- Email: [email protected]
A strategy for rapid cDNA cloning from double-stranded RNA templates isolated from plants infected with RNA viruses by using Taq DNA polymerase
Journal of Virological Methods 84 (2000) 59 – 63 www.elsevier.com/locate/jviromet
A strategy for rapid cDNA cloning from double-stranded RNA templates isolated from plants infected with RNA viruses by using Taq DNA polymerase Yun-ping Zhang, Adib Rowhani * Department of Plant Pathology, Uni6ersity of California, One Shields A6enue, Da6is, CA 95616, USA Received 30 April 1999; received in revised form 3 September 1999; accepted 6 September 1999
Abstract A fast and efficient cDNA cloning procedure for plant RNA viruses was developed. In this procedure, doublestranded RNA (dsRNA) was used as a template source. Standard cDNA synthesis reagents and random hexamers were then used for making cDNAs. Taq DNA polymerase was used to add additional (A) at the ends of cDNAs, a TA cloning kit to ligate the cDNAs to vectors, and an electroporator to transform the DNAs to E. coli cells. dsRNAs were extracted from grapevine tissues infected with four different viruses and used for cloning. These viruses included grapevine rupestris stem pitting associated virus, grapevine leafroll associated virus 5, and two uncharacterized grapevine viruses, one each closely related to marafivirus and vitivirus groups. Selected cDNA clones were sequenced and PCR primers were developed for RT-PCR detection of these viruses in host plants. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Grapevine virus; Virus detection; PCR; cDNA cloning; dsRNA
1. Introduction Complementary DNA (cDNA) cloning has been a primary technique for manipulating RNA and for the study of other molecular mechanisms since its introduction in 1976 (Efstratiadis et al., 1976; Rougeon and Mach, 1976). One of the important steps in cDNA cloning is the ligation of the double-stranded cDNA into * Corresponding author. Tel.: +1-530-752-5401; fax: + 1530-752-2132. E-mail address: [email protected] (A. Rowhani)
an appropriate cloning vector. Many different techniques have been used to accomplish this objective such as blunt end ligation, use of linkers or adapters, and d(G) or d(C) tailing (Okayama and Berg, 1982; Gubler and Hoffman, 1983; Imai et al., 1983; Jelkmann et al., 1989). Each of these techniques has limitations including: inefficiency of blunt end ligation; too many steps in the procedure when linkers or adapters are used that result in the loss of cDNA; or too many G-Cs resulting from d(C) or d(G) tailing, which causes difficulties in the subsequent sequencing (personal observations).
0166-0934/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 0 9 3 4 ( 9 9 ) 0 0 1 2 6 - 3
60
Y.-p. Zhang, A. Rowhani / Journal of Virological Methods 84 (2000) 59–63
Taq DNA polymerase has been one of the enzymes used most frequently in molecular biology since its discovery and utilization in polymerase chain reaction (PCR). One of its characteristics is the non-template dependent addition of an extra (A) at the 3% end of the doublestranded DNA, a property shared with other prokaryotic and eukaryotic DNA polymerases (Clark, 1988). This characteristic has been utilized for cloning the PCR products (Holton and Graham, 1990; Marchuk et al., 1990), subcloning of DNA fragments (Zhou et al., 1995), and construction of genomic DNA libraries (Huang and Pears, 1998; Kawata et al., 1998). We attempted to take advantage of this criterion for more efficient cDNA cloning from RNA templates. In this paper we report a new approach for making cDNA clones from RNA templates using Taq DNA polymerase.
2. Materials and methods
2.1. Virus isolates and reagents All virus isolates were maintained in Vitis 6inifera (grapevine) grown in the field. These virus isolates included grapevine rupestris stem pitting associated virus (GRSPaV), an unknown isolate similar to marafiviruses isolated from the same vine infected with GRSPaV, grapevine leafroll associated virus 5 (GLRaV-5), and an unknown isolate similar to vitiviruses. The enzymes used in this study were from Gibco BRL (Gaithersburg, MD) unless otherwise stated.
2.2. cDNA synthesis and d(A) tailing The templates used for cDNA cloning were double-stranded RNAs (dsRNA) extracted from cambium scrapings using a method described by Valverde (1990). The dsRNAs were denatured by incubating with 20 mM methylmercuric hydroxide for 10 min at room temperature, and the double stranded cDNAs were synthesized using the cDNA synthesis and plasmid cloning kit (BRL), following the manufacturer’s protocol. The DNA
was extracted with an equal volume of phenol/ chloroform/isoamyl alcohol (25:24:1) and precipitated with ammonium acetate and ethanol as recommended in the protocol. To add an additional (A) at the 3% end of double-stranded cDNA, the cDNA was resuspended in water and incubated at 72°C for 1 h with 0.2 mM dATP, 2.5 mM MgCl2, 1 ×PCR buffer (50 mM KCl, 10 mM Tris–HCl, pH 8.3), and 0.05 U/ml Taq DNA polymerase in a total volume of 30 ml. The DNA was extracted with phenol and precipitated by ethanol (Sambrook et al., 1989). The DNA was ligated to the pCR2.1 vector (Invitrogen, Carlsbad, CA) using the Invitrogen TA cloning kit as recommended by the manufacturer. The DNA was again precipitated with ethanol, air dried, and resuspended in 5 ml water. The circularized, double-stranded DNA was then transformed to Electromax DH10B cells (BRL) by electroporation using an electroporator (BRL) following the manufacturer’s recommendations. Heat shock transformation was used for comparison, but lower efficiency was observed with this method. The transformants were plated on ampicilin-agar media and screened for white colonies.
2.3. Screening of 6iral specific clones The recombinant colonies were transferred to nitrocellulose membranes and screened by colony hybridization as described by Sambrook et al. (1989). The colony blots were probed with 32P-labeled cDNA from dsRNA isolated from the same diseased plant as well as from healthy plant following the procedure described by Feinberg and Vogelstein (1983) with the substitution of DNA polymerase by M-MLV reverse transcriptase. Colonies that reacted only to probes made from diseased plant dsRNA were picked, cultured, and analyzed by restriction digestion with EcoRI (Sambrook et al., 1989). DNAs from these selected clones were then sequenced, and the sequences were compared to GenBank sequences using the blast program of the GCG software package (Genetic Computer Group, Madison, WI).
Y.-p. Zhang, A. Rowhani / Journal of Virological Methods 84 (2000) 59–63
2.4. RT-PCR detection Oligonucleotide primers were designed from positively identified clones and manufactured by Gibco BRL. Double-stranded RNAs isolated from virus-infected plants were used as templates and the RT-PCR was performed as described previously (Zhang et al., 1998b) to test the specificity of each pair of primers developed from the cloning experiments.
3. Results and discussion
3.1. cDNA clones of four grape6ine 6iruses For many plant viruses, especially viruses of woody plants, it is difficult to obtain pure virions. Double-stranded RNAs, on the other hand, are easy to extract from various virus infected plant tissues. The use of dsRNA as starting material to study plant viruses has proven to be a very effective approach in many cases of plant virus research (Jelkmann et al., 1989; Valverde, 1990; Zhang et al., 1998a). Thousands of recombinant colonies were produced using dsRNA as starting material, and 800 colonies from each library were selected for screening. Over 100 specific recombinant clones were identified for each target dsRNA after colony hybridization. Selected clones from each library were analyzed by restriction digestion with EcoRI and gel electrophoresis to determine their sizes. One clone from each library was selected for further study (Fig. 1). These four cDNA clones were sequenced, and the sequences were compared to GenBank sequences. They were determined to be: GRSPaV; an unknown virus with 67% similarity to oat blue dwarf virus (a member of marafivirus group); GLRaV 5; and an unknown virus with 76% similarity to grapevine virus A (a member of vitivirus group).
3.2. RT-PCR amplification from four 6iruses by primers de6eloped from the cDNA clones The primers designed for each virus are listed in
61
Table 1. These primers were: RSP 6-14 for GRSPaV, RSP 50-51 for the marafivirus, LR 3-4 for GLRaV 5, and GTV 1-2 for the vitivirus. They were used in RT-PCR for the detection of each virus from grapevines (Fig. 2). These RTPCR products were sequenced and showed 98– 100% identity to the sequences of their original cDNA clones, thus proving their specificity to the viruses from which they were cloned. The use of Taq DNA polymerase was only reported previously for cloning from a DNA, but not an RNA source (Holton and Graham, 1990; Marchuk et al., 1990). We developed a procedure to make cDNA clones from RNA templates using Taq DNA polymerase. This method eliminates the use of adapters and linkers, thereby reducing additional steps in cloning processes and lowering the chances of cDNA loss in the process. It creates compatible ends for cloning cDNA into the vector, hence increasing the ligation efficiency compared to blunt end ligation. It is very rapid, simple, and only a small amount of starting material is required. It is recommended that when
Fig. 1. Agarose gel electrophoresis of cDNA clones used in this study: Lane 1, DNA marker; lane 2, cDNA clone for a GRSPaV, 3 kb; lane 3, cDNA clone for the unknown virus related to marafivirus, 0.8 kb; lane 4, cDNA clone for GLRaV 5, 1.6 kb; lane 5, cDNA clone for the unknown virus related to vitivirus, 1.8 kb. The DNAs were digested with EcoRI. The top bands are the vectors and the lower bands are the inserts.
62
Y.-p. Zhang, A. Rowhani / Journal of Virological Methods 84 (2000) 59–63
Table 1 Primers and the sizes of their RT-PCR amplification products Primera
Primer sequence
Direction
Product size
RSP6 RSP14
5% CGTCCAAGAATTTTCAGGTT3% 5% CACTACTGCTGTCTACATAA3%
Forward Reverse
763 bp
RSP50 RSP51
5% GGGTCACCTCCGCCGCTTGGGAT3% 5% GCGGGAGCAGGCGAGCGTGGATA3%
Forward Reverse
287 bp
LR3 LR4
5% ACTCCCGGAACAATGTCATCTA3% 5% GAGAGCCAAGGAGAGACTTAT3%
Forward Reverse
348 bp
GTV1 GTV2
5% AGGGGGGAGATCCGAGCT3% 5% AGCCATGACCACGAGGAAGT3%
Forward Reverse
357 bp
a The specific PCR primers are: RSP 6-14 for GRSPaV; RSP 50-51 for the unknown virus related to marafivirus; LR3-4 for GLRaV 5; and GTV 1-2 for the unknown virus related to vitivirus.
large cDNA clones are desired, the cDNAs be fractionated by size selection columns before ligating to the vector. No pre-existing sequences are required in this procedure since random primers are used. The cDNA clones can be obtained for more than one virus from a multiply-infected plant at the same time as described in this paper (cDNAs for GRSPaV and the unknown related to marafivirus were cloned from a vine which was co-infected with both viruses). The genome of GRSPaV has been characterized (Zhang et al., 1998a) using cDNA clones produced by this new cDNA
Fig. 2. Agarose gel electrophoresis of RT-PCR products from dsRNA extraction from virus-infected and healthy grapevine. Lane 1, 1-kb DNA marker; lane 2, infected with GRSPaV; lane 4, infected with unknown related to marafivirus; lane 6, infected with GLRaV 5; lane 8, infected with unknown related to vitivirus. Lanes 3, 5, 7, and 9, healthy grapevines. Primers for each virus are as indicated in Table 1.
cloning methodology, and we are currently in the process of characterizing the other three viruses.
Acknowledgements We would like to acknowledge Lenka Biardi and Cheryl Covert for their critical review of the manuscript.
References Clark, J.M., 1988. Novel non-templated nucleotide addition reactions catalyzed by procaryotic and eucaryotic DNA polymerases. Nucleic Acids Res. 16, 9677 – 9686. Efstratiadis, A., Kafatos, F.C., Maxam, A.M., Maniatis, T., 1976. Enzymatic in vitro synthesis of globin genes. Cell 7, 279 – 288. Feinberg, A.P., Vogelstein, B., 1983. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6 – 13. Gubler, U., Hoffman, B.J., 1983. A simple and efficient method for generating cDNA libraries. Gene 25, 263 – 269. Holton, T.A., Graham, M.W., 1990. A simple and efficient method for direct clinging of PCR products using ddTtailed vectors. Nucleic Acids Res. 19, 1156. Huang, H.-J., Pears, C., 1998. Generation of genomic mini-libraries by Taq DNA polymerase modification of genomic fragments. BioTechniques 24, 566 – 568. Imai, M., Richardson, M.A., Ikegami, N., Shatkin, A.J., Furuichi, Y., 1983. Molecular cloning of double-stranded RNA virus genomes. Proc. Natl. Acad. Sci. USA 80, 373 – 377. Jelkmann, W., Martin, R.R., Maiss, E., 1989. Cloning of four plant viruses from small quantities of double-stranded RNA. Phytopathology 79, 1250 – 1253.
Y.-p. Zhang, A. Rowhani / Journal of Virological Methods 84 (2000) 59–63 Kawata, Y., Yano, S., Kojima, H., 1998. Construction of a genomic DNA library by TA cloning. BioTechniques 24, 564 – 565. Marchuk, D., Drumm, M., Saulino, A., Collins, F.S., 1990. Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Res. 19, 1154. Okayama, H., Berg, P., 1982. High-efficiency cloning of fulllength cDNA. Mol. Cell. Biol. 2, 161–170. Rougeon, F., Mach, B., 1976. Stepwise biosynthesis in vitro of globin genes from globin mRNA by DNA polymerase of avian myeloblastosis virus. Proc. Natl. Acad. Sci. USA 73, 3418 – 3422. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning, a Laboratory Manual, 2nd edn. Cold Spring
.
63
Harbor Laboratory Press, Cold Spring Harbor, New York. Valverde, R.A., 1990. Analysis of double-stranded RNA for plant virus diagnosis. Plant Dis. 74, 255 – 258. Zhang, Y.-P., Uyemoto, J.K., Golino, D.A., Rowhani, A., 1998a. Nucleotide sequence and RT-PCR detection of a virus associated with grapevine rupestris stem-pitting disease. Phytopathology 88, 1231 – 1237. Zhang, Y.-P., Uyemoto, J.K., Kirkpatrick, B.C., 1998b. A rapid, small scale procedure for extracting virus, viroid, MLO, and bacterial nucleic acids from plants for analysis by PCR. J. Virol. Methods 71, 45 – 50. Zhou, M.Y., Clerk, S.E., Gomez-Sanchez, C.E., 1995. Universal cloning method by TA strategy. BioTechniques 19, 34 – 35.
.
A strategy for rapid cDNA cloning from double-stranded RNA templates isolated from plants infected with RNA viruses by using Taq DNA polymerase Yun-ping Zhang, Adib Rowhani * Department of Plant Pathology, Uni6ersity of California, One Shields A6enue, Da6is, CA 95616, USA Received 30 April 1999; received in revised form 3 September 1999; accepted 6 September 1999
Abstract A fast and efficient cDNA cloning procedure for plant RNA viruses was developed. In this procedure, doublestranded RNA (dsRNA) was used as a template source. Standard cDNA synthesis reagents and random hexamers were then used for making cDNAs. Taq DNA polymerase was used to add additional (A) at the ends of cDNAs, a TA cloning kit to ligate the cDNAs to vectors, and an electroporator to transform the DNAs to E. coli cells. dsRNAs were extracted from grapevine tissues infected with four different viruses and used for cloning. These viruses included grapevine rupestris stem pitting associated virus, grapevine leafroll associated virus 5, and two uncharacterized grapevine viruses, one each closely related to marafivirus and vitivirus groups. Selected cDNA clones were sequenced and PCR primers were developed for RT-PCR detection of these viruses in host plants. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Grapevine virus; Virus detection; PCR; cDNA cloning; dsRNA
1. Introduction Complementary DNA (cDNA) cloning has been a primary technique for manipulating RNA and for the study of other molecular mechanisms since its introduction in 1976 (Efstratiadis et al., 1976; Rougeon and Mach, 1976). One of the important steps in cDNA cloning is the ligation of the double-stranded cDNA into * Corresponding author. Tel.: +1-530-752-5401; fax: + 1530-752-2132. E-mail address: [email protected] (A. Rowhani)
an appropriate cloning vector. Many different techniques have been used to accomplish this objective such as blunt end ligation, use of linkers or adapters, and d(G) or d(C) tailing (Okayama and Berg, 1982; Gubler and Hoffman, 1983; Imai et al., 1983; Jelkmann et al., 1989). Each of these techniques has limitations including: inefficiency of blunt end ligation; too many steps in the procedure when linkers or adapters are used that result in the loss of cDNA; or too many G-Cs resulting from d(C) or d(G) tailing, which causes difficulties in the subsequent sequencing (personal observations).
0166-0934/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 0 9 3 4 ( 9 9 ) 0 0 1 2 6 - 3
60
Y.-p. Zhang, A. Rowhani / Journal of Virological Methods 84 (2000) 59–63
Taq DNA polymerase has been one of the enzymes used most frequently in molecular biology since its discovery and utilization in polymerase chain reaction (PCR). One of its characteristics is the non-template dependent addition of an extra (A) at the 3% end of the doublestranded DNA, a property shared with other prokaryotic and eukaryotic DNA polymerases (Clark, 1988). This characteristic has been utilized for cloning the PCR products (Holton and Graham, 1990; Marchuk et al., 1990), subcloning of DNA fragments (Zhou et al., 1995), and construction of genomic DNA libraries (Huang and Pears, 1998; Kawata et al., 1998). We attempted to take advantage of this criterion for more efficient cDNA cloning from RNA templates. In this paper we report a new approach for making cDNA clones from RNA templates using Taq DNA polymerase.
2. Materials and methods
2.1. Virus isolates and reagents All virus isolates were maintained in Vitis 6inifera (grapevine) grown in the field. These virus isolates included grapevine rupestris stem pitting associated virus (GRSPaV), an unknown isolate similar to marafiviruses isolated from the same vine infected with GRSPaV, grapevine leafroll associated virus 5 (GLRaV-5), and an unknown isolate similar to vitiviruses. The enzymes used in this study were from Gibco BRL (Gaithersburg, MD) unless otherwise stated.
2.2. cDNA synthesis and d(A) tailing The templates used for cDNA cloning were double-stranded RNAs (dsRNA) extracted from cambium scrapings using a method described by Valverde (1990). The dsRNAs were denatured by incubating with 20 mM methylmercuric hydroxide for 10 min at room temperature, and the double stranded cDNAs were synthesized using the cDNA synthesis and plasmid cloning kit (BRL), following the manufacturer’s protocol. The DNA
was extracted with an equal volume of phenol/ chloroform/isoamyl alcohol (25:24:1) and precipitated with ammonium acetate and ethanol as recommended in the protocol. To add an additional (A) at the 3% end of double-stranded cDNA, the cDNA was resuspended in water and incubated at 72°C for 1 h with 0.2 mM dATP, 2.5 mM MgCl2, 1 ×PCR buffer (50 mM KCl, 10 mM Tris–HCl, pH 8.3), and 0.05 U/ml Taq DNA polymerase in a total volume of 30 ml. The DNA was extracted with phenol and precipitated by ethanol (Sambrook et al., 1989). The DNA was ligated to the pCR2.1 vector (Invitrogen, Carlsbad, CA) using the Invitrogen TA cloning kit as recommended by the manufacturer. The DNA was again precipitated with ethanol, air dried, and resuspended in 5 ml water. The circularized, double-stranded DNA was then transformed to Electromax DH10B cells (BRL) by electroporation using an electroporator (BRL) following the manufacturer’s recommendations. Heat shock transformation was used for comparison, but lower efficiency was observed with this method. The transformants were plated on ampicilin-agar media and screened for white colonies.
2.3. Screening of 6iral specific clones The recombinant colonies were transferred to nitrocellulose membranes and screened by colony hybridization as described by Sambrook et al. (1989). The colony blots were probed with 32P-labeled cDNA from dsRNA isolated from the same diseased plant as well as from healthy plant following the procedure described by Feinberg and Vogelstein (1983) with the substitution of DNA polymerase by M-MLV reverse transcriptase. Colonies that reacted only to probes made from diseased plant dsRNA were picked, cultured, and analyzed by restriction digestion with EcoRI (Sambrook et al., 1989). DNAs from these selected clones were then sequenced, and the sequences were compared to GenBank sequences using the blast program of the GCG software package (Genetic Computer Group, Madison, WI).
Y.-p. Zhang, A. Rowhani / Journal of Virological Methods 84 (2000) 59–63
2.4. RT-PCR detection Oligonucleotide primers were designed from positively identified clones and manufactured by Gibco BRL. Double-stranded RNAs isolated from virus-infected plants were used as templates and the RT-PCR was performed as described previously (Zhang et al., 1998b) to test the specificity of each pair of primers developed from the cloning experiments.
3. Results and discussion
3.1. cDNA clones of four grape6ine 6iruses For many plant viruses, especially viruses of woody plants, it is difficult to obtain pure virions. Double-stranded RNAs, on the other hand, are easy to extract from various virus infected plant tissues. The use of dsRNA as starting material to study plant viruses has proven to be a very effective approach in many cases of plant virus research (Jelkmann et al., 1989; Valverde, 1990; Zhang et al., 1998a). Thousands of recombinant colonies were produced using dsRNA as starting material, and 800 colonies from each library were selected for screening. Over 100 specific recombinant clones were identified for each target dsRNA after colony hybridization. Selected clones from each library were analyzed by restriction digestion with EcoRI and gel electrophoresis to determine their sizes. One clone from each library was selected for further study (Fig. 1). These four cDNA clones were sequenced, and the sequences were compared to GenBank sequences. They were determined to be: GRSPaV; an unknown virus with 67% similarity to oat blue dwarf virus (a member of marafivirus group); GLRaV 5; and an unknown virus with 76% similarity to grapevine virus A (a member of vitivirus group).
3.2. RT-PCR amplification from four 6iruses by primers de6eloped from the cDNA clones The primers designed for each virus are listed in
61
Table 1. These primers were: RSP 6-14 for GRSPaV, RSP 50-51 for the marafivirus, LR 3-4 for GLRaV 5, and GTV 1-2 for the vitivirus. They were used in RT-PCR for the detection of each virus from grapevines (Fig. 2). These RTPCR products were sequenced and showed 98– 100% identity to the sequences of their original cDNA clones, thus proving their specificity to the viruses from which they were cloned. The use of Taq DNA polymerase was only reported previously for cloning from a DNA, but not an RNA source (Holton and Graham, 1990; Marchuk et al., 1990). We developed a procedure to make cDNA clones from RNA templates using Taq DNA polymerase. This method eliminates the use of adapters and linkers, thereby reducing additional steps in cloning processes and lowering the chances of cDNA loss in the process. It creates compatible ends for cloning cDNA into the vector, hence increasing the ligation efficiency compared to blunt end ligation. It is very rapid, simple, and only a small amount of starting material is required. It is recommended that when
Fig. 1. Agarose gel electrophoresis of cDNA clones used in this study: Lane 1, DNA marker; lane 2, cDNA clone for a GRSPaV, 3 kb; lane 3, cDNA clone for the unknown virus related to marafivirus, 0.8 kb; lane 4, cDNA clone for GLRaV 5, 1.6 kb; lane 5, cDNA clone for the unknown virus related to vitivirus, 1.8 kb. The DNAs were digested with EcoRI. The top bands are the vectors and the lower bands are the inserts.
62
Y.-p. Zhang, A. Rowhani / Journal of Virological Methods 84 (2000) 59–63
Table 1 Primers and the sizes of their RT-PCR amplification products Primera
Primer sequence
Direction
Product size
RSP6 RSP14
5% CGTCCAAGAATTTTCAGGTT3% 5% CACTACTGCTGTCTACATAA3%
Forward Reverse
763 bp
RSP50 RSP51
5% GGGTCACCTCCGCCGCTTGGGAT3% 5% GCGGGAGCAGGCGAGCGTGGATA3%
Forward Reverse
287 bp
LR3 LR4
5% ACTCCCGGAACAATGTCATCTA3% 5% GAGAGCCAAGGAGAGACTTAT3%
Forward Reverse
348 bp
GTV1 GTV2
5% AGGGGGGAGATCCGAGCT3% 5% AGCCATGACCACGAGGAAGT3%
Forward Reverse
357 bp
a The specific PCR primers are: RSP 6-14 for GRSPaV; RSP 50-51 for the unknown virus related to marafivirus; LR3-4 for GLRaV 5; and GTV 1-2 for the unknown virus related to vitivirus.
large cDNA clones are desired, the cDNAs be fractionated by size selection columns before ligating to the vector. No pre-existing sequences are required in this procedure since random primers are used. The cDNA clones can be obtained for more than one virus from a multiply-infected plant at the same time as described in this paper (cDNAs for GRSPaV and the unknown related to marafivirus were cloned from a vine which was co-infected with both viruses). The genome of GRSPaV has been characterized (Zhang et al., 1998a) using cDNA clones produced by this new cDNA
Fig. 2. Agarose gel electrophoresis of RT-PCR products from dsRNA extraction from virus-infected and healthy grapevine. Lane 1, 1-kb DNA marker; lane 2, infected with GRSPaV; lane 4, infected with unknown related to marafivirus; lane 6, infected with GLRaV 5; lane 8, infected with unknown related to vitivirus. Lanes 3, 5, 7, and 9, healthy grapevines. Primers for each virus are as indicated in Table 1.
cloning methodology, and we are currently in the process of characterizing the other three viruses.
Acknowledgements We would like to acknowledge Lenka Biardi and Cheryl Covert for their critical review of the manuscript.
References Clark, J.M., 1988. Novel non-templated nucleotide addition reactions catalyzed by procaryotic and eucaryotic DNA polymerases. Nucleic Acids Res. 16, 9677 – 9686. Efstratiadis, A., Kafatos, F.C., Maxam, A.M., Maniatis, T., 1976. Enzymatic in vitro synthesis of globin genes. Cell 7, 279 – 288. Feinberg, A.P., Vogelstein, B., 1983. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6 – 13. Gubler, U., Hoffman, B.J., 1983. A simple and efficient method for generating cDNA libraries. Gene 25, 263 – 269. Holton, T.A., Graham, M.W., 1990. A simple and efficient method for direct clinging of PCR products using ddTtailed vectors. Nucleic Acids Res. 19, 1156. Huang, H.-J., Pears, C., 1998. Generation of genomic mini-libraries by Taq DNA polymerase modification of genomic fragments. BioTechniques 24, 566 – 568. Imai, M., Richardson, M.A., Ikegami, N., Shatkin, A.J., Furuichi, Y., 1983. Molecular cloning of double-stranded RNA virus genomes. Proc. Natl. Acad. Sci. USA 80, 373 – 377. Jelkmann, W., Martin, R.R., Maiss, E., 1989. Cloning of four plant viruses from small quantities of double-stranded RNA. Phytopathology 79, 1250 – 1253.
Y.-p. Zhang, A. Rowhani / Journal of Virological Methods 84 (2000) 59–63 Kawata, Y., Yano, S., Kojima, H., 1998. Construction of a genomic DNA library by TA cloning. BioTechniques 24, 564 – 565. Marchuk, D., Drumm, M., Saulino, A., Collins, F.S., 1990. Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Res. 19, 1154. Okayama, H., Berg, P., 1982. High-efficiency cloning of fulllength cDNA. Mol. Cell. Biol. 2, 161–170. Rougeon, F., Mach, B., 1976. Stepwise biosynthesis in vitro of globin genes from globin mRNA by DNA polymerase of avian myeloblastosis virus. Proc. Natl. Acad. Sci. USA 73, 3418 – 3422. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning, a Laboratory Manual, 2nd edn. Cold Spring
.
63
Harbor Laboratory Press, Cold Spring Harbor, New York. Valverde, R.A., 1990. Analysis of double-stranded RNA for plant virus diagnosis. Plant Dis. 74, 255 – 258. Zhang, Y.-P., Uyemoto, J.K., Golino, D.A., Rowhani, A., 1998a. Nucleotide sequence and RT-PCR detection of a virus associated with grapevine rupestris stem-pitting disease. Phytopathology 88, 1231 – 1237. Zhang, Y.-P., Uyemoto, J.K., Kirkpatrick, B.C., 1998b. A rapid, small scale procedure for extracting virus, viroid, MLO, and bacterial nucleic acids from plants for analysis by PCR. J. Virol. Methods 71, 45 – 50. Zhou, M.Y., Clerk, S.E., Gomez-Sanchez, C.E., 1995. Universal cloning method by TA strategy. BioTechniques 19, 34 – 35.
.