- Email: [email protected]
A strain of Bacillus thuringiensis subsp. galleriae containing a novel cry8 gene highly toxic to Anomala cuprea (Coleoptera: Scarabaeidae)
Biological Control 28 (2003) 191–196 www.elsevier.com/locate/ybcon
A strain of Bacillus thuringiensis subsp. galleriae containing a novel cry8 gene highly toxic to Anomala cuprea (Coleoptera: Scarabaeidae) Shin-ichiro Asano,a Chikage Yamashita,a Toshihiko Iizuka,a Katsuyoshi Takeuchi,b Satoshi Yamanaka,b David Cerf,c and Takashi Yamamotoc,* b
a Graduate School of Agriculture, Hokkaido University, Sapporo 060-8589, Japan Tsukuba Technology Center, SDS-Biotech K. K., Tsukuba, Ibaraki 300-2646, Japan c Verdia Inc., Redwood City, CA 94063, USA
Received 31 October 2002; accepted 6 March 2003
Abstract A strain of Bacillus thuringiensis (Bt) subsp. galleriae highly toxic to the cupreous chafer, Anomala cuprea, was isolated from a soil sample collected in Japan. The strain, SDS-502, produces a crystal consisting of a 130-kDa protein. The gene encoding the protein was cloned in Escherichia coli using antiserum directed to the protein. The gene was expressed in E. coli, producing a 130kDa protein toxic to A. cuprea. Sequencing of the cloned gene indicated a typical Bt cry gene with substantial homology to cry8 genes. Based on the peptide sequence comparison, the gene found in SDS-502 was designated as cry8Da (AB089299). The cry8Da gene was highly expressed in SDS-502 in a laboratory scale bioreactor. The fermentation product of SDS-502 was formulated for soil application and tested in a peanut field for chafer control along with a chemical insecticide reference, a fenthion organophosphate granular formulation. Judging from the amount of undamaged nuts harvested from plots of different treatments, plots treated with SDS-502 had significantly better insect control than the untreated plots. The chemical insecticide plots showed no significant difference in nut damage from the Bt-treated or control plots. Ó 2003 Elsevier Science (USA). All rights reserved. Keywords: Bacillus thuringiensis; Galleriae; SDS-502; cry8Da; AB089299; Anomala cuprea; Cupreous chafer; Field trial
1. Introduction Bacillus thuringiensis Berliner (Bt) is a rod-shaped, Gram-positive, spore-forming bacterium, which is often isolated from soil. A large number of Bt strains have been isolated and classified into different subspecies by flagellar serotyping supplemented with biochemical characterization. Bt grows in a simple culture medium such as nutrient broth under aerobic conditions. When nutrients are exhausted, Bt produces a spore along with one or several parasporal crystals. The crystals are made of proteins of various sizes. These proteins are called crystal proteins and are often insecticidal. When the spore matures, Bt cells lyse and release free spores and crystals. The spore–crystal complex can be collected by *
Corresponding author. Fax: 1-650-364-2715. E-mail address: [email protected] (T. Yamamoto).
centrifugation and formulated into a sprayable insecticide. Bt is certainly the most successful biological pesticide. Some crystal proteins have very high activity specific to certain insect species. For example, Luttrell et al. (1999) reported that Cry1Ac1, a crystal protein highly toxic to Heliothis virescens (Fabricus), has an LC50 against neonate larvae as low as 0.07 ppm when mixed in artificial diet. Because of the high activity, Bt is widely used to control lepidopteran insects that feed on foliage. Applications towards non-lepidopteran insects are not as common as applications towards lepidopteran insects. Bt tenebrionis and Bt israelensis have been used commercially to control coleopteran insects, especially the Colorado potato beetle and dipteran insects, respectively (Beegle and Yamamoto, 1992). These Bt strains have high specific activities against the corresponding target insects. There are several Bt subspecies, which show activity to other coleopteran insects such as
1049-9644/$ - see front matter Ó 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S1049-9644(03)00060-4
192
S. Asano et al. / Biological Control 28 (2003) 191–196
those in the Scarabaeidae family. Sharpe (1976) reported that parasporal inclusion of Bt galleriae NRRL B-4027 was toxic to the Japanese beetle, Popillia japonica Newman. Ohba et al. (1992) found a strain of Bt japonensis called ‘‘buibui’’ toxic to several scarab beetles. A cry gene, designated as cry8Ca, was cloned from the buibui strain, and its protein showed toxicity against Anomala cuprea Hope, Anomala rufocuprea Motsch and P. japonica (Sato et al., 1994). Two additional cry8 genes, cry8Aa, and cry8Ba, have been cloned from the PS50C strain of Bt kumamotoensis active against Cotinis sp. (June beetle) (US Patent 5554534). We are interested in finding a gene that is active against scarab beetles. In this report, we describe the discovery of a new Bt strain highly active against scarab beetles such as A. cuprea. A novel cry8 gene was cloned from this strain, and the spore and crystal complex from this strain was tested for A. cuprea control in soil. Some of the aspects described in this paper have been included in patent applications in Japan (P2002-45186A) and in the US.
2. Materials and methods 2.1. Isolation of Bt cultures A soil sample collected in Ibaraki, Japan was suspended in sterile water at 1 mg/ml. After shaking for 30 min, the suspension was left to stand for a few minutes to let coarse materials settle. An aliquot of the top clear layer was sampled in a test tube and treated at 80 °C for 10 min to kill non-sporogenic microorganisms. Dilutions of the heat-treated sample were then plated on nutrient agar plates and incubated for 48 h at 30 °C. Among the colonies that appeared on the plates, Bt colonies were identified by colony morphology and microscopic observation for the spore and crystal formation. Serotyping of selected Bt isolates was done by the method described by Bonnefoi and de Barjac (1963). 2.2. Insect screening Bt isolates obtained from soil samples were grown in 50 ml CYS medium (Yamamoto, 1990) in 200 ml flasks for 72 h at 30 °C. The crystals were harvested by centrifugation and re-suspended in 10 ml water. An aliquot (1 ml) of the crystal suspension was mixed with 5 g of sterile compost in a plastic cup containing five A. cuprea second-instar larvae. The larvae were obtained from eggs laid by A. cuprea adults collected around our facility in Tsukuba, Japan. The larvae were allowed to feed in the compost mixture for 7 days at 25 °C. The screening was conducted in two summers from May to September when a reasonable number of adult insects could be collected.
2.3. Protein purification and bioassay The SDS-502 strain was grown in a flask containing the CYS medium at 30 °C for 72 h. The crystals were purified by centrifugation in Percoll (Baba et al., 1990) and suspended in water to the final protein concentration of 10 lg=ml. In order to produce a specific antiserum, the antigen, SDS-502 crystal protein, was purified by SDS–PAGE. The purified crystals were dissolved in 0.1 N NaOH with 2% 2-mercaptoethanol and subjected to a preparative SDS–PAGE. The 130 kDa-crystal protein band was elelctro-eluted from the gel and injected into a guinea pig. Bioassay was conducted with the Percoll-purified crystal suspension in sterile compost as described in the insect screening section. Assays were carried out against first- to third-instar larvae of A. cuprea, A. orientalis, and P. japonica. The same crystal suspension was assayed against third to fourth-instar larvae of Bombyx mori (Linnaeus), Spodoptera litura (Fabricius), and Plutella xylostella (Linnaeus). In this case, the crystal suspension was placed on mulberry (B. mori), cabbage (S. litura and P. xylostella) leaves, and insects were allowed to feed at 30 °C for 5 days (B. mori and S. litura) or for 2 days (P. xylostella). At the end of the incubation, larval mortality was recorded. The cloned cry gene was expressed in Escherichia coli DH5-a producing inclusion bodies. These inclusion bodies were purified as described for SDS-502 crystals and assayed against A. cuprea. The gene was also cloned in a cry-minus Bt strain, BT51 as described in the gene cloning section (Sasaki et al., 1996). The purified crystals from BT51 were solubilized in 0.1 N NaOH. The protein was purified by differential solubilization between pH 8 at which the protein was soluble and pH 4.4 at which the protein was precipitated. The purified crystal protein was assayed against first-instar larvae of Diabrotica undecimpunctata undecimpunctata Mannerheim in 48-well plates containing a corn rootworm artificial diet obtained from Bio-Serv. The purified crystal protein in 100 ll 50 mM sodium bicarbonate was placed on the diet in each well at various concentrations, and D. undecimpunctata larvae were allowed to feed on the diet for 5 days at 25 °C. 2.4. Gene cloning Genomic DNA prepared from vegetatively growing Bt was digested with EcoRI. A fraction of EcoRI-digested DNA from 2 to 5 kb in size was ligated with EcoRI-digested kgt11 and cloned in E. coli DH5-a. Transformed E. coli cells were screened for Bt cry gene expression with antiserum made in guinea pig against the SDS-502 crystal protein(s). Colonies showing positive reaction to the antiserum were screened for the proper size insert. A clone showing a 3.4-kb insert was
S. Asano et al. / Biological Control 28 (2003) 191–196
partially sequenced to confirm the cloning of a cry gene. Since this cloned insert missed a portion of the 30 end, the missing portion was cloned by PCR (polymerase chain reaction) using TaKaRa LA PCR Cloning Kit (Isegawa et al., 1992). HindIII-digested genomic DNA was cloned in the HindIII cassette included in the kit, and portions containing the missing fragment were amplified between SDS-502 specific primers, Primer 1: 50 -tgcaacatttgaagcagaagaagacc and Primer 2: 50 ttgatacagaaacatatccaacgtatc, and Cassette Primer C1 and C2 provided in the kit. Amplified DNA was cloned in pGEM-T Easy (Promega) and sequenced to confirm the sequence of the cloned SDS-502 gene. A DNA fragment containing the complete cry gene was cloned in pBluescript II SK(+). In order to clone the cry gene from SDS-502 in BT51, the protein-coding region of the cloned gene was amplified by PCR with NcoI and BamHI sites that were engineered at the translation start and end, respectively. The PCR amplified gene was then cloned in the shuttle vector as described by Sasaki et al. (1996). 2.5. Field trial SDS-502 was fermented in a 5-L laboratory bioreactor using a soybean flour-based medium. At the end of fermentation, the spores and crystals were collected by centrifugation, dried by spray drying and formulated into a granular formulation for soil application. The amount of crystal protein(s) in the formulation was determined by SDS–PAGE. The field trial was conducted in a patch of peanut field consisting of three rows of 65 cm-wide, 20 cm-high ridges, where peanut plants were cultivated and treatments were made, and 55 cm-wide furrows. Each ridge was divided into four 5 m-long plots and there were 12 plots in the test patch. Before planting in May, the SDS502 formulation was sprayed onto the ground at 0:06 (crystal protein) and 0:12 g=m2 and tilled into the soil ca 20 cm deep. Plots treated with a granular formulation of a fenthion chemical insecticide at a rate of 0:45 g=m2 (active ingredient) were also prepared. Non-treated, control plots were arranged for comparison. These chemical and non-treated plots were also tilled. In each plot, about 30 peanut seedlings were planted. Each treatment was conducted in three replicated plots arranged at random in the test patch. At the time of planting, first-instar A. cuprea larvae were released to the field at one larva/plant. The insect release was repeated on the fifteenth day after the planting. In October, nuts were harvested from 10 randomly selected plants from each plot and sorted into two groups: undamaged and damaged by insects and/or fungi. Surviving larvae in each plot were counted at the time of harvesting. To compare the efficacy among three treatments, undamaged nuts production was analyzed by
193
TukeyÕs studentized range test at the 0.05 significance level. Residual activity of the SDS-502 crystals in soil was tracked by insect bioassay. Soil samples were collected from the plots treated with SDS-502 at ca 14-day intervals for up to 106 days. Insect mortality caused by Bt in soil samples was observed in ten replications in plastic cups (7 cm wide 3.5 cm high) containing one A. cuprea first-instar larva per cup. During the 3-week incubation at 26 °C, a piece of fresh cabbage leaf was placed weekly on the surface of the soil to supplement organic matter in the soil for insect consumption.
3. Results and discussion 3.1. Isolation and characterization of the scarab-active Bt isolate About 2000 Bt isolates were collected from different soil samples obtained from various locations within Ibaraki. The entire collection was screened against A. cuprea, and several isolates showing reproducible activity were found. One of these isolates designated as SDS-502 had the highest activity. The SDS-502 strain appeared to be a typical Bt producing, besides a spore, a spherical crystal (Fig. 1A). The crystal morphology of SDS-502 appeared to be similar to that of the buibui strain of Bt japonensis. The SDS-502 crystals were purified and their protein component(s) were analyzed by SDS–PAGE. As shown in Fig. 1B, SDS–PAGE revealed one band around 130 kDa. Upon serotyping the flagellar
Fig. 1. (A) Scanning electron micrograph of a sporulating culture of SDS-502. Arrows indicate the crystals produced by the culture. (B) SDS–PAGE of purified SDS-502 crystals (right lane). Molecular weight markers on the left were myosin (200,000), b-galactosidase (116,000), phosphorylase B (97,000), bovine serum albumin (66,000), and ovalbumin (45,000).
194
S. Asano et al. / Biological Control 28 (2003) 191–196
3.3. Sequence analysis
Table 1 Insecticidal activity of SDS-502 and HD8 Insects
Age (instar)
Mortality (%) SDS-502
HD8
Bombyx mori Plutella xylostella Spodoptera litura Anomala cuprea
4 4 3 1 2 3
0 40 0 100 100 80
80 80 40 0 0 0
Anomala orientalis
1 2
100 100
0 0
Popillia japonica
1 2 1
100 100 0
Diabrotica undecimpunctata
0 0 Not tested
antigen, SDS-502 was determined to be a galleriae strain. The purified crystals were tested against several different insects. As shown in Table 1, SDS-502 has substantial activity against insects in the Scarabaeidae. At 2 ppm (i.e., 10 lg crystal protein in 5 g compost), 100% of the first and second-instar larvae were killed in 7 days. Older larvae (third instar) also showed high mortality. On the other hand, no mortality was recorded with a Lepidopera-active galleriae strain, HD-8. No toxicity was observed with SDS-502 crystals against B. mori and S. litura. A weak but substantial (40%) mortality was seen with P. xylostella. The SDS-502 crystal protein purified from BT51 was tested against D. undecimpunctata, but no activity was found up to the highest concentration of 700 lg=cm2 . 3.2. Gene responsible for the scarab activity SDS–PAGE of the SDS-502 crystals showed one distinctive band around 130 kDa. Antiserum directed to this 130-kDa protein was made and used to clone the gene coding for the protein. The cloned gene in pBluescript II SK(+) was expressed in E. coli DH-5a. E. coli cells produced spherical inclusion bodies. The recombinant E. coli cells as well as the Percoll-purified inclusion bodies were active against A. cuprea, confirming the cloning of the gene responsible for the scarab activity. Although only one band was observed by SDS– PAGE, more than one 130-kDa protein could have comigrated to form the band. However, no more than one gene was found by screening the kgt11 library with antiserum. Since the antiserum used in the screening was based on the 130-kDa protein or proteins purified by SDS–PAGE, the serum should react with all proteins in the preparation. After extensive screening, it was concluded that there is only one cry gene that encodes for the 130-kDa protein in SDS-502.
The cloned gene was sequenced (Genbank Accession No. AB089299). One complete coding region for a 130kDa protein was found. By comparing the amino acid sequence of this SDS-502 protein with the existing crystal proteins, the cloned gene appeared to be a cry8 type. Indeed, the Bt d-endotoxin nomenclature committee assigned a new class, cry8Da, to this gene (http:// www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/index.html). The comparison among four Cry8 proteins, Cry8Aa, Cry8Ba, Cry8Ca, and Cry8Da, revealed several interesting observations as follows. First, the N-terminal amino acid residues from 1 to 310, presumably forming Domain I and a part of Domain II, were conserved more than the residues in the remaining toxic region up to 680. This observation was true even after the Cry3Aa sequence was added to the comparison. This region of Cry8Da has a higher level of homology with the corresponding region of Cry8Aa than of Cry8Ba and Cry8Ca. Second, the region between 390 and 470 residues, presumably a core part of Domain II, was highly diversified. Third, several sections of conserved sequences were observed in the region between 480 and 660 residues. Fourth, the protoxin region of Cry8Da, presumably starting at residue 681, was very similar to the corresponding region of Cry8Ca. These four observations strongly indicate that Bt is swapping the domains among the cry8 genes. Because of the sequence homology between the Cry8 proteins and Cry3Aa whose 3D structure has been determined (Li et al., 1991), a reasonable prediction of the structure of Cry8Da is possible. It is highly likely that Cry8Da has a 3D structure very similar to that of Cry3Aa. Even a distant Cry protein such as Cry2Aa has been shown to have a similar 3D-structure, which includes all characteristic secondary structures (i.e., a-helices and b-stands) (Morse et al., 2001). Based on this assumption, the amino acid residues that were conserved in all Cry8 proteins and Cry3Aa were plotted on the Cry3Aa 3D structure. As shown in Fig. 2, most of the conserved residues appeared to be located in the interior of the molecule. Interestingly, the conserved residues on the a-helices in Domain I, such as a-3, a-4, a-6, and a-7, were found mostly on the internal side of these helices. Fig. 2 top view (right) is particularly illustrative of this finding. There were much fewer conserved residues in Domain II and Domain III. Those residues also were internalized. Most of the conserved residues in Domain II and III were on b-2, b-3, b-10, b-11, b-17, b-20, and b-23. Domain II is known to be a receptor-binding domain (Schnepf et al., 1998). A BLAST search of the Cry8Da Domain II sequence showed moderate homology to the corresponding domain of Cry8Aa (US Patent 5554534),
S. Asano et al. / Biological Control 28 (2003) 191–196
195
Fig. 2. Cry3Aa 3D structure with amino acid residues that are conserved (identical) among four Cry8 proteins and Cry3Aa. The conserved residues are shown in black. A side view (left) and a top view (right).
Cry9Ba (Shevelev et al., 1993), Cry9Ca (Lambert et al., 1996), Cry9Da (Genbank Accession No. D85560 submitted by Asano as unpublished), and Cry9Ea (Genbank Accession No. AB011496, Midoh and Oyama, unpublished). Crickmore (2000) reported Domain II homology among these proteins before Cry8Da was discovered. Domain II loop sequences, which are presumably involved in the receptor binding, were compared among BLAST-identified, Domain II-homologous proteins. No significant homology was found among Cry8Da, Cry9Ba, and Cry9Ca. Cry9Ba and Cry9Ca are specific to lepidopteran insects (Lambert et al., 1996; Shevelev et al., 1993). On the other hand, the loop sequences of Cry8Da were homologous to the loop sequences of Cry8Aa, Cry9Da, and Cry9Ea. Interestingly, Cry8Aa and Cry9Da were reported to be active against coleopteran insects (US Patent 5554534, Asano personal communication). This finding is a good indication that Domain II loops determine the host specificity.
C; p ¼ 0:1378, Bt2 vs C) and between chemical treatment and untreated control (p ¼ 0:264, C vs NT). Counts of surviving insects demonstrated a good insect control with Bt-treatments. One or no A. cuprea larva was found per plant in the plots treated with Bt and the chemical while six larvae per plant were found in the control plots. It is possible that the artificially infested larvae at the beginning of the trial were killed in a short period with Bt and no natural infestation occurred afterward. Soil samples obtained from Bt-treated plots appeared to be insecticidal for a long period (Fig. 4).
3.4. Field trial Due to the encouraging laboratory assay results, the SDS-502 strain was tested in the field of scarab control to determine the feasibility for soil application. The fermentation product, spray-dried powder, was formulated into a granular formulation and tested in a patch of peanut field. Fig. 3 indicates that Bt-treated plots produced higher amounts of undamaged nuts. A statistical analysis confirmed that Bt treatment showed a significant effect on the undamaged nuts production over untreated control plots (p ¼ 0:00917, Bt1 vs NT; p ¼ 0:00894, Bt2 vs NT). However, no statistical significance was observed in undamaged nut productions between Bt and chemical treatments (p ¼ 0:1416, Bt1 vs
Fig. 3. Effects of Bt and chemical treatments to undamaged nuts productions. Bars standard deviation show the means of undamaged nuts productions from 3 plots per treatment. For each plot, 10 sample plants were used to determine the undamaged nut production. Bt1, treated with SDS-502 at 0.06 g/m2 ; Bt2, SDS-502 at 0.12 g/m2 ; C, fenthion at 0.45 g/m2 ; and NT, non-treated control. Different lowercase letters indicate statistical significance ðp < 0:05Þ based on TukeyÕs studentized range test conducted between each treatment (Bt1, Bt2, or C) and non-treated control (NT).
196
S. Asano et al. / Biological Control 28 (2003) 191–196
Fig. 4. Residual activity of SDS-502 found in soil samples. Dotted line indicates a plot treated with SDS-502 at 0.06 g/m2 and solid line 0.12 g/m2 .
The samples taken from a plot treated with high-rate Bt killed 100% of A. cuprea larvae as long as 56 days after the application. At the harvest time, some P. japonica and A. rufocuprea larvae were found in both treated (7– 9/plot) and untreated plots (15/plot). Presumably, these naturally occurring insects invaded the test plots in August or later after the plants were matured and residual activity of Bt diminished. Matured plants were more resistant to the insect damage to the nuts because of their hardened nutshells. These findings described here are particularly encouraging for commercial application of this new Bt strain. We are now studying methods of post-planting application.
Acknowledgments The authors thank Dr. Ajoy Roy, Maxigen, for his assistance in statistical analysis and Dr. Hisanori Bando, Hokkaido University, for his support in cloning and sequencing the cry8Da gene.
References Baba, F., Asano, S., Iizuka, T., 1990. Purification of crystals from Bacillus thuringiensis by using Percoll. J. Sericult. Sci. Jpn. 59, 487– 489. Beegle, C.C., Yamamoto, T., 1992. Invitation paper (C.P. Alexander Fund): history of Bacillus thuringiensis Berliner research and development. Can. Entomol. 124, 587–616.
Bonnefoi, A., de Barjac, H., 1963. Classification des souches du groupe Bacillus thuringiensis par la determination de lÕantigene flagellaire. Entomophaga 8, 223–229. Crickmore, N., 2000. The diversity of Bacillus thuringiensis dendotoxins. In: Charles, J.-F., Delecluse, A., Nielsen-LeRoux, C. (Eds.), Entomopathogenic bacteria: from laboratory to field application. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 65–79. Isegawa, Y., Sheng, J., Sokawa, Y., Yamanishi, K., Nakagomi, O., Ueda, S., 1992. Selective amplification of cDNA sequence from total RNA by cassette-ligation mediated polymerase chain reaction (PCR): application to sequencing 6.5 kb genome segment of hantavirus strain B-1. Mol. Cell. Probes 6, 467–475. Lambert, B., Buysse, L., Decock, C., Jansens, S., Piens, C., Saey, B., Seurinck, J., Van Audenhove, K., Van Rie, J., Van Vliet, A., Peferoen, M., 1996. A Bacillus thuringiensis insecticidal crystal protein with a high activity against members of the family Noctuidae. Appl. Environ. Microbiol. 62, 80–86. Li, J.D., Carroll, J., Ellar, D.J., 1991. Crystal structure of insecticidal d-endotoxin from Bacillus thuringiensis at 2.5 A resolution. Nature 353, 815–821. Luttrell, R.G., Wan, L., Knighten, K., 1999. Variation in susceptibility of noctuid (Lepidoptera) larvae attacking cotton and soybean to purified endotoxin proteins and commercial formulations of Bacillus thuringiensis. J. Econ. Entomol. 29, 21–32. Morse, R.J., Yamamoto, T., Stroud, R.M., 2001. Structure of Cry2Aa suggests an unexpected receptor-binding epitope. Structure 9, 409– 417. Ohba, M., Iwahana, H., Asano, S., Suzuki, N., Sato, R., Hori, H., 1992. A unique isolate of Bacillus thuringiensis serovar japonensis with a high larvicidal activity specific for scarabaeid beetles. J. Appl. Microbiol. 14, 54–57. Sasaki, J., Asano, S., Iizuka, T., Bando, H., Lay, B.W., Hastowo, S., Powell, G.K., Yamamoto, T., 1996. Insecticidal activity of the protein encoded by the cryV gene of Bacillus thuringiensis kurstaki INA-02. Curr. Microbiol. 32, 195–200. Sato, R., Takeuchi, K., Ogiwara, K., Minami, M., Kaji, Y., Suzuki, N., Hori, H., Asano, S., Ohba, M., Iwahana, H., 1994. Cloning, heterologous expression, and localization of a novel crystal protein gene from Bacillus thuringiensis serovar japonensis strain buibui toxic to scarabaeid insects. Curr. Microbiol. 28, 15–19. Schnepf, E., Crickmore, N., Van Rie, J., Lereclus, D., Baum, J., Feitelson, J., Zeigler, D.R., Dean, D.H., 1998. Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 62, 775–806. Sharpe, E.S., 1976. Toxicity of the parasporal crystal of Bacillus thuringiensis to Japanese beetle larvae. J. Invertebr. Pathol. 27, 421–422. Shevelev, A.B., Svarinsky, M.A., Karasin, A.I., Kogan Ya, N., Chestukhina, G.G., Stepanov, V.M., 1993. Primary structure of cryX, the novel delta-endotoxin-related gene from Bacillus thuringiensis spp. galleriae. FEBS Lett. 336, 79–82. Yamamoto, T., 1990. Identification of entomocidal toxins of Bacillus thuringiensis by high-performance liquid chromatography. In: Hickle, L.A., Fitch, W.L. (Eds.), Analytical Chemistry of Bacillus thuringiensis. American Chemical Society, Washington, DC, pp. 46–60.
A strain of Bacillus thuringiensis subsp. galleriae containing a novel cry8 gene highly toxic to Anomala cuprea (Coleoptera: Scarabaeidae) Shin-ichiro Asano,a Chikage Yamashita,a Toshihiko Iizuka,a Katsuyoshi Takeuchi,b Satoshi Yamanaka,b David Cerf,c and Takashi Yamamotoc,* b
a Graduate School of Agriculture, Hokkaido University, Sapporo 060-8589, Japan Tsukuba Technology Center, SDS-Biotech K. K., Tsukuba, Ibaraki 300-2646, Japan c Verdia Inc., Redwood City, CA 94063, USA
Received 31 October 2002; accepted 6 March 2003
Abstract A strain of Bacillus thuringiensis (Bt) subsp. galleriae highly toxic to the cupreous chafer, Anomala cuprea, was isolated from a soil sample collected in Japan. The strain, SDS-502, produces a crystal consisting of a 130-kDa protein. The gene encoding the protein was cloned in Escherichia coli using antiserum directed to the protein. The gene was expressed in E. coli, producing a 130kDa protein toxic to A. cuprea. Sequencing of the cloned gene indicated a typical Bt cry gene with substantial homology to cry8 genes. Based on the peptide sequence comparison, the gene found in SDS-502 was designated as cry8Da (AB089299). The cry8Da gene was highly expressed in SDS-502 in a laboratory scale bioreactor. The fermentation product of SDS-502 was formulated for soil application and tested in a peanut field for chafer control along with a chemical insecticide reference, a fenthion organophosphate granular formulation. Judging from the amount of undamaged nuts harvested from plots of different treatments, plots treated with SDS-502 had significantly better insect control than the untreated plots. The chemical insecticide plots showed no significant difference in nut damage from the Bt-treated or control plots. Ó 2003 Elsevier Science (USA). All rights reserved. Keywords: Bacillus thuringiensis; Galleriae; SDS-502; cry8Da; AB089299; Anomala cuprea; Cupreous chafer; Field trial
1. Introduction Bacillus thuringiensis Berliner (Bt) is a rod-shaped, Gram-positive, spore-forming bacterium, which is often isolated from soil. A large number of Bt strains have been isolated and classified into different subspecies by flagellar serotyping supplemented with biochemical characterization. Bt grows in a simple culture medium such as nutrient broth under aerobic conditions. When nutrients are exhausted, Bt produces a spore along with one or several parasporal crystals. The crystals are made of proteins of various sizes. These proteins are called crystal proteins and are often insecticidal. When the spore matures, Bt cells lyse and release free spores and crystals. The spore–crystal complex can be collected by *
Corresponding author. Fax: 1-650-364-2715. E-mail address: [email protected] (T. Yamamoto).
centrifugation and formulated into a sprayable insecticide. Bt is certainly the most successful biological pesticide. Some crystal proteins have very high activity specific to certain insect species. For example, Luttrell et al. (1999) reported that Cry1Ac1, a crystal protein highly toxic to Heliothis virescens (Fabricus), has an LC50 against neonate larvae as low as 0.07 ppm when mixed in artificial diet. Because of the high activity, Bt is widely used to control lepidopteran insects that feed on foliage. Applications towards non-lepidopteran insects are not as common as applications towards lepidopteran insects. Bt tenebrionis and Bt israelensis have been used commercially to control coleopteran insects, especially the Colorado potato beetle and dipteran insects, respectively (Beegle and Yamamoto, 1992). These Bt strains have high specific activities against the corresponding target insects. There are several Bt subspecies, which show activity to other coleopteran insects such as
1049-9644/$ - see front matter Ó 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S1049-9644(03)00060-4
192
S. Asano et al. / Biological Control 28 (2003) 191–196
those in the Scarabaeidae family. Sharpe (1976) reported that parasporal inclusion of Bt galleriae NRRL B-4027 was toxic to the Japanese beetle, Popillia japonica Newman. Ohba et al. (1992) found a strain of Bt japonensis called ‘‘buibui’’ toxic to several scarab beetles. A cry gene, designated as cry8Ca, was cloned from the buibui strain, and its protein showed toxicity against Anomala cuprea Hope, Anomala rufocuprea Motsch and P. japonica (Sato et al., 1994). Two additional cry8 genes, cry8Aa, and cry8Ba, have been cloned from the PS50C strain of Bt kumamotoensis active against Cotinis sp. (June beetle) (US Patent 5554534). We are interested in finding a gene that is active against scarab beetles. In this report, we describe the discovery of a new Bt strain highly active against scarab beetles such as A. cuprea. A novel cry8 gene was cloned from this strain, and the spore and crystal complex from this strain was tested for A. cuprea control in soil. Some of the aspects described in this paper have been included in patent applications in Japan (P2002-45186A) and in the US.
2. Materials and methods 2.1. Isolation of Bt cultures A soil sample collected in Ibaraki, Japan was suspended in sterile water at 1 mg/ml. After shaking for 30 min, the suspension was left to stand for a few minutes to let coarse materials settle. An aliquot of the top clear layer was sampled in a test tube and treated at 80 °C for 10 min to kill non-sporogenic microorganisms. Dilutions of the heat-treated sample were then plated on nutrient agar plates and incubated for 48 h at 30 °C. Among the colonies that appeared on the plates, Bt colonies were identified by colony morphology and microscopic observation for the spore and crystal formation. Serotyping of selected Bt isolates was done by the method described by Bonnefoi and de Barjac (1963). 2.2. Insect screening Bt isolates obtained from soil samples were grown in 50 ml CYS medium (Yamamoto, 1990) in 200 ml flasks for 72 h at 30 °C. The crystals were harvested by centrifugation and re-suspended in 10 ml water. An aliquot (1 ml) of the crystal suspension was mixed with 5 g of sterile compost in a plastic cup containing five A. cuprea second-instar larvae. The larvae were obtained from eggs laid by A. cuprea adults collected around our facility in Tsukuba, Japan. The larvae were allowed to feed in the compost mixture for 7 days at 25 °C. The screening was conducted in two summers from May to September when a reasonable number of adult insects could be collected.
2.3. Protein purification and bioassay The SDS-502 strain was grown in a flask containing the CYS medium at 30 °C for 72 h. The crystals were purified by centrifugation in Percoll (Baba et al., 1990) and suspended in water to the final protein concentration of 10 lg=ml. In order to produce a specific antiserum, the antigen, SDS-502 crystal protein, was purified by SDS–PAGE. The purified crystals were dissolved in 0.1 N NaOH with 2% 2-mercaptoethanol and subjected to a preparative SDS–PAGE. The 130 kDa-crystal protein band was elelctro-eluted from the gel and injected into a guinea pig. Bioassay was conducted with the Percoll-purified crystal suspension in sterile compost as described in the insect screening section. Assays were carried out against first- to third-instar larvae of A. cuprea, A. orientalis, and P. japonica. The same crystal suspension was assayed against third to fourth-instar larvae of Bombyx mori (Linnaeus), Spodoptera litura (Fabricius), and Plutella xylostella (Linnaeus). In this case, the crystal suspension was placed on mulberry (B. mori), cabbage (S. litura and P. xylostella) leaves, and insects were allowed to feed at 30 °C for 5 days (B. mori and S. litura) or for 2 days (P. xylostella). At the end of the incubation, larval mortality was recorded. The cloned cry gene was expressed in Escherichia coli DH5-a producing inclusion bodies. These inclusion bodies were purified as described for SDS-502 crystals and assayed against A. cuprea. The gene was also cloned in a cry-minus Bt strain, BT51 as described in the gene cloning section (Sasaki et al., 1996). The purified crystals from BT51 were solubilized in 0.1 N NaOH. The protein was purified by differential solubilization between pH 8 at which the protein was soluble and pH 4.4 at which the protein was precipitated. The purified crystal protein was assayed against first-instar larvae of Diabrotica undecimpunctata undecimpunctata Mannerheim in 48-well plates containing a corn rootworm artificial diet obtained from Bio-Serv. The purified crystal protein in 100 ll 50 mM sodium bicarbonate was placed on the diet in each well at various concentrations, and D. undecimpunctata larvae were allowed to feed on the diet for 5 days at 25 °C. 2.4. Gene cloning Genomic DNA prepared from vegetatively growing Bt was digested with EcoRI. A fraction of EcoRI-digested DNA from 2 to 5 kb in size was ligated with EcoRI-digested kgt11 and cloned in E. coli DH5-a. Transformed E. coli cells were screened for Bt cry gene expression with antiserum made in guinea pig against the SDS-502 crystal protein(s). Colonies showing positive reaction to the antiserum were screened for the proper size insert. A clone showing a 3.4-kb insert was
S. Asano et al. / Biological Control 28 (2003) 191–196
partially sequenced to confirm the cloning of a cry gene. Since this cloned insert missed a portion of the 30 end, the missing portion was cloned by PCR (polymerase chain reaction) using TaKaRa LA PCR Cloning Kit (Isegawa et al., 1992). HindIII-digested genomic DNA was cloned in the HindIII cassette included in the kit, and portions containing the missing fragment were amplified between SDS-502 specific primers, Primer 1: 50 -tgcaacatttgaagcagaagaagacc and Primer 2: 50 ttgatacagaaacatatccaacgtatc, and Cassette Primer C1 and C2 provided in the kit. Amplified DNA was cloned in pGEM-T Easy (Promega) and sequenced to confirm the sequence of the cloned SDS-502 gene. A DNA fragment containing the complete cry gene was cloned in pBluescript II SK(+). In order to clone the cry gene from SDS-502 in BT51, the protein-coding region of the cloned gene was amplified by PCR with NcoI and BamHI sites that were engineered at the translation start and end, respectively. The PCR amplified gene was then cloned in the shuttle vector as described by Sasaki et al. (1996). 2.5. Field trial SDS-502 was fermented in a 5-L laboratory bioreactor using a soybean flour-based medium. At the end of fermentation, the spores and crystals were collected by centrifugation, dried by spray drying and formulated into a granular formulation for soil application. The amount of crystal protein(s) in the formulation was determined by SDS–PAGE. The field trial was conducted in a patch of peanut field consisting of three rows of 65 cm-wide, 20 cm-high ridges, where peanut plants were cultivated and treatments were made, and 55 cm-wide furrows. Each ridge was divided into four 5 m-long plots and there were 12 plots in the test patch. Before planting in May, the SDS502 formulation was sprayed onto the ground at 0:06 (crystal protein) and 0:12 g=m2 and tilled into the soil ca 20 cm deep. Plots treated with a granular formulation of a fenthion chemical insecticide at a rate of 0:45 g=m2 (active ingredient) were also prepared. Non-treated, control plots were arranged for comparison. These chemical and non-treated plots were also tilled. In each plot, about 30 peanut seedlings were planted. Each treatment was conducted in three replicated plots arranged at random in the test patch. At the time of planting, first-instar A. cuprea larvae were released to the field at one larva/plant. The insect release was repeated on the fifteenth day after the planting. In October, nuts were harvested from 10 randomly selected plants from each plot and sorted into two groups: undamaged and damaged by insects and/or fungi. Surviving larvae in each plot were counted at the time of harvesting. To compare the efficacy among three treatments, undamaged nuts production was analyzed by
193
TukeyÕs studentized range test at the 0.05 significance level. Residual activity of the SDS-502 crystals in soil was tracked by insect bioassay. Soil samples were collected from the plots treated with SDS-502 at ca 14-day intervals for up to 106 days. Insect mortality caused by Bt in soil samples was observed in ten replications in plastic cups (7 cm wide 3.5 cm high) containing one A. cuprea first-instar larva per cup. During the 3-week incubation at 26 °C, a piece of fresh cabbage leaf was placed weekly on the surface of the soil to supplement organic matter in the soil for insect consumption.
3. Results and discussion 3.1. Isolation and characterization of the scarab-active Bt isolate About 2000 Bt isolates were collected from different soil samples obtained from various locations within Ibaraki. The entire collection was screened against A. cuprea, and several isolates showing reproducible activity were found. One of these isolates designated as SDS-502 had the highest activity. The SDS-502 strain appeared to be a typical Bt producing, besides a spore, a spherical crystal (Fig. 1A). The crystal morphology of SDS-502 appeared to be similar to that of the buibui strain of Bt japonensis. The SDS-502 crystals were purified and their protein component(s) were analyzed by SDS–PAGE. As shown in Fig. 1B, SDS–PAGE revealed one band around 130 kDa. Upon serotyping the flagellar
Fig. 1. (A) Scanning electron micrograph of a sporulating culture of SDS-502. Arrows indicate the crystals produced by the culture. (B) SDS–PAGE of purified SDS-502 crystals (right lane). Molecular weight markers on the left were myosin (200,000), b-galactosidase (116,000), phosphorylase B (97,000), bovine serum albumin (66,000), and ovalbumin (45,000).
194
S. Asano et al. / Biological Control 28 (2003) 191–196
3.3. Sequence analysis
Table 1 Insecticidal activity of SDS-502 and HD8 Insects
Age (instar)
Mortality (%) SDS-502
HD8
Bombyx mori Plutella xylostella Spodoptera litura Anomala cuprea
4 4 3 1 2 3
0 40 0 100 100 80
80 80 40 0 0 0
Anomala orientalis
1 2
100 100
0 0
Popillia japonica
1 2 1
100 100 0
Diabrotica undecimpunctata
0 0 Not tested
antigen, SDS-502 was determined to be a galleriae strain. The purified crystals were tested against several different insects. As shown in Table 1, SDS-502 has substantial activity against insects in the Scarabaeidae. At 2 ppm (i.e., 10 lg crystal protein in 5 g compost), 100% of the first and second-instar larvae were killed in 7 days. Older larvae (third instar) also showed high mortality. On the other hand, no mortality was recorded with a Lepidopera-active galleriae strain, HD-8. No toxicity was observed with SDS-502 crystals against B. mori and S. litura. A weak but substantial (40%) mortality was seen with P. xylostella. The SDS-502 crystal protein purified from BT51 was tested against D. undecimpunctata, but no activity was found up to the highest concentration of 700 lg=cm2 . 3.2. Gene responsible for the scarab activity SDS–PAGE of the SDS-502 crystals showed one distinctive band around 130 kDa. Antiserum directed to this 130-kDa protein was made and used to clone the gene coding for the protein. The cloned gene in pBluescript II SK(+) was expressed in E. coli DH-5a. E. coli cells produced spherical inclusion bodies. The recombinant E. coli cells as well as the Percoll-purified inclusion bodies were active against A. cuprea, confirming the cloning of the gene responsible for the scarab activity. Although only one band was observed by SDS– PAGE, more than one 130-kDa protein could have comigrated to form the band. However, no more than one gene was found by screening the kgt11 library with antiserum. Since the antiserum used in the screening was based on the 130-kDa protein or proteins purified by SDS–PAGE, the serum should react with all proteins in the preparation. After extensive screening, it was concluded that there is only one cry gene that encodes for the 130-kDa protein in SDS-502.
The cloned gene was sequenced (Genbank Accession No. AB089299). One complete coding region for a 130kDa protein was found. By comparing the amino acid sequence of this SDS-502 protein with the existing crystal proteins, the cloned gene appeared to be a cry8 type. Indeed, the Bt d-endotoxin nomenclature committee assigned a new class, cry8Da, to this gene (http:// www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/index.html). The comparison among four Cry8 proteins, Cry8Aa, Cry8Ba, Cry8Ca, and Cry8Da, revealed several interesting observations as follows. First, the N-terminal amino acid residues from 1 to 310, presumably forming Domain I and a part of Domain II, were conserved more than the residues in the remaining toxic region up to 680. This observation was true even after the Cry3Aa sequence was added to the comparison. This region of Cry8Da has a higher level of homology with the corresponding region of Cry8Aa than of Cry8Ba and Cry8Ca. Second, the region between 390 and 470 residues, presumably a core part of Domain II, was highly diversified. Third, several sections of conserved sequences were observed in the region between 480 and 660 residues. Fourth, the protoxin region of Cry8Da, presumably starting at residue 681, was very similar to the corresponding region of Cry8Ca. These four observations strongly indicate that Bt is swapping the domains among the cry8 genes. Because of the sequence homology between the Cry8 proteins and Cry3Aa whose 3D structure has been determined (Li et al., 1991), a reasonable prediction of the structure of Cry8Da is possible. It is highly likely that Cry8Da has a 3D structure very similar to that of Cry3Aa. Even a distant Cry protein such as Cry2Aa has been shown to have a similar 3D-structure, which includes all characteristic secondary structures (i.e., a-helices and b-stands) (Morse et al., 2001). Based on this assumption, the amino acid residues that were conserved in all Cry8 proteins and Cry3Aa were plotted on the Cry3Aa 3D structure. As shown in Fig. 2, most of the conserved residues appeared to be located in the interior of the molecule. Interestingly, the conserved residues on the a-helices in Domain I, such as a-3, a-4, a-6, and a-7, were found mostly on the internal side of these helices. Fig. 2 top view (right) is particularly illustrative of this finding. There were much fewer conserved residues in Domain II and Domain III. Those residues also were internalized. Most of the conserved residues in Domain II and III were on b-2, b-3, b-10, b-11, b-17, b-20, and b-23. Domain II is known to be a receptor-binding domain (Schnepf et al., 1998). A BLAST search of the Cry8Da Domain II sequence showed moderate homology to the corresponding domain of Cry8Aa (US Patent 5554534),
S. Asano et al. / Biological Control 28 (2003) 191–196
195
Fig. 2. Cry3Aa 3D structure with amino acid residues that are conserved (identical) among four Cry8 proteins and Cry3Aa. The conserved residues are shown in black. A side view (left) and a top view (right).
Cry9Ba (Shevelev et al., 1993), Cry9Ca (Lambert et al., 1996), Cry9Da (Genbank Accession No. D85560 submitted by Asano as unpublished), and Cry9Ea (Genbank Accession No. AB011496, Midoh and Oyama, unpublished). Crickmore (2000) reported Domain II homology among these proteins before Cry8Da was discovered. Domain II loop sequences, which are presumably involved in the receptor binding, were compared among BLAST-identified, Domain II-homologous proteins. No significant homology was found among Cry8Da, Cry9Ba, and Cry9Ca. Cry9Ba and Cry9Ca are specific to lepidopteran insects (Lambert et al., 1996; Shevelev et al., 1993). On the other hand, the loop sequences of Cry8Da were homologous to the loop sequences of Cry8Aa, Cry9Da, and Cry9Ea. Interestingly, Cry8Aa and Cry9Da were reported to be active against coleopteran insects (US Patent 5554534, Asano personal communication). This finding is a good indication that Domain II loops determine the host specificity.
C; p ¼ 0:1378, Bt2 vs C) and between chemical treatment and untreated control (p ¼ 0:264, C vs NT). Counts of surviving insects demonstrated a good insect control with Bt-treatments. One or no A. cuprea larva was found per plant in the plots treated with Bt and the chemical while six larvae per plant were found in the control plots. It is possible that the artificially infested larvae at the beginning of the trial were killed in a short period with Bt and no natural infestation occurred afterward. Soil samples obtained from Bt-treated plots appeared to be insecticidal for a long period (Fig. 4).
3.4. Field trial Due to the encouraging laboratory assay results, the SDS-502 strain was tested in the field of scarab control to determine the feasibility for soil application. The fermentation product, spray-dried powder, was formulated into a granular formulation and tested in a patch of peanut field. Fig. 3 indicates that Bt-treated plots produced higher amounts of undamaged nuts. A statistical analysis confirmed that Bt treatment showed a significant effect on the undamaged nuts production over untreated control plots (p ¼ 0:00917, Bt1 vs NT; p ¼ 0:00894, Bt2 vs NT). However, no statistical significance was observed in undamaged nut productions between Bt and chemical treatments (p ¼ 0:1416, Bt1 vs
Fig. 3. Effects of Bt and chemical treatments to undamaged nuts productions. Bars standard deviation show the means of undamaged nuts productions from 3 plots per treatment. For each plot, 10 sample plants were used to determine the undamaged nut production. Bt1, treated with SDS-502 at 0.06 g/m2 ; Bt2, SDS-502 at 0.12 g/m2 ; C, fenthion at 0.45 g/m2 ; and NT, non-treated control. Different lowercase letters indicate statistical significance ðp < 0:05Þ based on TukeyÕs studentized range test conducted between each treatment (Bt1, Bt2, or C) and non-treated control (NT).
196
S. Asano et al. / Biological Control 28 (2003) 191–196
Fig. 4. Residual activity of SDS-502 found in soil samples. Dotted line indicates a plot treated with SDS-502 at 0.06 g/m2 and solid line 0.12 g/m2 .
The samples taken from a plot treated with high-rate Bt killed 100% of A. cuprea larvae as long as 56 days after the application. At the harvest time, some P. japonica and A. rufocuprea larvae were found in both treated (7– 9/plot) and untreated plots (15/plot). Presumably, these naturally occurring insects invaded the test plots in August or later after the plants were matured and residual activity of Bt diminished. Matured plants were more resistant to the insect damage to the nuts because of their hardened nutshells. These findings described here are particularly encouraging for commercial application of this new Bt strain. We are now studying methods of post-planting application.
Acknowledgments The authors thank Dr. Ajoy Roy, Maxigen, for his assistance in statistical analysis and Dr. Hisanori Bando, Hokkaido University, for his support in cloning and sequencing the cry8Da gene.
References Baba, F., Asano, S., Iizuka, T., 1990. Purification of crystals from Bacillus thuringiensis by using Percoll. J. Sericult. Sci. Jpn. 59, 487– 489. Beegle, C.C., Yamamoto, T., 1992. Invitation paper (C.P. Alexander Fund): history of Bacillus thuringiensis Berliner research and development. Can. Entomol. 124, 587–616.
Bonnefoi, A., de Barjac, H., 1963. Classification des souches du groupe Bacillus thuringiensis par la determination de lÕantigene flagellaire. Entomophaga 8, 223–229. Crickmore, N., 2000. The diversity of Bacillus thuringiensis dendotoxins. In: Charles, J.-F., Delecluse, A., Nielsen-LeRoux, C. (Eds.), Entomopathogenic bacteria: from laboratory to field application. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 65–79. Isegawa, Y., Sheng, J., Sokawa, Y., Yamanishi, K., Nakagomi, O., Ueda, S., 1992. Selective amplification of cDNA sequence from total RNA by cassette-ligation mediated polymerase chain reaction (PCR): application to sequencing 6.5 kb genome segment of hantavirus strain B-1. Mol. Cell. Probes 6, 467–475. Lambert, B., Buysse, L., Decock, C., Jansens, S., Piens, C., Saey, B., Seurinck, J., Van Audenhove, K., Van Rie, J., Van Vliet, A., Peferoen, M., 1996. A Bacillus thuringiensis insecticidal crystal protein with a high activity against members of the family Noctuidae. Appl. Environ. Microbiol. 62, 80–86. Li, J.D., Carroll, J., Ellar, D.J., 1991. Crystal structure of insecticidal d-endotoxin from Bacillus thuringiensis at 2.5 A resolution. Nature 353, 815–821. Luttrell, R.G., Wan, L., Knighten, K., 1999. Variation in susceptibility of noctuid (Lepidoptera) larvae attacking cotton and soybean to purified endotoxin proteins and commercial formulations of Bacillus thuringiensis. J. Econ. Entomol. 29, 21–32. Morse, R.J., Yamamoto, T., Stroud, R.M., 2001. Structure of Cry2Aa suggests an unexpected receptor-binding epitope. Structure 9, 409– 417. Ohba, M., Iwahana, H., Asano, S., Suzuki, N., Sato, R., Hori, H., 1992. A unique isolate of Bacillus thuringiensis serovar japonensis with a high larvicidal activity specific for scarabaeid beetles. J. Appl. Microbiol. 14, 54–57. Sasaki, J., Asano, S., Iizuka, T., Bando, H., Lay, B.W., Hastowo, S., Powell, G.K., Yamamoto, T., 1996. Insecticidal activity of the protein encoded by the cryV gene of Bacillus thuringiensis kurstaki INA-02. Curr. Microbiol. 32, 195–200. Sato, R., Takeuchi, K., Ogiwara, K., Minami, M., Kaji, Y., Suzuki, N., Hori, H., Asano, S., Ohba, M., Iwahana, H., 1994. Cloning, heterologous expression, and localization of a novel crystal protein gene from Bacillus thuringiensis serovar japonensis strain buibui toxic to scarabaeid insects. Curr. Microbiol. 28, 15–19. Schnepf, E., Crickmore, N., Van Rie, J., Lereclus, D., Baum, J., Feitelson, J., Zeigler, D.R., Dean, D.H., 1998. Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 62, 775–806. Sharpe, E.S., 1976. Toxicity of the parasporal crystal of Bacillus thuringiensis to Japanese beetle larvae. J. Invertebr. Pathol. 27, 421–422. Shevelev, A.B., Svarinsky, M.A., Karasin, A.I., Kogan Ya, N., Chestukhina, G.G., Stepanov, V.M., 1993. Primary structure of cryX, the novel delta-endotoxin-related gene from Bacillus thuringiensis spp. galleriae. FEBS Lett. 336, 79–82. Yamamoto, T., 1990. Identification of entomocidal toxins of Bacillus thuringiensis by high-performance liquid chromatography. In: Hickle, L.A., Fitch, W.L. (Eds.), Analytical Chemistry of Bacillus thuringiensis. American Chemical Society, Washington, DC, pp. 46–60.