A small protein-protein interaction domain common to KlcB and global regulators KorA and TrbA of promiscuous IncP plasmids1

doi:10.1006/jmbi.2001.4729 available online at http://www.idealibrary.com on

J. Mol. Biol. (2001) 310, 51±67

A Small Protein-Protein Interaction Domain Common to KlcB and Global Regulators KorA and TrbA of Promiscuous IncP Plasmids Anuradha Bhattacharyya and David H. Figurski* Department of Microbiology College of Physicians and Surgeons, Columbia University New York, NY 10032, USA

The kor regulon of broad host-range, incompatibility group P (IncP) plasmids uses the KorA, KorB, and KorC repressors to regulate expression of genes for replication, conjugation, segregation, and host range. One operon, kilC, encodes the KorC repressor and two genes of unknown function (klcA and klcB). The predicted sequences of the 51.1 kDa KlcB protein, the 11.3 kDa KorA repressor, and another small (13.5 kDa) regulatory protein, TrbA, show a highly related 35 amino acid residue segment (V-L-P domain). We found that induction of the klcB gene is toxic to Escherichia coli host cells harboring an IncP plasmid. We con®rmed a model in which the V-L-P domain of KlcB interacts directly with the V-L-P domain of KorA to derepress KorA-regulated operons, thereby allowing expression of toxic genes. First, a lacZ reporter fused to the kleA promoter, which is regulated by KorA and KorC, revealed that klcB induction speci®cally releases KorA-repression but has no effect on KorC repression. Second, induced expression of the V-L-P domains from KorA or KlcB is suf®cient to release KorA-repression at the kleA promoter. Third, puri®ed GST-KlcB fusion protein interacts speci®cally with His-tagged KorA. Fourth, fusion of the V-L-P domains of KorA and TrbA and full-length KlcB polypeptide to the DNA-binding domain of bacteriophage l repressor leads to the formation of functional, dimeric repressors, and mutations that alter conserved residues of the V-L-P domain adversely affect dimerization. Fifth, crosslinking experiments demonstrated that the V-L-P domain of KorA is able to dimerize in solution and form heterodimers in mixtures with full-length KorA polypeptide. These ®ndings show that the V-L-P domain is a protein-protein interaction module that is likely to be responsible for dimerization of KorA and TrbA, and important for KlcB dimerization. We speculate on the possible signi®cance of KlcB-KorA heterodimers in IncP plasmid maintenance. # 2001 Academic Press

*Corresponding author

Keywords: incompatibility group P; broad host-range plasmid; repressor; homodimer; heterodimer

Introduction

Abbreviations used: IncP, incompatibility group P; V-L-P domain, domain containing a Val-Leu-Pro sequence, found in the six known IncP proteins; Tn1, ampicillin resistance-encoding transposon; EOP, ef®ciency of plating; l-DB, DNA-binding domain of l repressor; GST, glutathione-S-transferase; DSP, dithiobis(succinimidylpropionate). E-mail address of the corresponding author: ®[email protected] 0022-2836/01/010051±17 $35.00/0

Plasmids of incompatibility group P (IncP) have received considerable attention for their broad conjugative and replicative host ranges. Among the IncP plasmids, the virtually identical IncPa plasmids RK2, RP1, RP4, R68, and R995,1,2 as well as the related IncPb plasmid R751,3 are the best studied. These plasmids can facilitate gene transfer between diverse organisms, including Gram-negative and Gram-positive bacteria, and several species of yeast,2,4 ± 8 and they can be maintained as autonomously replicating and stably inherited # 2001 Academic Press

52 elements in a wide variety of Gram-negative bacteria.9,10 The molecular details of plasmid replication control, inheritance, and conjugative transfer are not well understood, and the remarkable ability of IncP a plasmids to perform these functions in diverse genera of bacteria has made them important experimental models. Studies of IncP plasmids should help reveal the extent and details of plasmid-host interactions and provide a greater understanding of the evolution of extrachromosomal elements. RK2 is a 60,099 bp, self-transmissible IncPa plasmid originally isolated from an antibiotic-resistant Klebsiella aerogenes strain cultured from a burn wound infection.2,11 The plasmid is maintained at the relatively moderate copy number of ®ve to ten plasmids per chromosome.12,13 Conjugative transfer of RK2 requires at least 19 plasmid-encoded genes that direct mating pair formation and DNA processing.2 In all the hosts tested, it was found that vegetative replication of RK2 involves a single plasmid gene, trfA, which is both necessary and suf®cient for initiation of replication at the origin of replication, oriV.14 ± 17 However, a minimal replicon, consisting of trfA and oriV, is not suf®cient to confer the remarkable stability exhibited by RK2 in its various hosts, thus demonstrating the need for additional plasmid maintenance functions.15,18 Studies have revealed three plasmid loci (kilE, par, incC/korB) that are involved in the stabilization of RK2 in host cells. The kilE locus is required for stable maintenance of RK2 in Pseudomonas aeruginosa, but not Escherichia coli, by an unknown mechanism.13 The par locus codes for two distinct plasmid maintenance functions. The parDE operon speci®es a post-segregational toxicity system that arrests or kills plasmidless segregants resulting from cell division,19,20 and the adjacent, divergently transcribed parCBA operon encodes a multimer resolution system to maintain the maximal number of segregating units.21,22 The relative importance of parDE and parCBA varies from host to host.10 The incC/korB region speci®es three elements required for active partition of RK2 plasmid molecules at cell division: IncC, a predicted ATPase related to the ParA family of partition proteins; KorB, a sitespeci®c DNA-binding protein that both functions as a transcriptional repressor and interacts with IncC; and a KorB-binding site. These elements are predicted to form a nucleoprotein complex that participates in plasmid pairing, interaction with an as yet unidenti®ed host DNA partition machinery, and subsequent segregation of plasmids to the daughter cells at cell division.23,24 We have suggested that the kilC locus, located directly upstream of kilE, may also function in the stable maintenance or host-range of IncP plasmids.25,26 The locus speci®es an operon of three genes (klcA, klcB, and korC) (Figure 1). The last gene of the operon, korC, encodes a transcriptional repressor of the kor regulon, a regulatory network on IncP plasmids consisting of multiple plasmid operons involved in replication control, conjuga-

Protein-Protein Interaction Domain

Figure 1. The kilC operons of IncPa plasmids RK2 and R995. The klcA, klcB, and korC genes (arrows) are described in the text. p indicates promoters, which are co-regulated by the KorA and KorC repressors; t is a putative transcriptional terminator. In RK2, the klcB gene is interrupted by transposon Tn1, and the korC gene is expressed from the b-lactamase promoter (p) within Tn1 .26,29

tive transfer, DNA segregation, and host range.2,25,27 KorC and another repressor, KorA, act together to control the promoters for the kilC operon and the kleA and kleD operons of the kilE locus.28 ± 30 In RK2, the kilC operon is disrupted by a transposon Tn1 insertion within the klcB gene, whereas the kilC operon of the nearly identical IncPa plasmid R995 is intact (Figure 1).26 The product of the ®rst gene of the kilC operon, klcA, is a 15.9 kDa acidic polypeptide whose sequence shows 31 % identity with the ArdB antirestriction protein of the IncN plasmid pKM101, but no antirestriction activity of KlcA has been detected.26 The predicted product of the second gene of the kilC operon, klcB, is a 51.1 kDa polypeptide of unknown function. An interesting feature of the KlcB polypeptide is that it shares signi®cant sequence similarity with two regulatory proteins of IncP plasmids.26,31 The C-terminal 35 amino acid residues of the small transcriptional repressors KorA (11.3 kDa) and TrbA (13.5 kDa) resemble an internal segment of the much larger KlcB polypeptide (Figure 2). The six known proteins of IncP plasmids display amino acid identities at ten positions within the 35 amino acid residue region, suggestive of an important function. We have designated these peptide segments as V-L-P domains, because the motif includes a Val-Leu-Pro sequence. Here, we report that KlcB is capable of interacting with KorA. Using genetic and biochemical approaches, we have determined that the V-L-P domains of KlcB, KorA, and TrbA function in protein-protein interaction. We consider the possible roles of this domain in both homodimer and heterodimer formation.

Results klcB induction is toxic to cells containing an IncP plasmid A common property of plasmid maintenance systems is that they are exquisitely sensitive to the

53

Protein-Protein Interaction Domain

Figure 2. (a) Alignment of the V-L-P domains of KorA, TrbA, and KlcB polypeptides from IncP plasmids. RK2 and R995 are IncPa plasmids,1,2 R7513 and pS1232 are IncPa plasmids; and pLV400 is an uncharacterized IncP plasmid.68 The nucleotide sequences of the R995 korA gene and the TrbA(V-L-P) coding region are identical with those of RK2 (data not shown). The R995 klcB gene was also sequenced and found to be identical with RK2 klcB lacking the Tn1 insertion (data not shown). Numbers show residue positions within the polypeptide; * indicates the C terminus; and > indicates that the sequence is incomplete. (b) The V-L-P motif sequence. Numbers 1-35 refer to the residue position within the V-L-P domain.

stoichiometry of their components, such that elevated expression of one component can cause plasmid loss in a growing population of cells.32 To test the possibility that KlcB is involved in IncP plasmid maintenance, we placed the klcB gene downstream of the IPTG-inducible tac promoter on a plasmid vector (Table 1). Because the RK2 klcB gene is interrupted by a Tn1 insertion (Figure 1), we used the intact klcB gene of the closely related IncP plasmid R995. Its sequence was found to be identical with the RK2 klcB gene without the Tn1 insertion. Induction of tacp-klcB had no effect on the growth of the host cells, as determined by plating on medium containing IPTG (Table 2, lines 1 and 2). We next tested the effect of klcB induction on the maintenance of the IncP plasmid R995. The ef®ciency of plating (EOP) was reduced more than 100-fold on medium containing selection for both R995 and the tacp-klcB plasmid (Table 2, lines 3 and 4). This is the expected result if overexpression of klcB interferes with the maintenance of R995. The EOP was also reduced without selection for R995 (i.e. selecting only for the tacp-klcB plasmid), thus indicating that klcB induction is toxic to the R995 strain. Because R995, like RK2, carries the parDE post-segregational toxicity system, it was expected that any loss of R995 induced by klcB expression would trigger the parDE system and kill plasmidless segregants. However, we were surprised that R995
par (pR9125), which lacks parDE, also reduced the EOP in the absence of selection (Table 2, lines 5 and 6). This result indicated that klcB induction causes an R995-dependent, but parDE-independent, toxicity to host cells. Similar results were obtained for RK2 and RK2
par, although the toxicity was apparent as tiny pinpoint colonies rather than a reduction in EOP. The effect of klcB induction was tested on the RK2
trfA derivative, pRK21591, which replicates using the P1 plasmid replication system. klcB toxicity was again evident (Table 2, lines 7 and 8). In contrast, klcB induction had no effect on a miniRK2 plasmid pRR10, which contains only the repli-

cation determinants trfA and oriV. These results show that klcB-mediated toxicity does not result from interference with RK2 replication. The korA-kfrA region allows klcB-mediated toxicity To identify the IncP plasmid element(s) required for klcB-mediated toxicity, we tested several RK2 derivatives and cloned segments for the ability to trigger host toxicity in the presence of induced klcB. Except for the mini-RK2 replicon tested above, all the plasmids we tested conferred toxicity in the presence of induced klcB, although the degree of toxicity varied among the derivatives, indicating that more than one region may be involved in the toxicity (data not shown). One of the smallest IncP derivatives to confer sensitivity to klcB induction was pRK2101, a plasmid containing the RK2 korA and kfrA operons (Table 3). Models for klcB-mediated toxicity We considered two models for klcB-mediated toxicity: (1) the presence of a second unidenti®ed post-segregational toxicity system induced by plasmid loss; and (2) repressor titration, in which KlcB interferes with the regulation of toxic genes on IncP plasmids. The ®rst model was ruled out because plasmid loss induced by expression of incC, a known maintenance gene, fails to trigger host toxicity unless the parDE region is present.24 The second model is particularly appealing for several reasons. The kor regulon of IncP plasmids contains several potentially toxic genes regulated by KorA, KorB, KorC and TrbA, including incC and korB present on plasmid pRK2101.2,24,25 A related plasmid that is deleted for incC does not confer toxicity in the presence of klcB (data not shown). Two of the repressors, KorA and TrbA, display signi®cant similarity with an internal 35 amino acid residue segment of KlcB (Figure 2). If these segments, designated V-L-P domains, are involved in protein-protein interactions, elevated expression of KlcB might cause titration of KorA and TrbA and

Table 1. Plasmids Plasmid

Selective marker(s) r

Genotype or relevant properties q

pAB1 pJAK13 pJAK17 pJH157 pJH391

Sp Spr Cmr Apr Apr

lacI tacp, 10 His-tag lacIq tacp lacIq tacp lcI‡ lcI(DB)

RK2 pRK2101 pRK2292

TcrApr Kmr Apr Tpr

klcB::Tn1 korA‡incC‡korB‡korF‡korG‡upf54.8‡ f(catp-korA‡)

pRK2462

Cmr

f(tetp-korC‡)

pRK21591

Apr Kmr Tcs Lac‡ Tpr

tetA::lacZYA‡
trfA::P1ori

pRK21724 R995 pR9109 pR9120 pR9125 pR9155 pR9210 pR9211 pR9233 pR9235 pR9242

Apr Lac‡ Kmr Tcr Spr Cmr Spr Kmr Tcr Apr Apr Apr Spr Spr Kmr Tcr

f(kleAp-lacZ‡) klcB‡ lacIq f (tacp-klcB) lacIq f (tacp-klcB)
par1 f (T7 f10p-gst-klcB) f (T7 f10p-his-korA) f (T7 f10p-his-korA(V-L-P)) f (tacp-his-korA(V-L-P)) f (tacp-his-klcB(V-L-P))
klcAB

pR9295 pR9297 pR9305 pR9311 pR9323 pR9325 pR9341 pR9343 pR9362 pR9363 pR9364 pR9365 pR9366 pR9367 pRR10 pZ150

Apr Apr Apr Apr Apr Apr Apr Apr Apr Apr Apr Apr Apr Apr Apr Apr

f(lcI(DB)-korA(V-L-P)( f(lcI(DB)-klcB(V-L-P)) f(lcI(DB)-trbA(V-L-P)) f(lcI(DB)-klcB) f(lcI(DB)-korA) f(lcI(DB)-korA(1-42)) f(lcI(DB)-korA(43-101)) f(lcI(DB)-korA(1-61)) fcI(DB)-korA(V-L-P) V76A) f(lcI(DB)-korA(V-L-P) L77Q) f(lcI(DB)-korA(V-L-P) W89R) f(lcI(DB)-korA(V-L-P) L77M) f(lcI(DB)-klcB V325A) f(lcI(DB)-klcB V325D) trfA‡oriV‡ vector

a b c

J. A. Kornacki. E. A. Sia and D. H. F. J. W. Wilson and D. H. F.

Description IncQ replicon, expression vector for His-tagged fusions IncQ replicon; expression vector IncQ replicon; expression vector Carries the wild-type lambda repressor gene Cloning vector to construct fusions with coding region for lcI DNA-binding domain IncPa plasmid pMB1 replicon with 6-kb segment of RK2 pSM1 replicon with RK2 korA expressed constitutively from the cat promoter P15A replicon with RK2 korC expressed constitutively from the tet promoter RK2lac with trfA deleted and replaced with the P1 ori and a trimethoprim resistance marker; requires P1 repA in trans RK2 kleA promoter fused to lacZ on a mini-F replicon IncPa plasmid pJAK13 with R995 klcB coding region fused to tacp pJAK17 with R995 klcB coding region fused to tacp R995 with par region deleted and replaced with a Spr marker Expresses GST-KlcB Expresses His-KorA Expresses His-tagged V-L-P domain of KorA Expresses His-tagged V-L-P domain of KorA Expresses His-tagged V-L-P domain of KlcB R995 with klcAB region deleted and replaced with an XbaI site Expresses lcI(DB)-KorA(V-L-P) (Figure 5) Expresses lcI(DB)-KlcB(V-L-P) Expresses lcI(DB)-TrbA(V-L-P) Expresses lcI(DB)-KlcB Expresses lcI(DB)-KorA (Figure 5) Expresses lcI(DB)-KorA(N terminus) (Figure 5) Expresses lcI(DB)-KorA(
N terminus) (Figure 5) Expresses lcI(DB)-KorA(
C terminus) (Figure 5) Expresses lcI(DB)-KorA(V-L-P) V76A Expresses lcI(DB)-KorA(V-L-P) L77Q Expresses lcI(DB)-KorA(V-L-P) W89R Expresses lcI(DB)-KorA(V-L-P) L77M Expresses lcI(DB)-KlcB V325A Expresses lcI(DB)-KlcB V325D Mini-RK2 Vector control for pJH391 and derivatives

Reference or source This study

a a

53 33 2 12 66 29 b c 1

This This This This This This This This This

study study study study study study study study study

This This This This This This This This This This This This This This

study study study study study study study study study study study study study study

67 53

55

Protein-Protein Interaction Domain Table 2. Requirements for klcB-mediated toxicity Selective for R995a ÿIPTG ‡IPTG Relevant properties

Plasmid None

-

R995

Wild-type

pR9125


par

pRK21591


trfA::P1 orie

pRR10

Mini-replicon

Induced plasmid Vector tacp-klcB‡, Vector tacp-klcB‡, Vector tacp-klcB‡, Vector tacp-klcB‡, Vector tacp-klcB‡,

c,d c,d d c c

a

Non-selective for R995a ÿIPTG ‡IPTG

EOPb

EOPb

EOP

EOPb

N/A N/A 1.1 1.1 0.7 0.7 0.6 0.6 1.1 1.6

N/A N/A 1.4 <0.01 1.1 <0.01 1.3 <0.01 1.6 1.7

1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0

2.8 1.3 1.4 <0.01 1.5 <0.01 1.1 <0.01 1.2 0.9

klcB-induced toxicity ÿ ‡ ‡ ‡ ÿ

‡

Media also contained selection for the tacp-klcB plasmid. EOP normalized to non-selective condition without IPTG. pR9109. d pR9120. e Strain BR2943 was used for this plasmid; strain EKA335 was used for all others. b c

derepression of toxic operons. We next tested several predictions of this model. KlcB interferes specifically with repression by KorA One prediction of the repressor titration model is that klcB induction will derepress a KorA-regulated promoter. To test this prediction, we used a fusion of the RK2 kleA promoter and the lacZ reporter gene on a low-copy mini-F vector. The kleA promoter is regulated by both KorA and KorC, which bind separate, non-overlapping operators.30 Each protein can independently reduce expression from the kleA promoter, although tightest repression occurs when KorA and KorC act together. We made strains carrying the kleAp-lacZ reporter and plasmids expressing korA, korC, or both. The strains also carried either the IncQ tacp vector or the tacp-klcB plasmid. Liquid b-galactosidase assays were done on cells grown in the presence or absence of IPTG. The results show that klcB induction released KorA repression of kleAp-lacZ by 40-fold (Figure 3(a)). Even in the absence of IPTG, there was a reproducible threefold increase in lacZ expression. Thus, even low-level expression of klcB, presumably resulting from the leakiness of the tac

promoter, caused detectable release of KorA repression. In contrast, klcB induction had no effect on KorC repression (Figure 3(b)). When both KorA and KorC were present, induction of klcB caused a sixfold increase in lacZ expression (Figure 3(c)). The b-galactosidase levels were similar to that observed when the kleA promoter was regulated by KorC alone. These results show that klcB induction causes a KorA-speci®c derepression of the kleA promoter. The V-L-P domain is sufficient to interfere with repression by KorA We next tested the prediction that the V-L-P domains present in KlcB, KorA, and TrbA (Figure 2) are involved in the derepression of KorA-regulated promoters. If the V-L-P domain mediates protein-protein interaction, then it may be suf®cient to interfere with KorA regulation of the kleA-lacZ promoter. To test this possibility, we constructed a gene fusion that expresses the C-terminal V-L-P fragment of KorA (pR9233). A similar fusion was constructed to express the internal V-L-P domain of KlcB (pR9235). Both gene fusions were cloned downstream of the tac promoter in plasmid vectors, and induction with IPTG resulted in the appearance of appropriately sized

Table 3. korA-kfrA region allows klcB-mediated toxicity EOPa Test plasmid None pRK2101 a

Relevant properties korA‡incC‡korB‡korF‡korG‡kfrA‡upf54.8‡

Induced plasmid Vector tacp-klcB‡,b Vector tacp-klcB‡,b

EOP ˆ (CFU on medium with IPTG)/(CFU on medium without IPTG). b pR9109.

ÿIPTG

‡IPTG

1.0 1.0 1.0 1.0

2.8 1.3 0.9 0.08

klcB-mediated toxicity ÿ ‡

56

Protein-Protein Interaction Domain

polypeptides, as determined by SDS-PAGE (data not shown). Like the full-length KlcB protein, both KorA(V-L-P) and KlcB(V-L-P) caused toxicity to host cells when expressed in trans to R995 (data not shown), suggesting that the short peptides were functional. To determine if KorA(V-L-P) and KlcB(V-L-P) were able to interfere with KorA-mediated repression, we tested their effects on the kleAp-lacZ reporter, as described above. Upon induction, KorA(VL-P) and KlcB(V-L-P) were able to release KorA repression at the kleA promoter by tenfold and 12-fold, respectively (Figure 4(a)). This effect was not caused by the His-tag at the N-termini of the peptides because an unrelated His-tagged protein (His-KleD) had no effect on KorA regulation (data not shown). In contrast to the effects on KorA, the KorA(V-L-P) and KlcB(V-L-P) peptides did not interfere with KorC repression of kleAp-lacZ (Figure 4(b)). Therefore, like the full-length KlcB protein, both KorA(V-L-P) and KlcB(V-L-P) peptides interfere speci®cally with KorA regulation. Furthermore, these results show that the V-L-P domain is suf®cient for this effect. The V-L-P domain is sufficient for dimerization in vivo

Figure 3. Effect of KlcB on KorA and KorC repression of kleAp-lacZ. The tacp-klcB plasmid pR9109 (®lled columns) and the tacp vector pJAK13 (shaded columns) were tested for their ability to release KorA and/or KorC repression of the kleAp-lacZ reporter (pRK21724) in the absence (ÿ) or presence (‡) of IPTG, as described in Materials and Methods. (a) Effect of klcB on repression by KorA alone. (b) Effect of klcB on repression by KorC alone. (c) Effect of klcB on repression by both KorA and KorC. KorA was provided by plasmid pRK2292, and KorC, by pRK2462. Where appropriate, IPTG was added to 1 mM. lacZ expression was measured by assaying b-galactosidase units. In the absence of any repressor, b-galactosidase units were >15,000. Note the different scales on the y-axes. Assays were done in triplicate; standard deviations are shown by error bars (not visible on all columns).

To test if the V-L-P domain is suf®cient to promote protein-protein interaction, we used a reporter for protein dimerization in vivo based on the bacteriophage l cI repressor.33 The DNA-binding domain of l repressor (l DB) is in the N-terminal domain, and dimerization is mediated by the C-terminal domain.34 The l DB domain can be fused to polypeptides of interest to test for dimerization, which is indicated by immunity to superinfecting homoimmune l phage and repression of a l PR-lacZ reporter.35 To test the V-L-P domains of KorA, KlcB, and TrbA for their ability to promote dimerization, we placed their coding regions in-frame with the coding region for the l DB on plasmid pJH391. Since KorA is known to function as a dimer,36 we also constructed a l DB-KorA(full-length) fusion (pR9323), as well as derivatives of l DB-KorA that lack the V-L-P domain (pR9343), lack the N-terminal 42 amino acid residues (pR9341), or contain only the N-terminal 42 residues of KorA (pR9325) (Figure 5). Plasmid pJH157, which expresses a fulllength l repressor, served as a positive control, and plasmids pZ150 (vector) and pJH391, which express the l DB domain only, were used as negative controls. Strains carrying these plasmids were assayed for their sensitivity to phage lKH54 (cI ÿ) and repression of the lPR-lacZ reporter (Table 4). As expected, the positive control strain with pJH157 was immune to superinfection by lKH54, as determined by EOP, and it exhibited a repressed level of expression of lPR-lacZ, as shown by b-galactosidase assays. The negative control strains with pZ150 or pJH391 were sensitive to superinfection,

Protein-Protein Interaction Domain

57 in this system. The absence of the N-terminal 42 residues of KorA (pR9341) did not diminish immunity to l superinfection or repression of lPR-lacZ. In contrast, the absence of the C-terminal V-L-P domain of KorA (pR9343) abolished both superinfection immunity and repression of lPR-lacZ. Conversely, the l DB-KorA(V-L-P) fusion (pR9295) was suf®cient to form completely functional dimers, as revealed by superinfection immunity and repression of lPR-lacZ, whereas the l DBKorA(1-42) fusion containing the N terminus (pR9325) was inactive. Western blot analysis with anti-l DB antibody showed that all these KorA fusions were expressed (data not shown). The results indicate that the V-L-P domain is both necessary and suf®cient for dimerization of KorA. We also found that the l DB-TrbA(V-L-P) fusion (pR9305) was similarly able to repress lPR-lacZ and provide immunity to superinfection (Table 4). Full-length KlcB fused to the l DB domain (pR9311) was also able to form dimers, but fusion of the V-L-P domain of KlcB (pR9297) did not yield functional repressor. Whether the internal V-L-P domain of KlcB cannot fold properly in the context of the l DB domain or whether this re¯ects a property of the KlcB(V-L-P) domain is not known. Nevertheless, our results demonstrate that the V-L-P domains of KorA and TrbA are suf®cient to mediate protein-protein interaction in vivo. Evidence for the role of the V-L-P in KlcB dimerization is provided below. V-L-P point mutants defective in dimerization

Figure 4. Effect of KorA(V-L-P) and KlcB(V-L-P) on KorA and KorC repression of kleAp-lacZ. The korA(V-LP) plasmid pR9233 (hatched columns), the klcB(V-L-P) plasmid pR9235 (open columns), the klcB plasmid pR9109 (®lled columns) and the vector control plasmid pAB1 (shaded columns) were tested for their ability to release KorA and/or KorC repression of the kleAp-lacZ reporter (pRK21724) in the absence (ÿ) or presence (‡) of IPTG, as described in Materials and Methods. (a) Effects on repression by KorA alone. (b) Effects on repression by KorC alone. KorA was provided by plasmid pRK2292, and KorC, by pRK2462. Where indicated, IPTG was added to 0.1 mM. (At 1 mM IPTG, the V-L-P fragments were toxic.) lacZ expression was measured by assaying b-galactosidase units. In the absence of any repressor, b-galactosidase units were >15,000. Note the different scales on the y-axes. Assays were done in triplicate; standard deviations are shown by error bars (not visible on all columns).

and they showed little or no repression of lPRlacZ. We found that the strain carrying the lDBKorA(full-length) fusion (pR9323) was immune to superinfection and showed high levels of repression at lPR-lacZ, just as the positive control, thus demonstrating that KorA can mediate dimerization

We used a PCR-based random mutagenesis strategy to obtain point mutants of the KorA(V-LP) domain. The mutagenized V-L-P-encoding fragments were used to construct a library of fusions with l DB. Clones were initially screened for sensitivity to phage KH54 (cI ÿ). Four mutants (plasmids pR9362 to pR9365) were obtained and characterized further. All four mutants were found to be sensitive to superinfection and unable to repress lPR-lacZ (Table 4). Western blot analysis con®rmed that all four mutant proteins were expressed (Figure 6(b)). Each of the mutants contained a single amino acid change that affected an absolutely conserved residue of the V-L-P domain (Figure 6(a)). Three mutants were altered in the Val or Leu residues of the V-L-P string, and the fourth showed a change of the conserved Trp residue. As shown in the previous section, the KlcB(V-LP) domain was unable to mediate dimerization of l DB, whereas full-length KlcB was. To determine if dimerization by full-length KlcB required the V-L-P domain, we used site-directed mutagenesis to alter the Val residue shown above to be required for dimerization of the KorA(V-L-P) domain. We obtained two mutants: Val ! Ala and Val ! Asp (Figure 6(c)). The Val ! Asp change in the l DBKlcB fusion abolished both superinfection immunity and repression of lPR-lacZ (Table 4; pR9367).

58

Protein-Protein Interaction Domain

Figure 5. Schematic showing portions of KorA present in l DB fusion proteins. Plasmids expressing the different fusions are listed on the left. The top line shows full-length KorA polypeptide (101 residues). The predicted helixturn-helix domain (HTH) and the V-L-P domain (V-L-P) are indicated by the arrows. N is N terminus; C, C terminus. Black lines show the portions of KorA present in the different fusion proteins. Numbers refer to the amino acid residues at the end points. Dimerization summarizes the KorA results from Table 4.

Surprisingly, the Val ! Ala change, which inactivated the l DB-KorA(V-L-P) fusion, caused only a partial defect in the context of l DB-KlcB(fulllength) (Table 4; pR9366). The EOP of lKH54 was reduced relative to the positive controls and the plaques were small and turbid. Repression of lPRlacZ was less, but still signi®cant. Western blot analysis con®rmed that both mutant fusion proteins were fully expressed (Figure 6(d)). Thus, the Val ! Ala mutant had a stronger effect in the context of KorA(V-L-P) than with full-length KlcB, indicating possibly that this residue has a more important role in KorA dimerization than in KlcB. Nevertheless, we conclude from these studies that

the conserved residues of the V-L-P domain are important to protein-protein interaction. The V-L-P domain is sufficient for dimerization in vitro We asked if the V-L-P domain can dimerize in vitro. His-tagged full-length KorA (His-KorA) and His-KorA(V-L-P) were puri®ed by af®nity chromatography, and dimers were assayed by SDS-PAGE after treatment with the cross-linking agent DSP (Figure 7). Both full-length His-KorA (lanes 1 and 2) and the His-KorA(V-L-P) peptide (lanes 3 and 4) yielded new species (D and d)

Table 4. Activity of l cI fusion proteins Plasmid pZ150 pJH391 pJH157 pR9323 pR9295 pR9343 pR9325 pR9341 pR9305 pR9311 pR9297 pR9362 pR9363 pR9364 pR9365 pR9366 pR9367 a b c

Repressor None lcI(DB) lcI lcI(DB)-KorA lcI(DB)-KorA(V-L-P) lcI(DB)-KorA(
C term) lcI(DB)-KorA(N term) lcI(DB)-KorA(
N term) lcI(DB)-TrbA(V-L-P) lcI(DB)-KlcB lcI(DB)-KlcB(V-L-P) lcI(DB)-KorA(V-L-P) V76A lcI(DB)-KorA(V-L-P) L77Q lcI(DB)-KorA(V-L-P) W89R lcI(DB)-KorA(V-L-P) L77M lcI(DB)-KlcB V325A lcI(DB)-KlcB V325D

EOPa

Sensitivity to lKH54

% Repression of lPR-lacZb

1.0 0.9 <10ÿ6 <10ÿ6 <10ÿ6 0.9 0.8 <10ÿ6 <10ÿ6 <10ÿ6 0.8 0.5 0.5 0.8 0.8 0.2c 0.6

Sensitive Sensitive Immune Immune Immune Sensitive Sensitive Immune Immune Immune Sensitive Sensitive Sensitive Sensitive Sensitive Sensitive Sensitive

0 18  5 92  3 93  2 95  2 16  1 20  1 70  4 74  2 70  3 25  1 40  1 31  2 33  4 30  1 49  1 19  1

EOP ˆ EOP normalized to the vector strain. % Repression ˆ 1 ÿ (b-Gal units with repressor/b-Gal without repressor)  100. Small and turbid plaques.

59

Protein-Protein Interaction Domain

Figure 6. Dimerization-defective V-L-P mutants. (a) and (c) Amino acid changes in the V-L-P mutants of l DBKorA(V-L-P) and l DB-KlcB(full-length), respectively. Bold letters show residues present in all V-L-P domains (see Figure 2). (b) and (d) Western blot analyses of the mutant fusion proteins with anti-l DB polyclonal antibody. (b) l DB-KorA(V-L-P) mutants. Lanes: 1, wild-type (pR9295); 2, V76A (pR9362); 3, L77Q (pR9363); 4, W89R (pR9364); 5, L77 M (pR9365). (d) l DB-KlcB(full-length) mutants. Lanes: 1, wild-type (pR9311); 2, V325A (pR9366); 3, V325D (pR9367). The positions of the fusion proteins are indicated by the arrows. The doublet bands are always seen with KlcB(full-length) derivatives.

migrating at the expected positions for dimers. When His-KorA and His-KorA(V-L-P) were mixed in the presence of DSP (lanes 5 and 6), there appeared a novel species (HD) corresponding to the expected size of the His-KorA/HisKorA(V-L-P) heterodimer. The results indicate that the V-L-P domain is able to form dimers. Furthermore, it is able to interact with full-length KorA protein, indicating that the structure of the V-L-P is the same in both the V-L-P peptide and the full-length KorA polypeptide. KlcB and KorA proteins interact in vitro The repressor-titration model for KlcB-mediated toxicity predicts that KlcB and KorA interact. Direct interaction of KlcB and KorA in vitro was tested using a solid matrix binding assay. We constructed a gene fusion that expressed a chimeric protein with GST at the N terminus of KlcB (GSTKlcB). GST-KlcB was puri®ed by af®nity chromatography and mixed with increasing amounts of His-KorA to allow interaction. Potential GST-KlcB

complexes were captured on glutathione beads, washed, and assayed for the presence of His-KorA by Western blot analysis. His-KorA was found to be associated with GST-KlcB-coated glutathione beads (Figure 8). A fusion of GST with human papilloma virus E2 protein (GST-E2) did not bind His-KorA. These results indicate that His-KorA interacts directly and speci®cally with the KlcB moiety of GST-KlcB. Do physiological levels of KlcB affect repression by KorA in vivo? We wished to know if KlcB had any effect on KorA repression when expressed at physiological levels by a natural IncP plasmid in vivo. One indication that it does was the earlier result showing that tacp-klcB produced a detectable and reproducible effect on KorA repression of the kleAp-lacZ reporter in the absence of induction (Figure 3), suggesting a possible KlcB-KorA interaction even at low levels of klcB expression. We therefore compared repression of the kleAp-lacZ reporter by R995

60

Protein-Protein Interaction Domain

Discussion

Figure 7. Cross-linking assay for KorA and KorA(V-LP) interactions. Puri®ed His-KorA and His-KorA(V-L-P) were used in the cross-linking assay, as described in Materials and Methods. Proteins were subjected to SDSPAGE in a 20 % (w/v) polyacrylamide gel and stained with Coomassie blue. Lanes 1 and 2, His-KorA; lanes 3 and 4, His-KorA(V-L-P); lanes 5 and 6, mixture of HisKorA and His-KorA(V-L-P). The ÿ and ‡ signs show the absence and presence of the cross-linking agent DSP. The arrows on the right indicate the following species: m, KorA(V-L-P) monomers; d, KorA(V-L-P) dimers; M, KorA monomers; D, KorA dimers; HD, KorA/KorA (VL-P) heterodimers. Molecular mass markers are shown on the left: ovalbumin (46 kDa), carbonic anhydrase (30 kDa), trypsin inhibitor (21.5 kDa), and lysozyme (14.3 kDa).

wild-type and an R995 mutant lacking the klcAB region (pR9242). Repression of kleAp was reproducibly twofold greater for R995
klcAB than for R995 wild-type (Figure 9). This result suggests that KlcB may be able to interact with KorA when these proteins are expressed at normal levels.

The predicted KlcB, KorA, and TrbA polypeptides of IncP plasmids were previously known to contain a 35 amino acid residue region of high sequence similarity, but the function of the region was unknown.26,31 In this study, we have used genetic and biochemical approaches to show that this region constitutes a functional domain (the V-L-P domain) that is able to mediate homologous and heterologous protein-protein interactions. Our investigation of the V-L-P domain resulted from the surprising observation that induction of klcB is toxic in host cells that also harbored an IncP plasmid. The minimal region required for klcBmediated toxicity was a KorA-regulated operon of potentially toxic genes. We proposed and tested a ``repressor titration'' model, in which KlcB interacts directly with KorA to derepress KorA-regulated operons and allow the toxic genes to be expressed. This model was fully supported by our ®ndings: (1) klcB induction speci®cally released KorA repression of the kleA promoter, but had no effect on KorC repression; and (2) GST-KlcB interacts with His-KorA in vitro. We found further that expression of small peptides consisting of the V-L-P domains of KlcB or KorA is suf®cient for KorA titration in vivo and that the KorA(V-L-P) domain interacts with full-length KorA protein in vitro. Thus, the V-L-P domain is involved in KlcB-KorA and KorA-KorA interactions. We also tested the possibility that the proteins form complexes through V-L-P/V-L-P interactions. This model was con®rmed by showing that chimeric proteins consisting of the DNA-binding domain of phage l repressor ( l DB) and the V-L-P domain of KorA or TrbA are able to dimerize and form fully functional repressors in vivo. In addition, random mutagenesis of the coding region for the KorA(V-L-P) moiety led to the isolation of mutants defective in the ability to dimerize. The mutations resulted in changes in absolutely conserved residues in the V-L-P domain. The results show that

Figure 8. Direct interaction of KorA and KlcB. GST-KlcB was mixed with increasing amounts of His-KorA and the mixture was bound to glutathione beads, as described in Materials and Methods. The beads were washed, and the bound proteins were separated by SDS-PAGE. Western blot analysis with the anti-His monoclonal antibody was done to assay the presence of His-KorA (indicated by the arrow). Lane 1, His-KorA (1 mg) applied directly to the gel; 2, glutathione beads mixed with His-KorA (10 mg); 3, glutathione beads mixed with >10 mg GST-E2 (GST fusion of human papilloma virus E2 protein, from S.J. Silverstein) and His-KorA (10 mg); 4, glutathione beads mixed with GSTKlcB (10 mg) and His-KorA (5 mg); 5, glutathione beads mixed with GST-KlcB (10 mg) and His-KorA (10 mg).

Protein-Protein Interaction Domain

Figure 9. Effect of physiological levels of KlcB on KorA repression of kleAp-lacZ. Strains containing the kleAp-lacZ reporter plasmid (pRK21724) and wild-type R995 (shaded bar) or R995
klcAB (®lled column) were assayed for levels of b-galactosidase. In the absence of any repressor, b-galactosidase units were >15,000. Assays were done in triplicate; standard deviations are shown by error bars (not visible on the
klcAB column).

V-L-P/V-L-P interactions can be suf®cient for the formation of functional l repressor. The V-L-P domain occupies the C termini of both KorA and TrbA of RK2, which are small regulatory proteins of 100 and 121 amino acid residues that contain predicted internal helix-turn-helix (HTH) domains for DNA-binding.31,37 TrbA is known to regulate the expression of ®ve operons involved in replication and conjugative transfer of RK2, and it is predicted to function as a dimer.2,31,38,39 The better-characterized KorA repressor binds to a 12 bp palindromic sequence located in seven KorA-regulated promoters of the RK2 kor regulon.2,36,40,41 Mutations in the HTHcoding region of KorA affect DNA-binding, as expected.42 The C terminus is essential for KorA function. Deletion of the entire V-L-P domain (A. B. & D.H.F., unpublished results) or as few as six C-terminal amino acid residues37 abolishes KorA repressor activity. KorA exists in solution as a dimer,36 and other studies have concluded that the dimerization activity resides in the N terminus.42 The results presented here indicate that the C-terminal V-L-P domain of KorA is both necessary and suf®cient for dimerization. The V-LP domain of KorA, but not the N-terminal domain, was suf®cient to allow the formation of functional repressor fusions. The absence of the N terminus of KorA had little effect on dimerization of a chimeric repressor, whereas the absence of the C-terminal V-L-P domain abolished dimerization. Furthermore, point mutations leading to alterations in conserved residues of the V-L-P domain blocked

61 dimerization. Similarly, the TrbA(V-L-P) domain was fully functional in dimerization of chimeric repressor. Therefore, the V-L-P domains of these proteins are capable of homologous interaction. The results strongly suggest that the V-L-P domain is responsible for dimerization of the wild-type KorA and TrbA proteins. In contrast, the V-L-P domain of the much larger 51.1 kDa KlcB polypeptide occurs internally (residues 312-349 of 461 total).26 The function of KlcB is not known, although there is evidence that the kilC operon is involved in stable maintenance of IncP plasmids (A.B. & D.H.F., unpublished results). Because the V-L-P domains of KorA and TrbA are suf®cient for homodimerization, we expected that KlcB is able to form dimers in the cell. Indeed, fusion of full-length KlcB polypeptide to l DB results in a functional repressor, showing that KlcB has the ability to dimerize in this context. Thus, wild-type KlcB protein may function as a dimer. However, a l DB fusion with the KlcB(V-L-P) domain failed to produce a functional dimer despite the presence of abundant protein, as determined by Western blot analysis. It is possible that the V-L-P domain of KlcB does not fold properly in the context of the fusion protein. Alternatively, unlike the V-L-P domains of KorA and TrbA, the KlcB(V-L-P) domain may not be suf®cient to form homodimers. Nevertheless, our results are consistent with a role of the V-L-P domain in KlcB dimerization. Mutations that change the Val residue of the V-L-P sequence to Ala or Asp in full-length KlcB fused to l DB alter the function of the chimeric repressor in vivo. Interestingly, the Val ! Ala change, which severely affects the ability of l DB-KorA(V-L-P) fusion to form functional dimers, has an only moderate effect on the full-length KlcB fusion. One interpretation is that the V-L-P domain of KlcB participates in the formation of KlcB dimers, but it is not suf®cient. Protein-protein interactions are critically important for modulating biological processes. To understand the determinants for recognition, a number of dimerization domains have been identi®ed and studied at atomic resolution. Their sizes, sequences, and structures reveal a variety of strategies for allowing protein surfaces to interact, including the well-studied two-stranded, coiledcoil of leucine zippers found in a variety of regulators (e.g. Fos, Jun, GCN4, and Lac repressor),43 ± 49 the short 20 residue HTH domain of the plasmid CopG repressor,46 the four-helix bundle formed by interacting monomers of the helix-loop-helix protein Max,47 and the seven-stranded antiparallel b-sheet of the 105 residue dimerization domain of l repressor.48 The 35 amino acid residue V-L-P domain is among the smallest of known proteinprotein interaction domains, and secondary structure predictions reveal no obvious structural relationships with well-studied domains. As expected from the presence of Pro and Gly residues in its N-terminal half, the V-L-P domain is not predicted to form an a-helix of suf®cient length

62 for a coiled-coil. Interestingly, the C-terminal portion of the KlcB(V-L-P) domain overlaps the start of an a-helical region that may participate in a coiled-coil (data not shown). The KlcB dimerization results discussed above would be consistent with the possibility that this structure is involved in the dimerization of KlcB with the adjacent V-L-P domain contributing to dimer stability. However, considerably more work needs to be done to test this model. Some basic principles have emerged from the analysis of protein-protein interaction modules.45,49 First, it is likely that the interacting surfaces of the V-L-P domains will show high geometric and electrostatic complementarity. Second, the hydrophobic residues will likely be buried at the interface of the interacting subunits. Third, the absolutely conserved residues should be critical for protein-protein interaction. Indeed, the four KorA(V-L-P) mutants found to have defects in dimerization activity occurred in three different absolutely conserved residues (Figure 6). Extensive database searches with the V-L-P motif sequence have revealed only two other examples of V-L-Pdomain proteins, and both of these are predicted KorA proteins encoded by other IncP plasmids (Figure 2). While the open reading frames are incomplete, the sequences encoded the appropriate absolutely conserved amino acids. An interesting feature of some well-characterized protein-protein interaction domains is that they are found on more than one protein present in the cell, allowing the formation of homo and hetero-oligomers. For example, the leucine zipper transcriptional factors, Jun and Fos, can form Jun/Fos heterodimers, as well as Jun/Jun homodimers, but not Fos/Fos homodimers.45 The HLH and leucine zipper domains of Max permit homodimerization, as well as heterodimerization with Myc oncoprotein, although Myc itself cannot homodimerize.50 Thus, the domains form structures that are complementary, but they contain additional information that determines the speci®city of interaction. The rules for speci®city among highly complementary interaction domains are not well understood.49 The V-L-P domain occurs on three distinct proteins encoded by IncP plasmids. Examination of the sequences of the V-L-P domains reveals absolutely and highly conserved residues at 20 of 35 positions, and apparent ``protein species-speci®c'' residues (Figure 2). For example, the KlcB polypeptides have Ala at position 24 of the V-L-P domain, whereas the TrbA polypeptides have Gly, and the KorA proteins all have Glu at this position. At position 25, there is an acidic residue in TrbA polypeptides, whereas KlcB and KorA polypeptides all have Ala. All six TrbA and KorA polypeptides have an Arg residue at position 7, while the KlcB polypeptides are different at this position. Some of these species-speci®c residues may be determinants of interaction speci®city, acting to discourage or promote the formation of speci®c heterodimers or

Protein-Protein Interaction Domain

homodimers. The answer will require three-dimensional structure analysis of these domains. We have shown that the V-L-P domains of KorA and TrbA are suf®cient to mediate homodimer formation in the repressor assay, while the KlcB(V-LP) domain is not. Nevertheless, the KlcB(V-L-P) domain titrates KorA repressor as well as the KorA(V-L-P) domain, as measured by the kleAplacZ reporter assay. This result raises the possibility that KlcB(V-L-P) may be capable of strong heterologous interaction with KorA. Our data support this idea. Uninduced expression of klcB or klcB(VL-P) from the leaky tac promoter caused a detectable and reproducible difference in repression of the kleAp-lacZ reporter by KorA expressed constitutively from a high copy number plasmid. In a more physiologically relevant experiment, the absence of klcB on R995 allowed reproducibly greater repression of the kleA promoter. In this case, korA was expressed from its natural location on plasmid R995. This intriguing result is consistent with the possibility that the KlcB-KorA interaction has functional signi®cance in the biology of RK2. What could its function be? One possibility is that KlcB modulates the level of repression by KorA in response to a signal, perhaps from the host cell. Conversely, KorA may interact with KlcB to affect its activity. There is a clear precedent for the latter possibility. We have recently shown that another global transcriptional repressor of IncP plasmids, KorB, interacts with the IncC protein to promote the active partition of plasmid DNA into newly forming daughter cells.24 In summary, we have shown that the V-L-P domain is a protein-protein interaction module used by three different IncP plasmid proteins. Further studies on possible heterologous interactions by these proteins may lead to a better understanding of the complex regulatory circuits and novel functions encoded by the broad hostrange IncP plasmids. In addition, continued genetic and structural analysis of the V-L-P domains of KlcB, KorA, and TrbA should provide further insights into the mechanism and speci®city of protein-protein interactions.

Materials and Methods Bacteria, phage, and plasmids The E. coli strains were: BL21(DE3, pLysS) {F ÿ hsdS gal [lD69 f(lacUV5p-T7 gene 1)]};51 BR2943 {hsdR17 thi-1 relA1 supE44 endA1 gyrA96 recA1 [lDKC266(P1 repA‡)]} (from D. Chattoraj); DF4063 (thr-1 leuB6 thi-1 tonA21 supE44 rfbD1
trpE5 gyrA);10 DH5a [supE44
(lacIZYAargF) U169 hsdR17 recA1 endA1 gyrA96 thi-1 relA1 deoR f(80dlac lacZ
M15)];52 EKA335 (previously EKA340.2) [thr-1 leuB-6 lacY1 thi-1 tonA21 supE44 rfbD1
trpE5
(argF-lac)U169 deoC1::Tn10 (Tcs) srl::Tn10 recA];10 INV F0 [ F0 , endA1, recA1, hsdR17, supE44, thi-1, gyrA96, relA1, f(80dlac lacZ
M15)
(lacZYA-argF)U169] (InVitrogen); JH372: MC1061 (F0 128 lacIq lacZ::Tn5 )(l202) (from J. C. Hu);53,54 TOP10 [mcrA,
(mrr-hsdRMS-mcrBC), f(80dlac

63

Protein-Protein Interaction Domain lacZ
M15)
lacX74, deoR, recA1, araD139,
(araleu)7697, galU, galK, rpsL, endA1, nupG] (InVitrogen). The phage used for the E. coli two-hybrid assay was, lKH54, which is deleted for the cI gene53 (from J.C. Hu). The plasmids used in this study are described in Table 1. Unpublished plasmids were constructed as follows: pR9105, by PCR ampli®cation of the klcBcoding region from R995 using the oligonucleotide primers 995B5 (50 -AAGCTTCGTTGGAGGCGAGCATGCAAGAC-30 ) and 995B3 (50 -GAATTCGTTATCAAATGG CGGCCCGCAATTG-30 ), followed by ligation of the ampli®cation product to pCR2.1 (InVitrogen); pR9109, by digestion of pR9105 with HindIII and EcoRI, and ligation to HindIII/EcoRI-digested pJAK13, a Spr derivative of pMMB6755 (from J. Kornacki); pR9120, by digestion of pR9105 with HindIII and EcoRI, and ligation to HindIII/ EcoRI-digested pJAK17, a Cmr derivative of pMMB6755,56 (from J. Kornacki). pR1925 (R995
par) was constructed by homologous recombination between RK2
par (pRK21382),10 which is Apr and has the par region replaced by a spectinomycin-resistance (Spr) marker, and R995, which is Aps and has a wild-type par region. DF4063(R995) was mated with EKA335(pRK21382), transconjugants were streaked on LBNalSpTcXgal plates, and white colonies were screened for ampicillin sensitivity. The structure of the deletion plasmid was veri®ed by restriction digestion. pAB1 was constructed by digestion of pET-16b (Novagen) with XbaI and EcoRI, and ligation to XbaI/EcoRI-digested pJAK13; pR9182, by PCR ampli®cation of korA(V-L-P) from R995 using the oligonucleotide primers KorA50 (50 -CATATGGCCGCGTTCGAGGACAAGAAC-30 ) and KorAdn (50 -GGATCCTT TTCATCGTTTGGTTTCCTG-30 ), followed by ligation of the ampli®cation product to pCR2.1; pR9233, by digestion of pR9182 with NdeI and BamHI, and ligation to NdeI/BamHI-digested pAB1; pR9184, by PCR ampli®cation of klcB(V-L-P) from R995 using the oligonucleotide primers klcBup (50 -CATATGGCCGTGGTCGAGGACT GGCGG-30 ) and klcBdn (50 -GGATCCCGGCTCCCTTCA CTGCCCGGC-30 ), followed by ligation of the ampli®cation product to pCR2.1; pR9235, by digestion of pR9184 with NdeI, and BamHI, and ligation to NdeI/BamHIdigested pAB1; pR9149, by PCR ampli®cation of klcB from R995 using the oligonucleotide primers klcB995 (50 GGATCCGCATGCAAGACGACAACATCAAGCGCCG30 ) and 995B3, followed by ligation of the ampli®cation product to pCR2.1; pR9155, by digestion of pR9149 with EcoRI and BamHI and ligation to EcoRI/BamHI-digested pALEX (gift of S.J. Silverstein);57 pRK21931, by PCR ampli®cation of korA from RK2 using the oligonucleotide primers KorAup (50 -CATATGAAGAAACGGCTTACCGAAAGC-30 ) and KorAdn, followed by ligation of the ampli®cation product to pCR2.1; pR9210, by digestion of pRK21931 with NdeI and BamHI, and ligation to NdeI/ BamHI-digested pET-16b; pR9211, by digestion of pR9182 with Nde I and BamHI and ligation to NdeI/ BamHI-digested pET-16b; pR9289, by PCR ampli®cation of korA(V-L-P) from R995 using the oligonucleotide primers KorA37up (50 -GTCGACAGCCGCGTTCGAGGACAAGAA-30 ) and KorAdn, followed by ligation of the ampli®cation product to pCR2.1; pR9295, by digestion of pR9289 with SalI and BamHI, and ligation to SalI/ BamHI-digested pJH391;33 pR9292, by PCR ampli®cation of klcB(V-L-P) from R995 using the oligonucleotide primers KlcB37up (50 -GTCGACAGCCGTGGTCGAGGA CTGGCGG-30 ) and klcBdn, followed by ligation of the ampli®cation product to pCR2.1; pR9297, by digestion of pR9292 with SalI and BamHI, and ligation to SalI/ BamHI-digested pJH391; pR9313, by PCR ampli®cation

of korA from R995 using the oligonucleotide primers 50 KorAl (50 -GTCGACAATGAAGAAACGGCTTACCG30 ) and KorAdn, followed by ligation of the ampli®cation product to pCR2.1; pR9323, by digestion of pR9313 with SalI and BamHI, and ligation to SalI/BamHI-digested pJH391; pR9314, by PCR ampli®cation of korA(1-42) from R995 using the oligonucleotide primers 50 KorAl and 30 KorA-Nterm (50 -GGATCCCAGTCACGTTGCGAA CGTCG-30 ), followed by ligation of the ampli®cation product to pCR2.1; pR9325, by digestion of pR9314 with SalI and BamHI, and ligation to SalI/BamHI-digested pJH391; pR9337, by PCR ampli®cation of korA(42-101) from R995 using the oligonucleotide primers 50 KorA
N1 (GTCGACATCGCTGGGACTGACCAGG) and KorAdn, followed by ligation of the ampli®cation product to pCR2.1; pR9341, by digestion of pR9344 with SalI and BamHI, and ligation to SalI/BamHI-digested pJH391; pR9336, by PCR ampli®cation of korA(1-60) from R995 using the oligonucleotide primers 50 KorA and KorA
C30 (50 -GGATCCCTTGTCCTCTCACGCGGCC-30 ), followed by ligation of the ampli®cation product to pCR2.1; pR9343, by digestion of pR9336 with SalI and BamHI, and ligation to SalI/BamHI-digested pJH391; pR9299, by PCR ampli®cation of trbA(V-L-P) from R995 using the oligonucleotide primers TrbA37up (50 -GTCGACAGGTCATCCTTTCAAGAGCAGC-30 ) and TrbA30 (50 -GGA TCCCCCTTGGCGTCAGAGCCTTCC-30 ), followed by ligation of the ampli®cation product to pCR2.1; pR9305, by digestion of pR9299 with SalI and BamHI, and ligation to SalI/BamHI-digested pJH391; pR9310, by PCR ampli®cation of klcB from R995 using the oligonucleotide primers lKlcB50 (50 -GTCGACAATGCAAGACGACAACATC-30 ) and HisKlcB30 (50 -GGATCCGTTATCAAA TGGCGGCCCGC-30 ), followed by ligation of the ampli®cation product to pCR2.1; pR9311, by digestion of pR9310 with SalI and BamHI, and ligation to SalI/ BamHI-digested pJH391; pR9362-pR9365, PCR product obtained using the oligonucleotide primers 50 KorA00 cd00 (50 -GGTGATGCGGAGAGATGGGTGTCGAC-30 ) and 30 KorA00 cd00 (50 -CTTTCGGGCTTTGTTAGCGCCGGAT CC-30 ), was cut with SalI and BamHI, ligated to SalI/ BamHI-digested pR9295, and the mutant plasmids were screened for their sensitivity to l phage infection; pR9366 and pR9367, PCR products obtained using the oligonucleotide primers 50 klcBcd (50 -GATGCG GAGAGATGGGTGTCGACAATGCAAG-30 ), SacIklcB30 (50 -GGCGAAGCCCGGCGGGAGCTCGTCCGGC-30 ), 50 SacIklcBVal (50 -GGACGAGCTCCCGCCGGGCTTCGCC TGGGTTGATGCCGNNCTG-30 ), and 30 klcBcd (50 -CGG GCTTTGTTAGCGCCGGATCCGTTATC-30 ), were cut with SalI and SacI (klcBup), and with SalI and BamHI (klcBdn), ligated to SalI/BamHI-digested pR9295, and the mutant plasmids were screened for their sensitivity to phage infection. Plasmid pR9242 was constructed from R995 by the modi®ed VEX method for making precise deletions in large plasmids.17 The deletion in this plasmid results in an in-frame fusion consisting of the ®rst six codons of klcA, a 6 bp XbaI recognition site, and the stop codon of klcB. The details of the construction will be described elsewhere (A.B. & D.H.F., unpublished results). Media Media for growth of bacteria were Luria-Bertani (LB) and M9-CAA medium.58 M9-CAA medium was supplemented with tryptophan (50 mg mlÿ1) when necessary. Antibiotics at the following concentrations were used at the indicated concentrations: ampicillin,

64 50 mg mlÿ1; chloramphenicol, 50 mg mlÿ1; kanamycin, 50 mg mlÿ1; nalidixic acid, 20 mg mlÿ1; penicillin, 150 mg mlÿ1; spectinomycin, 50 mg mlÿ1; tetracycline, 15 mg mlÿ1; and trimethoprim, 50 mg mlÿ1. To induce expression of proteins from tacp, the medium was supplemented with 1 mM or 0.1 mM IPTG. To detect Lac‡ colonies, solid medium contained 40 mg mlÿ1 of X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside). DNA procedures Preparation of DNA from E. coli was done according to an alkaline lysis protocol.59 Agarose gel and polyacrylamide gel electrophoresis (PAGE) have been described.60 DNA manipulations with restriction endonucleases and phage T4 DNA ligase were done according to the manufacturers' recommendations. Ampli®cation of DNA by PCR was done with Taq DNA polymerase.61 Bacteria were transformed by the method of Cohen et al.62 Puri®ed DNA fragments were obtained by the crush and soak method.63 KlcB overexpression assays Strains were grown overnight at 37  C in broth with selection for both the tacp-klcB plasmid and the test plasmid. Dilutions of the cultures were then plated on media containing selection for the tacp plasmid alone (single selection) with and without IPTG, as well as selection for both plasmids (double selection) with and without IPTG. For each assay, the viable cell count (CFU) of the single selection without IPTG was normalized to an EOP of 1.0. The CFUs of other sets were then obtained and the relative EOPs were calculated. b -Galactosidase assays For l repressor fusions, overnight cultures of JH372 containing the appropriate plasmids were diluted 50-fold in LB and grown at 37  C to an A600 of 0.4-0.6. Assay and units were as described.64 For the kleAp-lacZ reporter studies, EKA335 was used as the host strain. Assays for b-galactosidase activity were performed as described64 with the following modi®cations to accommodate the reporter plasmid pRK21724. Cells that had been streaked the previous day were scraped from a plate into fresh media with selection and grown to A600 between 0.5 and 1.0. These cultures were diluted tenfold to 20-fold into fresh media with selection and grown to A600 between 0.5 and 1.0. Strains were grown in the presence or absence of IPTG. Cells were then put on ice and the b-galactosidase activity determined as described.64 Cells were plated on LB X-Gal and LB Ap X-Gal for calculation of the ratio of reporter plasmid-containing cells to total cells. The initial Miller units were divided by the value of this ratio to obtain the actual value of Miller units. Plaque assay with bacteriophage l Cells were grown overnight at 37  C in LBAp. The cultures were diluted 50-fold into fresh media (LBAp), supplemented with 0.2 % (w/v) maltose, and grown to A600 between 0.6 and 0.7. Cells were centrifuged at 6000 g for ten minutes. The cell pellet was resuspended in sterile 0.01 M MgSO4 (1 ml), and plaque-forming units (pfu) were assayed as described.58 Ef®ciency of plating (EOP)

Protein-Protein Interaction Domain was calculated as the number of plaques divided by the number of pfu. Mutagenesis Mutagenesis of the KorA(V-L-P) coding region was performed by the PCR-based random mutagenesis method to introduce random point mutations.65 The protocol utilizes manganese to facilitate misincorporation of nucleotides by Taq DNA polymerase (Qiagen). Also increasing the number of PCR cycles and decreasing the concentration of dNTPs elevated the probability of mutations. Using the 50 KorA''cd'' and 30 KorA''cd'' primers described above, the KorA(V-L-P) coding fragment was synthesized by mutagenic PCR, cloned into pJH391 to form an in-frame fusion with the coding region of repressor DNA-binding domain. Candidate mutants were screened for altered function, and all mutants were veri®ed by sequence analysis. The V-L-P domain of full-length KlcB was altered by site-directed mutagenesis. The construction and isolation of mutant plasmids pR9366 and pR9367 is described above. Brie¯y, two fragments were synthesized by PCR, cleaved with appropriate restriction endonucleases, and cloned into the l DB fusion vector to reconstitute fulllength KlcB. The primers were designed to introduce a silent mutation that creates a SacI site within klcB. One primer was synthesized with random nucleotide incorporation in the codon for Val in the V-L-P sequence, which is near the new SacI site. All mutants were veri®ed by sequencing the complete KlcB coding region. Purification of His-tagged KorA proteins The korA coding region, beginning with the second codon, was fused in-frame with a 22 codon open reading frame of pET-16b that codes for an N-terminal 10 -His tag and linker to generate pR9210 (described above). Similarly, a fragment carrying the KorA(V-L-P) coding region was inserted in pET-16b to allow expression of an N-terminal, 10 -His tagged KorA(V-L-P) fusion protein (pR9211). The fusions were induced in strain BL21(DE3, pLysS), which contains an IPTG-inducible phage T7 RNA polymerase gene,51 as described,24 with the following modi®cations. The sonicate was applied to TALON metal af®nity resin (Clontech), washed with 20 mM and 75 mM imidazole, and the His-tagged fusion proteins were eluted with 300 mM imidazole. Proteins were then analyzed by Western blot using the ECL detection kit (Amersham Life Sciences) and anti-HisTAG monoclonal antibody (Sigma). Purification of GST-tagged KlcB protein The klcB coding region, beginning with the ®rst codon, was fused in-frame with the glutathione-S-transferase (GST) gene on pALEX to form an N-terminal fusion that is inducible by IPTG (described above). The gene for the GST-klcB fusion on pR9155 was induced in strain BL21(DE3, pLysS) as follows: 100 ml of cells was grown overnight in LB broth with selections for pR9155 and pLysS at 37  C, then the overnight culture was added to 500 ml of LB (with selections); grown at 37  C for four hours; fusion gene expression was then induced by adding IPTG to a ®nal concentration of 1 mM. The culture was incubated at 37  C for three hours; cells were harvested by centrifugation; frozen at ÿ70 C; and thawed on ice. Cells were washed with 20 ml of PBS

65

Protein-Protein Interaction Domain (1.8 mM KH2PO4, 10 mM NaH2PO4, 140 mM NaCl, 2.7 mM KCl, pH 7.3), centrifuged, and the pellet was then resuspended in 20 ml of GST lysis buffer (PBS, 1 % (v/v) Triton X-100, 0.2 mg mlÿ1 lysozyme, 1 mM PMSF). The cells were then sonicated on ice with three 15 second pulses. The sonicate was run over a 50 % (w/v) glutathione-agarose column (Sigma); the beads were washed several times, and the GST-KlcB fusion protein was eluted with 10 mM reduced glutathione. Solid matrix affinity assay GST-KlcB (10 mg) was mixed with increasing amounts of His-KorA (5 mg and 10 mg) and the mixtures were mixed at 4  C for one hour. Twenty-®ve ml of 50 % (w/v) glutathione slurry-mix was added to the mixtures, and nutated for another hour at 4  C. The resulting complex was washed several times with PBT, resuspended in 50 ml of SDS-PAGE sample buffer, boiled for ten minutes, and then analyzed by Western blot using the ECL detection kit (Amersham Life Sciences) and anti-HisTAG monoclonal antibody (Sigma). Cross-linking assay DSP (dithiobis(succinimidyl propionate; Pierce) was used as a cross-linking agent. A fresh 25 solution of DSP was prepared in DMSO by dissolving 5 mg of DSP in 1 ml of DMSO. For 25 ml of protein extract, 1 ml of DSP was added to make a ®nal concentration of DSP of 200 mg mlÿ1. After DSP was added, the protein extracts were incubated at room temperature for 15 minutes. Then the cross-linking reaction was quenched for 15 minutes at room temperature by adding lysine to 3 mM and Tris-HCl (pH 8.0) to 25 mM. The resulting complex was resuspended in SDS-PAGE buffer (lacking b-mercaptoethanol) and separated by SDS-PAGE in a 20 % (w/v) polyacrylamide gel. The experiments used 20 mg of His-KorA protein and 12 mg of His-KorA(V-L-P) peptide; 18 mg of each were used in the experiment in which His-KorA was mixed with His-KorA(V-L-P). Western blot analyses of l DB-fusion proteins One ml of the cultures grown for b-galactosidase assays and/or l plaque assays was centrifuged, and the cell pellet was resuspended in 50 ml of 2 SDS sample buffer. These samples, which had similar A600 values, were boiled for ten minutes, and separated by SDSPAGE in a 20 % (w/v) polyacrylamide gel. The fusion proteins were then analyzed by Western blot using the ECL detection kit (Amersham Life Sciences) and rabbit polyclonal anti- l DB antibody (a gift from J. Leeds).

Acknowledgments We thank James Hu for the l DB fusion vectors and strains, Jennifer Leeds for anti-l DB antibody, and Saul Silverstein for puri®ed GST-HPV E2 protein. We are grateful to Carey Waldburger and Hamish Young for helpful discussions. This research was supported by NIH grant R01-GM29085 to D.H.F. and Cancer Center support grant CA13696 to Columbia University. A.B. was partially supported by NIH training grant AI07161.

References 1. Villarroel, R., Hedges, R. W., Maenhaut, R., Leemans, J., Engler, G., Van Montagu, M. & Schell, J. (1983). Heteroduplex analysis of P-plasmid evolution: the role of insertion and deletion of transposable elements. Mol. Gen. Genet. 189, 390-399. 2. Pansegrau, W., Lanka, E., Barth, P. T., Figurski, D. H., Guiney, D. G., Haas, D. et al. (1994). Complete nucleotide sequence of Birmingham IncP plasmids: compilation and comparative analysis. J. Mol. Biol. 239, 623-663. 3. Thorsted, P. B., Macartney, D. P., Akhtar, P., Haines, A. S., Ali, N., Davidson, P. et al. (1998). Complete sequence of the IncPb plasmid R751: implications for evolution and organisation of the IncP backbone. J. Mol. Biol. 282, 969-990. 4. Datta, N. & Hedges, R. (1972). Host ranges of R factors. J. Gen. Microbiol. 70, 453-460. 5. Trieu-Cuot, P., Carlier, C., Martin, M. & Courvalin, P. (1987). Plasmid transfer by conjugation from Escherichia coli to Gram-positive bacteria. FEMS Microbiol. Letters, 48, 289-294. 6. Heinemann, J. A. & Sprague, G. (1989). Bacterial conjugative plasmids mobilize DNA transfer between bacteria and yeast. Nature, 340, 205-209. 7. Hayman, G. T. & Bolen, P. L. (1993). Movement of shuttle plasmids from Escherichia coli into yeasts other than Saccharomyces cerevisiae using trans-kingdom conjugation. Plasmid, 30, 251-257. 8. Giebelhaus, L. A., Frost, L., Lanka, E., Gormley, E. P., Davies, J. E. & Leskiw, B. (1996). The Tra2 core of the IncPa plasmid RP4 is required for intergeneric mating between Escherichia coli and Streptomyces lividans. J. Bacteriol. 178, 6378-6381. 9. Thomas, C. M. & Helinski, D. R. (1989). Vegetative replication and stable inheritance of IncP plasmids. In Promiscuous Plasmids of Gram-negative Bacteria (Thomas, C. M., ed.), pp. 1-25, Academic Press Ltd, San Diego, CA. 10. Sia, E. A., Roberts, R. C., Easter, C., Helinski, D. R. & Figurski, D. H. (1995). Different relative importances of the par operons and the effect of conjugal transfer on the maintenance of intact promiscuous plasmid RK2. J. Bacteriol. 177, 2789-2797. 11. Ingram, L. C., Richmond, M. H. & Sykes, R. B. (1973). Molecular characterization of the R factors implicated in the carbenicillin resistance of a sequence of Pseudomonas aeruginosa strains isolated from burns. Antimicrob. Agents Chemother. 3, 279-288. 12. Figurski, D. H., Meyer, R. J. & Helinski, D. R. (1979). Suppression of ColE1 replication properties by the IncP-1 plasmid RK2 in hybrid plasmids constructed in vitro. J. Mol. Biol. 133, 295-318. 13. Wilson, J. W., Sia, E. A. & Figurski, D. H. (1997). The kilE locus of promiscuous IncPa plasmid RK2 is required for stable maintenance in Pseudomonas aeruginosa. J. Bacteriol. 179, 2339-2347. 14. Smith, C. A. & Thomas, C. M. (1984). Nucleotide sequence of the trfA gene of broad host-range plasmid RK2. J. Mol. Biol. 175, 251-262. 15. Schmidhauser, T. J. & Helinski, D. R. (1985). Regions of broad-host-range plasmid RK2 involved in replication and stable maintenance in nine species of Gram-negative bacteria. J. Bacteriol. 164, 446-455. 16. Perri, S., Helinski, D. R. & Toukdarian, A. (1991). Interaction of plasmid-encoded replication initiation proteins with the origin of DNA replication in broad

66

17.

18.

19.

20.

21.

22.

23.

24.

25.

26. 27. 28.

29.

30.

31.

Protein-Protein Interaction Domain host range plasmid RK2. J. Biol. Chem. 266, 1253612543. Ayres, E. K., Thomson, V. J., Merino, G., Balderes, D. & Figurski, D. H. (1993). Precise deletions in large prokaryotic genomes by vector-mediated excision (VEX): the trfA gene of promiscuous plasmid RK2 is essential for replication in several Gramnegative hosts. J. Mol. Biol. 230, 174-185. Schmidhauser, T. J., Bechhofer, D. H., Figurski, D. H. & Helinski, D. R. (1989). Host-speci®c effects of the korA-korB operon and oriT region on the maintenance of miniplasmid derivatives of broad host-range plasmid RK2. Plasmid, 21, 99-112. Jovanovic, O. S., Ayres, E. K. & Figurski, D. H. (1994). Host-inhibitory functions encoded by promiscuous plasmids: transient arrest of Escherichia coli segregants that fail to inherit plasmid RK2. J. Mol. Biol. 237, 52-64. Roberts, R. C., StroÈm, A. & Helinski, D. R. (1994). The parDE operon of broad-host-range plasmid RK2 speci®es growth inhibition associated with plasmid loss. J. Mol. Biol. 237, 35-51. Eberl, L., Kristensen, C. S., Givskov, M., Grohmann, E., Gerlitz, M. & Schwab, H. (1994). Analysis of the multimer resolution system encoded by the parCBA operon of broad-host-range plasmid RP4. Mol. Microbiol. 12, 131-141. Easter, C. L., Schwab, H. & Helinski, D. R. (1998). Role of the parCBA operon of the broad-host-range plasmid RK2 in stable plasmid maintenance. J. Bacteriol. 180, 6023-6030. Bignell, C. R., Haines, A. S., Khare, D. & Thomas, C. M. (1999). Effect of growth rate and incC mutation on symmetric plasmid distribution by the IncP-1 partitioning apparatus. Mol. Microbiol. 34, 205-216. Rosche, T. M., Siddique, A., Larsen, M. H. & Figurski, D. H. (2000). Incompatibility protein IncC and global regulator KorB interact in active partition of promiscuous plasmid RK2. J. Bacteriol. 182, 60146026. Figurski, D. H., Pohlman, R. F., Bechhofer, D. H., Prince, A. S. & Kelton, C. A. (1982). Broad host range plasmid RK2 encodes multiple kil genes potentially lethal to Escherichia coli host cells. Proc. Natl Acad. Sci. USA, 79, 1935-1939. Larsen, M. H. & Figurski, D. H. (1994). Structure, expression, and regulation of the kilC operon of promiscuous IncPa plasmids. J. Bacteriol. 176, 5022-5032. Thomas, C. M. (2000). Paradigms of plasmid organization. Mol. Microbiol. 37, 485-491. Thomas, C. M., Ibbotson, J. P., Wang, N. Y., Smith, C. A., Tipping, R. & Loader, N. M. (1988). Gene regulation on broad host range plasmid RK2: identi®cation of three novel operons whose transcription is repressed by both KorA and KorC. Nucl. Acids Res. 16, 5345-5359. Kornacki, J. A., Burlage, R. S. & Figurski, D. H. (1990). The kil-kor regulon of broad-host-range plasmid RK2: nucleotide sequence, polypeptide product, and expression of regulatory gene korC. J. Bacteriol. 172, 3040-3050. Kornacki, J. A., Chang, C.-H. & Figurski, D. H. (1993). The kil-kor regulon of promiscuous plasmid RK2: structure, products, and regulation of two operons that constitute the kilE locus. J. Bacteriol. 175, 5078-5090. Jagura-Burdzy, G., Khanim, F., Smith, C. A. & Thomas, C. M. (1992). Crosstalk between plasmid

32.

33.

34. 35. 36.

37.

38.

39.

40.

41.

42.

43. 44. 45. 46.

47.

48.

vegetative replication and conjugative transfer: repression of the trfA operon by trbA of broad host range plasmid RK2. Nucl. Acids Res. 20, 3939-3944. Beil, S., Timmis, K. N. & Pieper, D. H. (1999). Genetic and biochemical analyses of the tec operon suggest a route for evolution of chlorobenzene degradation genes. J. Bacteriol. 181, 341-346. Hu, J. C., Kornacker, M. G. & Hochschild, A. (2000). Escherichia coli one- and two-hybrid systems for the analysis and identi®cation of protein-protein interactions. Methods, 20, 80-94. Pabo, C. O., Sauer, R. T., Sturtevant, J. M. & Ptashne, M. (1979). The repressor contains two domains. Proc. Natl Acad. Sci. USA, 76, 1608-1612. Novick, R. P. (1987). Plasmid incompatibility. Microbiol. Rev. 51, 381-395. Jagura-Burdzy, G. & Thomas, C. M. (1995). Puri®cation of KorA protein from broad host range plasmid RK2: de®nition of a hierarchy of KorA operators. J. Mol. Biol. 253, 39-50. Bechhofer, D. H. & Figurski, D. H. (1983). Map location and nucleotide sequence of korA, a key regulatory gene of promiscuous plasmid RK2. Nucl. Acids Res. 11, 7453-7469. Lessl, M., Balzer, D., Weyrauch, K. & Lanka, E. (1993). The mating pair formation system of plasmid RP4 as de®ned by RSF1010 mobilization and donor speci®c phage propagation. J. Bacteriol. 175, 64156425. Zatyka, M., Jagura-Burdzy, G. & Thomas, C. M. (1994). Regulation of transfer genes of promiscuous IncPa plasmid RK2: repression of Tra1 region transcription both by relaxosome proteins and by the Tra2 regulator TrbA. Microbiology, 140, 2981-2990. Smith, C. A., Shingler, V. & Thomas, C. M. (1984). The trfA and trfB promoter regions of broad host range plasmid RK2 share common potential regulatory sequences. Nucl. Acids Res. 12, 3619-3630. Young, C., Prince, A. S. & Figurski, D. H. (1985). korA function of promiscuous plasmid RK2: an autorepressor that inhibits expression of host-lethal gene kilA and replication gene trfA. Proc. Natl Acad. Sci. USA, 82, 7374-7378. Kostelidou, K., Jagura-Burdzy, G. & Thomas, C. M. (1998). Mutational analysis of the global regulator KorA of broad-host-range plasmid RK2. J. Mol. Biol. 281, 453-463. McKnight, S. L. (1991). Molecular zippers in gene regulation. Science, 246, 911-916. Alber, T. (1992). Structure of the leucine zipper. Curr. Opin. Genet. Dev. 2, 205-210. Phizicky, E. M. & Fields, S. (1995). Protein-protein interactions: methods for detection and analysis. Microbiol. Rev. 59, 94-123. Gomis-Ruth, F. X., Sola, M., Acebo, P., Parraga, A., Guasch, A., Eritja, R. et al. (1998). The structure of plasmid-encoded transcriptional repressor CopG unliganded and bound to its operator. EMBO J. 17, 7404-7415. Ferre-D'Amare, A. R., Prendergast, G. C., Ziff, E. B. & Burley, S. K. (1993). Recognition by Max of its cognate DNA through a dimeric b/HLH/Z domain. Nature, 363, 38-45. Bell, C. E., Fresqura, P., Hochschild, A. & Lewis, M. (2000). Crystal structure of the repressor C-terminal domain provides a model for cooperative operator binding. Cell, 101, 801-811.

Protein-Protein Interaction Domain 49. Jones, S. & Thornton, J. M. (1996). Principles of protein-protein interactions. Proc. Natl Acad. Sci. USA, 93, 13-20. 50. Luscher, B. & Lars-Gunnar, L. (1999). The basic region/helix-loop-helix/leucine zipper domain of Myc proto-oncoproteins: function and regulation. Oncogene, 18, 2955-2966. 51. Studier, F. W. & Moffatt, B. A. (1986). Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 189, 113-130. 52. Hanahan, D. (1983). Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 557580. 53. Hu, J. C., O'Shea, E. K., Kim, P. S. & Sauer, R. T. (1990). Sequence requirements for coiled-coils: analysis with lambda repressor-GCN4 leucine zipper fusions. Science, 250, 1400-1403. 54. Meyer, B. J. & Ptashne, M. (1980). Gene regulation at the right operator (OR) of bacteriophage lambda. III. Lambda repressor directly activates gene transcription. J. Mol. Biol. 139, 195-205. 55. FuÈrste, J. P., Pansegrau, W., Frank, R., Blocker, H., Scholz, P., Bagdasarian, M. & Lanka, E. (1986). Molecular cloning of the plasmid RP4 primase region in a multi-host-range tacP expression vector. Gene, 48, 119-131. 56. Thomson, V. J., Bhattacharjee, M. K., Fine, D. H., Derbyshire, K. M. & Figurski, D. H. (1999). Direct selection of IS903 transposon insertions by use of a broad-host-range vector: isolation of catalasede®cient mutants of Actinobacillus actinomycetemcomitans. J. Bacteriol. 181, 7298-7307. 57. Panagiotidis, C. A. & Silverstein, S. J. (1995). pALEX, a dual-tag prokaryotic expression vector for the puri®cation of full-length proteins. Gene, 164, 4547. 58. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982). Molecular Cloning - A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

67 59. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1989). Current Protocols in Molecular Biology, J. Wiley & Sons, New York. 60. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edit., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 61. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. I., Higuchi, R., Horn, G. T., Mullis, K. B. & Erlich, H. A. (1988). Primer-directed enzymatic ampli®cation of DNA with a thermostable DNA polymerase. Science, 239, 487-491. 62. Cohen, S. N., Chang, A. C. Y. & Hsu, L. (1972). Nonchromosomal antibiotic resistance in bacteria: genetic transformation of Escherichia coli by R-factor DNA. Proc. Natl Acad. Sci. USA, 69, 2110-2114. 63. Maxam, A. M. & Gilbert, W. (1980). Sequencing end-labelled DNA with base-speci®c chemical cleavages. Methods Enzymol. 65, 499-560. 64. Miller, J. (1972). Experiments in Molecular Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 65. Lin-Goerke, J. L., Robbins, D. J. & Burczak, J. D. (1997). PCR-based random mutagenesis using manganese and reduced dNTP concentration. Biotechniques, 23, 409-412. 66. Ayres, E. K., Saadi, S., Schreiner, H. C., Thomson, V. J. & Figurski, D. H. (1991). Differentiation of lethal and nonlethal, kor-regulated functions in the kilB region of broad host-range plasmid RK2. Plasmid, 25, 53-63. 67. Roberts, R. C., Burioni, R. & Helinski, D. R. (1990). Genetic characterization of the stabilizing functions of a region of broad-host-range plasmid RK2. J. Bacteriol. 172, 6204-6216. 68. Speakman, A. J., Binns, S. H., Osborn, A. M., Corkill, J. E., Kariuki, S., Saunders, J. R. et al. (1997). Characterization of antibiotic resistance plasmids from Bordetella bronchiseptica. J. Antimicrob. Chemother. 40, 811-816.

Edited by M. Belfort (Received 26 January 2001; received in revised form 18 April 2001; accepted 20 April 2001)