigene variable region gene families. Due to the presence of placental barriers the bovine immune system develops in the absence of influences from maternal antibodies, and a majority of the bovine peripheral B lymphocytes express CD5 glycoprotein (Naessens and Williams, 1992) a marker related to B-l lymphocytes (Herzenberg et al., 1986). We have, therefore, analysed the structure and VDJ rearrangements of bovine Ig-Vn genes from two anti-bovine herpesvirusl IgG 1-secreting heterohybridomas and five bovine IgM-secreting heterohybridomas from polyclonally activated PBLs. Because of nucleotide homology of > 80%, all the cloned Vn genes, as well as four other cattle VH genes isolated from different sources (Jackson et al., 1992; Armour et al., 1994), were found to constitute a single VH gene family. We have designated this bovine V, gene family as Bov VH 1, a homologue of the human V,4 and murine Q-52 gene families which belong to mammalian group I (Tutter and Riblet, 1988a; Tutter and Riblet, 1989; Kofler et al., 1992) and clan II (Kirkham et al., 1992) V, genes. In addition, the Bov V, 1 gene family was observed to be expressed at 100% frequency among 44 mouse xcattle heterohybridomas originating from polyclonally-activated PBLs. The nucleotide sequence of twent two cDNAs (five of these sequences are shown in Fig. 1) prepared from randomly selected RNAs which tested positive for Bov VH 1 gene in the dot-blot assay showed them to belong to Bov VH1 gene family. These observations suggest that a single Bov V,l gene family is predominantly expressed in the peripheral antibody repertoire of cattle. We noted an unusually long CDR3 length in rearranged bovine VDJ gene sequences, a finding also noted by other authors (Jackson et al., 1992; Armour et al., 1994) and in recent sequencing data from our laboratory, where CDR3 length of up to 56 amino acids

Bovine Vn genes is noted (unpublished). The identification of bovine D genes is required to ascertain their contribution to this unusually long CDR3 length, possibly via D-D fusions. This is especially important as the CDR3 is located in the middle of the antibody combining site and its length is important in fitting the contour of the antigen molecule. The amino acid substitutions in the CDRl and CDR2 of the cloned bovine Vn genes of both IgM and IgGl antibodies suggest that somatic hypermutations significantly contribute to the generation of antibody diversity in cattle. However, comparison with germline V, gene sequences is essential to confirm the contribution of somatic hypermutations, and to determine if other mechanisms such as gene conversion also contribute to antibody diversity in cattle. The nucleotide sequences encoding FR4 of seven rearranged VDJ genes are most homologous to human Jn4 and Jn.5 gene segments. Based on FR4 analysis, at least two J, gene segments exist in cattle (unpublished). The genomic complexity of the designated Bov Vnl gene family ranges from 13 to 15 members. Despite the fact that the genomic DNA analysed from PBLs may include some rearranged VDJ fragments, three polymorphic RFLP patterns were noted among the four cattle breeds analysed. The faintly hybridizing restriction fragments seen most likely reflect either rearranged VDJ segments or differences in the copy number of a gene. Further investigations conducted with sperm or liver genomit DNA would be required in order to confirm the observed polymorphism. Nevertheless, the presence or absence of strongly hybridizing restriction fragments (Fig. 4) suggest polymorphism at the Ig-Vn locus. The existence of polymorphism at the Ig-V, locus of cattle, similar to that seen in other species such as mouse (Tutter and Riblet, 1988b) and human (Pincus, 1987) is of interest as ongoing inbreeding in cattle would be expected to reduce the polymorphism. Nevertheless, recombination in natural populations of cattle may be responsible for sustaining the observed polymorphism at the Ig-V, locus. In contrast to our previous observation, where homologues of the murine Vnl 1 gene were detected in a Southern blot of bovine genomic DNA (Saini et al., 1996) and to the observation that the homologues of group III Vn genes (murine V, 7183, V, S107, V, 5606 and Vn X24 and human Vn3 gene families) are conserved during evolution (Tutter and Riblet, 1988a, 1989) a single bovine Vn gene family has been consistently isolated from the expressed antibody repertoire from different sources (Jackson et al., 1992; Armour et al., 1994). It is unknown at present whether the homologues of Vnl I and other group III Vn genes, which appear by Southern blotting to be present in bovine genome, are actually expressed. The single bovine Vn gene family (Bov Vnl) defined here is closest to the single sheep Vn gene family, a homologue of the human Vn4 gene family, which predominates in the Ig variable region heavy chain repertoire of sheep (Dufour et al., 1996). Swine also express a single V, gene family, related to the human V,3 gene family (Sun et al., 1994). Similarly, a 3’ gene from a single VH gene family,

649

also related to human Vn3 gene family, preferentially rearranges in the rabbit Ig repertoire (Becker and Knight, 1990; Knight, 1992; Weinstein et al., 1994). Chicken B cells also utilize the single available functional Vn gene (and one functional Vn gene) to achieve antibody diversity via gene conversion (Reynaud et al., 1989, 1994). Similar to both the horse (Home et al., 1992) and to sheep (Reynaud et al., 1991, 1995) the A-light chain predominates in the primary antibody repertoire of cattle (Butler, 1983). Further, of the two V;, light chain gene families, the V,l gene family is predominantly expressed in the light chain repertoire of cattle (Sinclair et al., 1995). The diversity of the bovine l-light chain repertoire has been suggested to be generated through gene conversion (Parng et al., 1996). It has also been suggested that the bovine V, light chain repertoire contributes relatively little to the recognition of antigens (Sinclair et al., 1995) and, therefore, bovine V, genes are expected to contribute most to antigen recognition. It thus appears that the single V, gene family (Bov Vnl) and the single Vi1 gene family contribute most to the development of humoral immunity in cattle. This situation is in contrast to both mice and humans where multigene families, representing divergent germline sequences, contribute most to both heavy and light chain diversity. The ruminant immune system also differs from that of rabbits and swine, where a single Vn gene family, related to the human Vn3 gene family (mammalian group III), is consistently expressed (Knight, 1992; Sun et al., 1994). Both the bovine and ovine Vn genes are homologues of human Vn4 and murine Q-52 gene families, corresponding to mammalian group I V, genes which, unlike group III genes, are not highly conserved during evolution (Tutter and Riblet, 1988a, 1989). The conservation of mammalian group III Vn gene families throughout the vertebrate immune system has led to the suggestion that members of this group might be closest to the ancestral primordial genes. They are probably endowed with an important non-coding function related to the nucleotide sequences in the FRl and FR3 regions, which target a series of recombinogenic events (Tutter and Riblet, 1989). Our observations from the ruminant immune system do not support such a hypothesis, as the expressed bovine and ovine Vn genes were found to belong to relatively less conserved group I Vn genes. Further studies on other mammalian and nonmammalian Ig-Vn loci are essential to better understand the origin of the Vn genes during phylogeny. To conclude, the studies outlined here demonstrate that (i) a single bovine V, gene family (Bov Vnl), a homologue of human Vn4 and murine Q-52 gene families and corresponding to mammalian group I and clan II genes, is consistently isolated from different sources and is predominantly expressed among antigen-induced and polyclonally-activated PBLs from BLV infected cattle, (ii) the CDR3 length of the rearranged bovine VDJ genes is unusually long (15-23 amino acids), (iii) the FR4 of rearranged bovine VDJ sequences appears to be encoded by two Jn gene segments which are most homologous to human Jn4 and J,5 genes, (iv) the genomic complexity

650

S. S. SAINI

of the Bov V,l gene family ranges between 13 and 15 genes, and (v) polymorphism exists at the Ig-VH locus of cattle. Acknowledgements-The authors would like to thank Dr Brian Allore, MOBIX, McMaster University, Hamilton, Ontario, for DNA sequencing support, Dr S. Joshi, Biotechnology Center, University of Toronto, Toronto, Ontario, for oligonucleotide synthesis and Dr R. Jacobs, Department of Pathobiology, University of Guelph, for providing blood samples from BLV-infected cattle for the construction of mouse x cattle heterohybridomas. The authors also thank Dr K. Welch for providing help in the preparation of the manuscript. Surinder, S. Saini is a recipient of a studentship from the Canadian Commonwealth Scholarship and Fellowship Programme.

REFERENCES Altschul S. F., Gish W., Miller W., Myers E. W. and Lipman D. J. (1990) Basic local alignment search tool. Journal of Molecular Biology 215,403-410. Armour K. L., Tempest P. R., Fawcett P. H., Fernie M. L., King S. I., White P., Taylor G. and Harris W. H. (1994) Sequences of heavy and light chain variable regions from four bovine immunoglobulins. Molecular Immunology 31, 1369-1372. Becker R. S. and Knight K. L. (1990) Somatic diversification of immunoglobulin heavy chain VDJ genes: evidence for somatic gene conversion in rabbits. Cell 63, 987-997. Berman J. E., Mellis S. J., Pollock R., Smith C. L., Suh H., Heinke B., Kowal C., Surti U., Chess L., Cantor C. R. and Alt F. W. (1988) Content and organization of human Ig V, locus: definition of three new Vu families and linkage to the Ig Cu locus. EMBO Journal I, 721-738. Brodeur P. H. and Riblet R. (1984) The immunoglobulin heavy chain variable region (IgH-V) locus in the mouse. I. One hundred IgH-V genes comprise 7 families of homologous genes. European Journal of Immunology 14,922-930. Butler J. E. (1983) Bovine immunoglobulins: An augmented review. Veterinary Immunology and Immunoputhology 4,43152. Chomczynski P. and Sacchi N. (1987) Single step method of RNA isolation by acid guanidium thiocyanate-phenolchloroform extration. Analytical Biochemistry 162, 156159. Czerwinski M., Blackall D. P., Abrams W. R., Rubocki R. J. and Spitalnik S. L. (1994) Restricted Vu gene usage by murine hybridomas directed against the human, N, but not M, blood group antigen. Molecular Immunology 31,279-288. Dufour V., Malinge S. and Nau F. (1996) The sheep Ig variable region repertoire consists of a single V, family. Journal a/ Immunology 156,2163-2170. Emara M. G., Tout N. L., Kaushik A. and Lam J. S. (1995) Diverse V, and V, genes encode antibodies to Pseudomonas aeruginosa LPS. Journal ofImmunology 115, 3912-3921. Herzenberg L. A., Stall A. M., Lalor P. A., Sidman C., Moore W. A., Parks D. R. and Herzenberg L. A. (1986) The Ly-1 B cell lineage. Immunological Reviews 93, 81-102. Home W. A., Ford J. E. and Gibson D. M. (1992) L chain regulation in horse. I. Characterization of IgL genes. Journal of Immunology 149,3927-3936. Jackson T., Morris B. A. and Sanders P. G. (1992) Nucleotide sequences and expression of cDNAs for a bovine anti-testosterone monoclonal IgGl antibody. Molecular Immunology 29, 667-676.

et al.

Kabat, E.A., Wu, T.T., Perry, H.M., Gottesman, K.S. and Foeller, C. (1991) Sequences of Proteins of Immuno/ogical Interest, 4th Edition, United States Department of Health and Human Services, Washington, D.C. Kaushik A., Lim A., Poncet P., Ge X. and Dighiero G. (1988) Comparative analysis of natural antibody specificities among hybridomas originating from spleen and peritoneal cavity of adult NZB and BALB/c mice. Scandanavian Journal af Immunology 27,46 1-47 1. Kaushik A., Schulze D. H., Bonilla F. A., Bona C. and Kelsoe G. (1990) Stochastic pairing of heavy-chain and light-chain variable gene families occurs in polyclonally activated B cells. Proceedings of the National Academy of Science U.S.A. 81, 49324936. Kirkham P. M., Mortari F., Newton J. A., Schroeder H. W. Jr (1992) Immunoglobulin VH clan and family identity predicts variable domain structure and may influence antigen binding. EMBO Journal 11,603~609. Knight K. L. (1992) Restricted Vu gene usage and generation of antibody diversity in rabbit. Annual Review of Immunology 10, 593. Kofler R. S., Geley S., Kofler H. and Helmberg A. (1992) Mouse variable region gene families: Complexity, polymorphism and use in non-autoimmune responses. Immunological Reviews 128, 5-21. Kyte J. and Doolittle R. F. (1982) A simple method for displaying the hydropathic character of a protein. Journul af Molecular Biology 157, 105-I 32. Lipsanen, V., Walter, B., Emara, M., Siminovtch, K., Lam, J. and Kaushik, A. (1997) Restricted CDR3 length of the heavy chain is characteristic of six randomly isolated disease associated VH J558+ IgM autoantibodies in lupus prone motheaten mice. International Immunology 9, 655-664. Mainville C. A., Sheehan K. M., Klaman L. D., Giorgetti C. A., Press J. L. and Brodeur P. H. (1996) Deletional mapping of fifteen mouse VH gene families reveals a common organization for three Igh haplotypes. Journal af Immunology 156, 1038-1046. Naessens J. and Williams D. J. L. (1992) Characterization and measurement of CDS+ B cells in normal and Trypanosoma congolense infected cattle. European Journal of Immunology 22,1713-1718. Parng C. L., Hansal S., Goldsby R. A. and Osborne B. A. (1996) Gene conversion contributes to the Ig light chain diversity in cattle. Journal of Immunology 157, 5478-5486. Patri S. and Nau F. (1992) Isolation and sequence of a cDNA coding for the immunoglobulin p chain of the sheep. Moleculur Immunology 29,8299836. Pincus S. H. (1987) Human immunoglobulin heavy chain variable (Vu) region gene families defined by hybridization with cloned human and murine V, genes. Human Immunology 22, 1999215. Reininger L., Kaushik A., Izui S. and Jaton J.-C. (1988) A member of a new V, gene family encodes anti-bromelinized mouse red blood cell autoantibodies. European Journal af immunology 18, 1521-1526. Reynaud C.-A., Bertocci B., Dahan A. and Weill J.-C. (1994) Formation of the B-cell repertoire: ontogenesis, regulation of Ig gene rearrangement, and diversification by gene conversion. Advunces in Immunology 57, 353-378. Reynaud C.-A., Dahan A., Anquez V. and Weill J.-C. (1989) Somatic hyper-conversion diversifies the single Vu gene of the chicken with a high incidence in the D region. Cell 59, 17ll183. Reynaud C.-A.. Garcia C., Heil W. R. and Weill J.-C. (1995)

Bovine Vn genes Hypermutation generating the sheep immunoglobulin repertoire is an antigen-independent process. Cell 80, 115-l 25. Reynaud C.-A., McKay C. R., Muller R. G. and Weill J.C. (1991) Somatic generation of diversity in a mammalian primary lymphoid organ: the sheep ileal Peyer’s patches. Cell 64,995-100.5. Saini, S.S., Teo, K., Nangpal, A., Mallard, B.A. and Kaushik, A. (1996) Homologues of murine Vhl 1 gene are conserved during evolution. Experimental und Clinical Immunogenetics. 13, 154160. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. In A Laboratory Manual, 2nd Edition, (Edited by N. Ford, C. Nolan and M. Ferguson), pp. 11724. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Schroeder H. W. Jr, Hillson J. L. and Perimutter R. M. (1987) Early restriction of the human antibody repertoire. Science 238,79 l-793. Sinclair M. C., Gilchrist J. and Aitken R. (1995) Molecular characterization of bovine V>” regions. Journal qf’lmmunolog? 155,3068-3078. Stenzel-Poore M. P., Hall T. J., Heusser C. H., Faust C. H. and Rittenberg M. B. (1987) Immunologic memory to PC-KLH: Participation of the Q-52 V, gene family. Journal of Immunology 139, 1698-l 703. Sun J., Kacskovics I., Brown W. R. and Butler J. E. (1994) Expressed swine Vi, genes belong to a small V, family homologous to human V, III. Journal of ImmunologUv 153, 56185627.

651

Symons D. B. A., Clarkson C. A. and Beale D. (1989) Structure of bovine immunoglobulin constant region heavy chain gamma 1 and gamma 2 genes. Molecular Immunology 26, 841-850. Tizard, I. (1992) Veterinary Immunology: An Introduction, 4th Edition. W B Saunders Company, Harcourt Brace Jovanovich Inc., Philadelphia. Tonegawa S. (1983) Somatic generation of antibody diversity. Nature 302, 575-58 1. Tutter A. and Riblet R. (1988a) Selective and neutral evolution in the murine Igh-V locus. Current Topics in Microbiology and Immunology 137, 107-l 15. Tutter A. and Riblet R. (1988b) Duplication and deletion of Vh genes in inbred strains of mice. Immunogenetics 28, 1255 135. Tutter A. and Riblet R. (1989) Conservation of an immunoglobulin variable-region gene family indicates a specific non-coding function. Proceedings of the National Academy qf Science U.S.A. 86, 7460-7464. Van Dijk K. W., Mortari F., Kirham P. M., Schroeder H. W. Jr and Milner E. C. B. (1993) The human immunoglobulin V,7 gene family consists of a small, polymorphic group of six to eight gene segments dispersed throughout the V, locus. European Journal of Immunology 23,832-839. Weinstein P. D., Anderson A. 0. and Mage R. G. (1994) Rabbit IgH sequences in appendix germinal centers: V, diversification by gene conversion-like and hypermutation mechanisms. Immunitv 1, 647-659.