A strategy for soluble overexpression and biochemical characterization of halo-thermotolerant Bacillus laccase in modified E. coli

Accepted Manuscript Title: A strategy for soluble overexpression and biochemical characterization of halo-thermotolerant Bacillus laccase in modified E. coli Author: Azam Safary Rezvan Moniri Maryam Hamzeh-Mivehroud Siavoush Dastmalchi PII: DOI: Reference:

S0168-1656(16)30178-X http://dx.doi.org/doi:10.1016/j.jbiotec.2016.04.006 BIOTEC 7493

To appear in:

Journal of Biotechnology

Received date: Revised date: Accepted date:

23-2-2016 30-3-2016 5-4-2016

Please cite this article as: Safary, Azam, Moniri, Rezvan, Hamzeh-Mivehroud, Maryam, Dastmalchi, Siavoush, A strategy for soluble overexpression and biochemical characterization of halo-thermotolerant Bacillus laccase in modified E.coli.Journal of Biotechnology http://dx.doi.org/10.1016/j.jbiotec.2016.04.006 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

A strategy for soluble overexpression and biochemical characterization of halothermotolerant Bacillus laccase in modified E. coli Azam Safarya, c, Rezvan Moniria, b, *, Maryam Hamzeh-Mivehroud c, d, Siavoush Dastmalchic, d, * a

Anatomical Sciences Research Center, Kashan University of Medical Sciences, Kashan, Iran.

b

Department of Microbiology and Immunology, Faculty of Medicine, Kashan University of

Medical Sciences, Kashan, Iran. c

Biotechnology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran.

d

School of Pharmacy, Tabriz University of Medical Sciences, Tabriz, Iran.

*

Corresponding authors: Siavoush Dastmalchi, Biotechnology Research Center, and School of

Pharmacy, Tabriz University of Medical Sciences, Daneshgah Street, Tabriz, 5165665813, Iran. Tel: +98(41)33364038, Fax: +98(41)33379420, e-mail: [email protected], [email protected]. Rezvan Moniri, Department of Microbiology and Immunology, Faculty of Medicine, and Anatomical Sciences Research Center, Kashan University of Medical Sciences, Ghotbe Ravandi Street, Kashan, 87155111, Iran. Tel: +98(31)55540021, e-mail: [email protected], [email protected] Highlights 

Laccase gene from newly isolated Bacillus sp. SL-1 was cloned and overexpressed.



A method was introduced for soluble expression of laccase in Origami strain.



The laccase activity under different oxygen availability was investigated.



The produced laccase retained 50% activity after one hour incubation at 70°C.



The enzyme was resistant to various inhibitors and organic solvents.

1

Abstract An efficient method was introduced for soluble expression of recombinant laccase (rpCotA(SL-1)) from a newly isolated halo-thermotolerant Bacillus sp. SL-1 in modified E.coli, trxB2/gor2 mutant (OrigamiTM B (DE3)). The yield of purified soluble laccase in Origami strain under micro-aerobic condition was ~20 mg/L of bacterial culture, showing significant improvement over the laccase produced in E.coli BL21 strain under aerobic condition. The specific activity of 13 U/mg for purified laccase produced in micro-aerobic condition was higher than that of 1.07 U/mg observed for the purified enzyme obtained in aerobic condition in Origami. The kinetic Km and kcat parameters for laccase-induced oxidation reactions were 46 μM and 23 s−1 for ABTS (2,2’-Azino-bis(3-ethylbenzthiazoline-6-sulphonic acid), and 19.6 μM and 24 s−1 for SGZ (syringaldazine) substrates, respectively. The rpCotA(SL-1) displayed thermostability at 70 °C and tolerance to specified concentrations of NaCl, NaN3, EDTA and SDS as inhibitors. The enzyme was relatively stable in the presence of different concentration of organic solvents, however the residual activity was adversely affected as the dipole moment of the solvents increase. Here we successfully report the production of soluble and functional laccase in Origami at the expression level suitable for industrial application. Keywords: multicopper oxidase, cytoplasmic expression, micro-aerobic expression, inclusion body, Bacillus sp. SL-1, Origami B (DE3) Chemical compounds studied in this article Syringaldazine (PubChem CID: 5379425); 2,2’-Azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (PubChem CID: 5464076); Sodium Chloride (PubChem CID: 5234); EDTA (PubChem CID: 6049); SDS (PubChem CID: 3423265); NaN3 (PubChem CID: 33557)

2

Introduction Laccases (benzenediol: oxygen oxidoreductase; EC 1.10.3.2) belong to the superfamily of multicopper oxidases, which catalyze the reduction of molecular oxygen into water molecule by transferring the electrons from substrate molecules (Dwivedi et al., 2011). They contain four redox-active copper ions that are conventionally classified into three distinct types (T1, T2, and T3) based on their coordination states and spectroscopic properties (Mot and Silaghi-Dumitrescu, 2012). Due to high capacity for the oxidation of broad range of phenols and polyphenols and to a lesser extent heterocyclic and inorganic compounds, laccases have potential for applications in various biotechnological and industrial processes (Santhanam et al., 2011). Laccases have been isolated from different eukaryotic systems such as fungi, plants as well as prokaryotes like bacteria. Generally, laccases from fungi origin are used in diverse industrial processes because of their high redox potency (Mayer and Staples, 2002), however, in recent years, several attempts have been focused to find novel laccases from bacterial sources (Claus, 2003). The main advantages of using bacterial laccases are their higher activity as well as stability at various pH and temperature in comparison to the fungal laccase. In addition, the expression level is expected to be higher in bacterial hosts, which may provide added economic values. Besides, the industrial processes are often performed in harsh conditions such as extreme pH, temperature, or ionic strength and hence such robust enzymes provide economically appealing materials (Brander et al., 2014; Santhanam et al., 2011). Bacterial laccases can be overexpressed in Escherichia coli, an organism, which probably is still the most favored expression system for heterologous proteins because of its fast growth and easy genetic manipulation (Ihssen et al., 2015). The importance of E. coli for heterologous protein production is perhaps best highlighted by the wide variety of commercial products produced in this system (Peti and Page, 2007). Although there are reports of high-level expression of laccases in E. coli, the accumulation of misfolded and biologically inactive recombinant proteins in the form of cytoplasmic inclusion bodies is a major challenge to meet the industrial demands (Mollania et al., 2013; Wang et al., 2015). Normally, the E. coli cytoplasm is a reducing environment that strongly prevents the formation of stable intra or intermolecular disulfide bonds which can led to misfolding, aggregation and lack of functionality of the heterologously expressed proteins (Baneyx and Mujacic, 2004; Rosano and Ceccarelli, 3

2014). Expression of target protein in periplasm of E. coli often is considered as a first strategy to resolve this problem because of the existence of a set of enzymes (DsbA, DsbB, DsbC, DsbD) that mediate disulfide bond formation within proteins in the periplasmic space, although this is not always true (Berkmen, 2012). However, the yield of the expressed protein can be restricted because of inner membrane transport barrier and limited capacity of the periplasmic compartment. The other strategy could be the use of modified trxB2/gor2 double mutant E. coli strainin order to increase the efficiency of oxidized recombinant protein production (Casali, 2003). Disruption of the trxB and gor genes encoding the thioredoxin and glutathione reductase enzymes, promotes the formation of disulfide bonds and hence proper folding of heterologously expressed target proteins in the E. coli cytoplasm (Sørensen and Mortensen, 2005). Refolding is one of the strategies which is used to obtain soluble and active form of the enzyme from the inclusion bodies. Although there have been few successful efforts for refolding of laccase from inclusion body (Martins et al., 2002), the cost and time of the whole process must be considered if the goal is to obtain a large-scale manufactured product. In many cases, refolding from inclusion bodies is considered undesirable, because of the poor recovery and lack of a universal optimum refolding condition for the proteins of interest (Middelberg, 2002). Maximizing the production of recombinant proteins in soluble form is an attractive alternative to the in vitro refolding procedures. Purification of soluble recombinant proteins is more costeffective and less time-consuming than refolding and purification from inclusion bodies (RabhiEssafi et al., 2007). Laccase catalytic function depends on the presence of copper ions in the culture media. Copper ions are both highly toxic and indispensable micronutrient for living organisms as a cofactor for important enzymes. To avoid harmful effects of copper, living organisms contain well-balanced systems for its homeostasis consisting of copper exporters, copper oxidases, metallothioneines, and copper binding chaperones. These systems limit the number of available copper ions for incorporation into the heterologously expressed enzymes and might be the reason for the observed copper depletion of expressed bacterial laccases (Gunne et al., 2013). The accumulation of copper ions in E. coli is in turn related to oxygen availability in growth conditions. Therefore, the growth of E. coli cells in micro-aerobic conditions promotes higher intracellular copper ions content (Durao et al., 2008). Therefore, optimization of environmental 4

factors, genetic engineering of the target protein and the use of modified E. coli expression systems are among the commonly used strategies for increasing the yield of correctly folded active and soluble recombinant laccase production in E. coli (Baneyx and Mujacic, 2004). In this study, the corresponding gene for laccase from a recently characterized halothermotolerant Bacillus sp. SL-1 (Safary et al., 2012), was cloned and overexpressed in OrigamiTM B (DE3) expression system (a modified E. coli strain with trxB2/gor2 double mutant) under aerobic and micro-aerobic conditions for the production of soluble recombinant laccase. The soluble form of enzyme was obtained and compared to the results achieved in E. coli BL21 expression system. Functional enzyme activity assays were performed to determine the yield, stability, and enzyme kinetic parameters. The results revealed the suitability of the introduced method for producing sufficient amount of soluble and functional enzyme applicable in specific industrial and biotechnological processes. Materials and Methods 2.1. Strains and culture media Halo-thermotolerant Bacillus sp. SL-1 was isolated from Aran-Bidgol Saline Lake in central region of Iran as introduced in previous study (Safary et al., 2012). All E. coli strains (i.e., Origami, DH5α and BL21) used in this study were from Novagen (Darmstadt, Germany). Tryptone and NaCl were purchased from Scharlau (Barcelona, Spain). Yeast extract, agar and glycerol were from Applichem (Darmstadt, Germany). 2.2. Cloning of laccase gene from Bacillus sp. SL-1 Genomic DNA from Bacillus sp. SL-1 was extracted by QIAamp DNA kit (Qiagen, Germany) according to the supplier’s instruction. The rationales for doing so were the based on high similarity of 16S rDNA sequences from Bacillus sp. SL-1 (GenBank accession no. JQ996502) and Bacillus licheniformis (strain ATCC 14580). The amplification of the laccase gene was performed by polymerase chain reaction using the forward (5′CAGGCATATGAAACTTGAAAAATTCGTTGACCGGC-3′) and reverse (5′AGGCCTCGAGTTGATGACGAACATCTGTCACTTC-3′) primers (Bioron, Germany, ordered via FAZA Biotech, Iran). The recognition sites for NdeI and XhoI endonucleases (Fermentas, 5

Russia) are indicated in italics in the primers. The PCR product was double digested with NdeI and XhoI and then was ligated into pET22b+ expression vector at 16 °C overnight. The produced construct was transformed into E. coli DH5α for plasmid amplification and extraction using plasmid purification kit (Roche, Germany). Then the purified plasmid construct was tested for the presence of laccase coding DNA sequence by PCR reactions using the above mentioned primers and universal primers for the pET expression vectors. For further confirmation of the sequence of the cloned gene, the generated construct (named pET22cotA) was sent out for sequencing at Sequetech, USA. 2.3. Expression of recombinant CotA(SL-1) laccase The expression of the recombinant laccase was examined using BL2 (DE3) and OrigamiTM B (DE3) strains of E. coli under aerobic and micro-aerobic conditions in Luria-Bertani (LB) (5 g/L yeast extract, 10 g/L tryptone, 5 g/L NaCl) medium. Production of laccase under aerobic condition was performed based on the modification of the method reported by Koschorreck et al. (2008) in E. coli BL21 expression system (Koschorreck et al., 2008). Briefly, the recombinant construct pET22cotA was transformed chemically into E. coli (BL21 and Origami) and plated on LB-ampicillin plates. The overnight starter cultures were diluted 1:100 in fresh LB medium supplemented with 100 μg/mL ampicillin and incubated at 37 °C with shaking 180 rpm. At an optical density (OD600) of 1-1.2, expression was induced by addition of isopropyl beta-Dthiogalactoside (IPTG) at final concentration of 0.4 mM. Also, to the culture was added 2 mM CuSO4 and incubated overnight at 18 °C while shaking at 140 rpm. In the micro-aerobic method, the culture was inoculated 1:50 with starter culture and incubated at 35 °C and 140 rpm until an OD600 of 0.6-0.7 was reached. Subsequently, the cultivation temperature was reduced to 25 °C; the expression of recombinant proteins was induced by addition of 0.1 mM IPTG, and CuSO4 was added to the medium at final concentration of 0.25 mM. After 4 h, aerobic incubation was shifted to a micro-aerobic condition or static incubation by switching off the shaking according to the method described by Durao et al. (2008) for production of laccase from B. subtilis (Durao et al., 2008). At different time intervals, samples were taken to analyze the preferable protein expression method. After overnight incubation, the cells were harvested by centrifugation at 5,000×g for 15 min. The pellet was resuspended in lysis buffer (50 mM Tris-HCl pH 8, 100 mM NaCl, 1% Triton X-100, 1.4 mM protease inhibitor (PMSF), 0.1% β-mercaptoethanol and 0.1 6

mg/ml lysozyme). Cell disruption was performed by three cycle of freeze-thaw using liquid nitrogen followed by sonication on ice for 30 seconds at 60% pulse, repeating for 5 times with 1 minute interval. The bacterial debris was removed by centrifugation at 10,000×g for 20 min at 4 °C. 2.4. Purification of CotA(SL-1) laccase Purification of recombinant laccase was performed by using affinity chromatography in batch/gravity-flow conditions. In this method, the supernatant containing soluble 6×His -tagged laccase was heated for 15 min at 70 °C and the precipitate was removed by centrifugation at 10,000×g for 15 min at 4 °C. Then the clear soluble fraction was subjected to the affinity chromatography using Ni Sepharose resin (Ni Sepharose 6 Fast flow, GE Healthcare, Sweden) pre-equilibrated with lysis buffer at 4 °C. After 1 h incubation and washing step (Tris 50 mM, NaCl 150 mM, β-mercaptoethanol 0.1%, and imidazole 20 mM) the 6×His-tagged target protein was eluted (imidazole 500 mM, sodium phosphate 20 mM, NaCl 500 mM, pH 7). Imidazole was removed by dialysis against 100 mM NaCl and 50 mM Tris-HCl, pH 8 at 4 °C overnight, and protein concentration was determined by micro BCA protein assay method against calibration curve prepared using BSA standard solutions (Thermo Scientific, USA). 2.5. SDS-PAGE, western blot and UV-visible analysis of CotA(SL-1) laccase Total proteins in all samples of aerobic and micro-aerobic condition were monitored using a 12% polyacrylamide gel (SDS-PAGE). The amount of cell lysate loaded per well of SDS-PAGE was adjusted to 25 µg. Protein bands were visualized by staining with Coomassie brilliant blue G250. After electrophoresis, proteins were transferred onto a polyvinylidene fluoride (PVDF) membrane, and then the membrane was incubated in 5% bovine serum albumin (BSA) dissolved in TBST (20 mM Tris–HCl, containing 150 mM NaCl and 0.05% Tween-20 at pH 7.5) at 4 °C overnight followed by incubation with anti-His monoclonal primary antibody (GE Healthcare, Sweden) (1:3,000) in 3% BSA at room temperature for 1.5 h. The membrane was washed three times in TBST for 5 min at ambient temperature, followed by incubation with goat anti-mouse IgG-HRP (Santa Cruz, USA) in 3% BSA at a dilution of 1:8,000 for 1 h at room temperature, and finally the protein bands were visualized using chemiluminescence (BM chemiluminescence western blotting kit, Roche, Germany). The UV-vis absorption spectra of pure laccase produced 7

under aerobic and micro-aerobic condition was recorded in the range of 300-700 nm in 100 mM potassium phosphate buffer, pH 7 on Cecil CE8020 UV-visible spectrophotometer. 2.6. Activity assay of recombinant CotA(SL-1) laccase Laccase activity was evaluated using SGZ and ABTS (Sigma-Aldrich, USA) as the substrates by continuous spectrophotometric method. The assay mixture was composed of 0.065 mM SGZ in 100 mM potassium phosphate buffer, pH 6.5. Oxidation of SGZ was monitored at 37 °C by the measured absorbance at 530 nm. Oxidation of ABTS (0.91 mM) was followed by the intensity of the developed deep green color at 405 nm in 100 mM phosphate buffer, pH 5 at 25 °C. One unit of enzyme activity was defined as the amount of enzyme required to oxidize 1 µmol of substrate per minute. Total enzyme concentration was determined by micro BCA protein assay kit according to the supplier’s instruction. 2.7. Biochemical characterization of CotA(SL-1) laccase The effect of pH on the activity and stability of laccase was determined based on SGZ oxidation by the enzyme in 100 mM potassium phosphate buffer pH 2.5-10 according to the spectroscopic method outlined above. The temperature effect on enzymatic reaction was studied between 25 °C and 60 °C using SGZ substrate at pH 6.5. Laccase resistance to heat denaturation was determined by incubating enzyme at 70 °C and 80 °C. At different intervals, samples were taken and immediately assayed for residual enzymatic activity using the SGZ substrate. Kinetic parameters of the purified laccase were determined using different concentrations of ABTS and SGZ. Enzyme assay was performed in triplicate. The data were fitted to the Michaelis–Menten equation (Tallarida and Murray, 1987) by linear regression using Prism software (version 6.01, GraphPad Software Inc.). The effects of different concentration of inhibitors (SDS, EDTA, NaCl, DTT, L-cysteine and NaN3) and organic solvents (Methanol, Ethanol, Acetonitrile and Dimethyl sulfoxide (DMSO)) on laccase activity were studied by determining the residual activity in 100 mM potassium phosphate buffer, pH 6.5 with SGZ as the substrate.

8

Results 3.1. Identification of a putative Bacillus sp. SL-1 laccase The search for putative multi-copper oxidases within diverse bacterial genomes revealed a vast number of candidate genes, particularly in Bacillus species. Based on 97.0% similarity observed between the16S rDNA gene sequences for Bacillus sp. SL-1 and B. licheniformis (strain ATCC 14580), the two strains were regarded closely related and hence the coding sequence for laccase from the latter was used as a template for designing appropriate primers for amplifying the corresponding gene from the genome of the former strain (Figure S1, supplementary materials). A part from this, as shown in Table 1, the N- and C-terminal regions for laccase gene sequences in different Bacillus strains are either identical or highly conserved and therefore, designing the primers based on B. licheniformis (strain ATCC 14580) was expected to correctly recognize the appropriate regions in the genome of Bacillus sp. SL-1 and led to the amplification of the coding sequence for this enzyme (i.e., CotA). The sequence analysis of the cloned CotA(SL-1) gene showed high degree of identity (99%) to CotA from B. licheniformis (strain ATCC 14580), except a single A948C substitution which has led to K316 (Lys) to N (Asn) residue change in protein (CotA(SL-1) GenBank accession no. KU711667). Multiple sequence alignment of laccase from Bacillus sp. SL-1 with other laccase enzyme from different Bacillus strains indicated four conserved segments containing histidinerich copper-binding sites which are characteristic for bacterial laccases. Moreover, the CotA(SL-1) from Bacillus sp. SL-1 shows 65.8% identity with CotA from Bacillus subtilis. 3.2. Optimizing the expression of CotA(SL-1) laccase The generated pET22cotA construct was transformed into chemically competent E. coli cells (BL21 (DE3) and OrigamiTM B (DE3)) and then the expression, total and specific activity of soluble form of 6×His-tagged laccase enzyme under aerobic and micro-aerobic conditions were compared. Using Origami under both aerobic and micro-aerobic conditions, laccase was expressed significantly in soluble form as shown by the appearance of a new band just under 70 kDa (Figure 1a) whereas production of laccase in E. coli BL21 expression system under both aerobic and micro-aerobic conditions resulted to formation of insoluble aggregates and only a

9

very faint band corresponding to soluble laccase was detectable. The results of western-blot analysis shown in Figure 1b were in agreement to those of SDS-PAGE experiment. Based on the results of total and specific activities measured for the soluble fractions isolated from the cell lysates, establishing a micro-aerobic growth condition by stopping the shaking of the cultures during the expression of laccase in Origami resulted to the reduced amount of total proteins relative to the continually aerated culture from 2.6 mg/ml to 1.5 mg/ml. However, in the micro-aerobic condition, the specific activity of purified enzyme increased in comparison to that of the aerobic condition from 1.08 to 13.00 U/mg. Also, purified protein samples from micro-aerobic cultures showed more intense blue color compared with the prepared protein from aerobic condition. This was illustrated by the absorption peak with λmax at ~600 nm (Figure 2) due to the presence of copper ion in T1 center, which is stabilized by residues H418, C491, H496, and M501 as the conserved pattern HCHM found in the third Cupredoxin domain of bacterial laccases called CuRO_3_CotA_like domain (CDD domain ID: cd13891) (Marchler-Bauer et al., 2014; Mot and Silaghi-Dumitrescu, 2012). 3.3. Purification steps of CotA(SL-1) laccase After expression of CotA(SL-1) laccase under described condition, cells were harvested, and then lysed by freeze-thaw and sonication. Through heating the soluble fraction at high temperature (70 °C, 15 min), most of the E. coli proteins precipitated leading to less complicated subsequent purification steps. The clear soluble fraction was subjected to Ni Sepharose resin for further purification of 6×His-tagged laccase. In each step of purification, total protein amount (mg), total activity (U) and specific activity (U/mg) of enzyme were determined by using SGZ as substrate in 100 mM phosphate buffer (pH 6.5) at 37 °C. Proceeding toward the purified enzyme (produced under micro-aerobic condition) in the course of purification steps, the total amount of protein and the total activity reduced from 12.5 mg and 4.6 U to 0.16 mg and 2 U, respectively, whiles the specific activity increased more than 40 fold from 0.3 to 13 U/mg (Table 2). Furthermore, the collected samples of different purification steps were applied to 12% SDSPAGE and the recombinant 6×His-tagged laccase was visualized by the band with molecular weight around ∼65 kDa (Figure S2, supplementary materials) corresponding to the molecular weight of laccase from B. licheniformis and B. subtilis. The purified enzyme exhibited a typical blue color characteristic to all family of blue copper oxidases due to the absorbance at 600 nm of 10

the chelated copper in T1 site. All above mentioned experimental evidences revealed that the isolated protein is in fact the intended recombinant protein of CotA(SL-1) (rpCotA(SL-1)). 3.4. Biochemical characterization of recombinant CotA(SL-1) laccase The results of kinetic parameters Km and Kcat for the oxidation of ABTS and SGZ are shown in Table 3. The results were also compared to the parameters reported for CotA from B. licheniformis and B. subtilis (Table 3). The highest activity of the purified laccase on ABTS was found in the acidic condition (pH 4.5), while the optimum pH for SGZ oxidation was determined to be near-neutral condition (pH 6.5) (Figure 3). The results of pH stability profile showed that the enzyme loses its activity completely at pH 3.5 after 24 h, but retains 21% and 17 % activity at pH values of 6.5 and 8.5 after 72 h incubation at room temperature, respectively. Temperature dependence of enzyme activity was measured for the range of 25 °C and 60 °C, with maximum activity observed at 50 °C (Figure 4a). Thermostability of rpCotA(SL-1) enzyme was evaluated at 70 °C and 80 °C. A gradual decrease in activity was observed after incubation at 70 °C and 80 °C, with a more rapid loss of activity at 80 °C (Figure 4b). The determined activity half-lifes of the produced recombinant laccase were about 60 min and 20 min at 70 °C and 80 °C, respectively. The effects of studied inhibitors on the oxidative activity of rpCotA(SL-1) were summarized in Table 4. The rpCotA(SL-1) enzyme displayed tolerance to different concentration of NaCl, NaN3, EDTA and SDS as inhibitors. The effects of four commonly used water-miscible organic solvent on the activity of recombinant laccase were showed in figure 5. The residual activity for the rpCotA(SL-1) varied between ~10 to ~30% at the 50% (V/V) concentration of different organic solvents. Discussion The main goal of this work was to provide an efficient strategy for high-yield production of soluble and functional recombinant laccase in E. coli expression system within reasonable time. There are numerous reports of poor solubility of laccase and its accumulation as the inclusion bodies when overexpressed in E. coli, which renders the produced enzyme inadequate for 11

structural, biochemical, and industrial applications (Fang et al., 2011; Fang et al., 2014; Mollania et al., 2013). One of the most important factors leading to the aggregation of recombinant proteins is the inability of E. coli to support complex post-translational modifications including proper disulfide bonds formation and the absence of chaperones required for correct folding (Baneyx and Mujacic, 2004; Pacheco et al., 2012). From structural point of view, one or two disulfide bridges between domains 1 and 2 stabilize the correct structure of Bacillus laccases (Mot and Silaghi-Dumitrescu, 2012). Rabhi-Essafi et al. (2007) have shown that the cytoplasm of trxB mutants can be rendered sufficiently oxidizing to allow efficient formation of native disulfide bonds in recombinant human interferon α protein without compromising cell viability (Rabhi-Essafi et al., 2007). In the current study, we used this strategy for the purpose of increasing the expression yield and possible appropriate folding of laccase in soluble form. The yield of soluble production of purified active laccase in Origami strain under micro-aerobic condition was ~20 mg per one liter bacterial culture showing improvement over the laccase produced in E.coli BL21 strain under aerobic condition reported by Koschorreck et al. (2008) where 10 mg of active purified soluble B. licheniformis laccase was isolated per one liter of E. coli BL21 cultured under aerobic condition (Koschorreck et al., 2008). It is noteworthy to mention that the CotA from B. licheniformis does not have K316N variation. One may speculate that this single residue variation may be the reason for the observed dissimilar expression profile. The soluble expression of laccase could possibly be due to its correct folding in the oxidized cytoplasm environment of Origami expression system. Since the soluble expressed recombinant proteins are often properly folded, functional and easy to purify in comparison to the product prepared by refolding of the aggregated proteins found in inclusion bodies(Mollania et al., 2013), thus the solubility is considered as a key factor for the production of recombinant protein in heterologous expression systems (Sørensen and Mortensen, 2005). In addition to solubility issue, the expressed laccase may still be in incomplete folding or inactive form, probably due to the incomplete copper incorporation in multi copper centers of laccase. Durao et al. (2008) noted that copper physiology in E. coli is dependent on oxygen availability, and an increased intracellular accumulation of copper was observed under anaerobic growth conditions. Therefore, addition of copper ions to the culture medium and transition from aerobic to micro-aerobic condition can increase the accumulation of intracellular copper ions 12

leading to the production of appropriately folded and fully copper incorporated enzyme (Durao et al., 2008). Therefore in this study the expression of 6×His-tagged laccase enzyme in E. coli was performed under different oxygen availability. Based on the total and specific activity, as well as the level of copper ions incorporation (detected using UV-vis absorption spectra at 600 nm) in the laccase produced in Origami, the micro-aerobic aeration is superior relative to the aerobic aeration method. Similar results have also been reported for CotA from B. subtilis and Bacillus sp. HR03 expressed under micro-aerobic condition, where the increased copper content of enzyme was demonstrated experimentally (Durao et al., 2008; Mohammadian et al., 2010). More recently, Gunne et al. (2013) showed that for more efficient incorporation of copper ions into the structure of laccase from B. licheniformis co-expression of CotA with CopZ increases the copper content and specific activity of enzyme (Gunne et al., 2013). The CotA(SL-1) laccase expressed in Origami under micro-aerobic condition were investigated for its biochemical properties. The Km value of laccase from Bacillus sp. SL-1 toward ABTS was approximately three times lower than the reported value for B. subtilis, but the value toward SGZ showed more agreement to that of B. subtilis laccase as shown in Table 3. The purified laccase from Bacillus sp. SL-1 possessed higher specificity for SGZ than ABTS similar to those isolated from other species of Bacillus. The pH-activity profile determined for CotA(SL-1) is in agreement to that shown for CotA from other bacterial as well as fungal species (Koschorreck et al., 2008; Lu et al., 2013; Lu et al., 2012). The thermostability of CotA(SL-1) at 80 °C was similar to the stability of CotA from B. licheniformis, where its residual activity was about 10% after 60 min incubation at this temperature (Koschorreck et al., 2008). Therefore, thermostability profile of rpCotA(SL-1) was almost comparable to that of CotA from B. licheniformis, but was superior to the thermal stability of CueO from E. coli (Roberts et al., 2003). However rpCotA(SL-1) was not as thermostable as the laccase from B. subtilis according to the report of Wang et al. (2015) who showed that the laccase from B. subtilis retains 82% and 27% of the initial activity after 60 min incubation at 70 °C and 80 °C, indicating its higher thermal stability compared to the laccase from Bacillus sp. SL-1 (Wang et al., 2015). The thermostability of rpCotA(SL-1) becomes significant, especially when it is compared to a thermostable fungal laccase from C. cladosporioides, which loses 52% of its activity after 5 min at 80 °C (Halaburgi et al., 2011). Lu et al. (2012) reported a laccase from B. licheniformis LS04 13

that showed its maximal activity at 60 °C, and could maintain high activity at 40-70 °C (Lu et al., 2012). The functionality of the produced enzyme was assessed in the presence of commonly inhibitors particularly found in industrial processes. The recombinant CotA(SL-1) laccase demonstrated tolerance towards chloride, retaining about 83% and 76% of its activity at 0.5 and 1 M NaCl respectively. This is ~25% more than what has been reported by Lu et al. (2013) where 1 M of NaCl reduced the activity up to 50% for the laccase from B. licheniformis LS04 expressed in Pichia pastoris (Lu et al., 2013). Similarly, a bacterial laccase from the marine microbial metagenome has shown to retain the original activity (100%) in the presence of 1 M NaCl. Most fungal laccases are inactive at the concentrations of NaCl higher than 100 mM due to their intrinsic sensitivity towards halides (Fang et al., 2011). It has been proved that binding of anions such as chloride to T2/T3 coppers inhibits the enzyme activity due to interruption of internal electron transfer from the T1 to the T2/T3 centers (Ruijssenaars and Hartmans, 2004). One of the major obstacles that have prevented rapid progress in the practical application of laccases in industry is the requirement for activity under high concentrations of chloride ions. Thus, high chloride tolerance of CotA(SL-1) laccase compared to other bacterial laccases may be beneficial in application, such as wastewater treatment, since effluents from textile and pulp industries usually contain high salt concentrations, where most fungal laccases are unsuitable (Fang et al., 2011; Singh et al., 2007). No significant loss of activity was observed for enzyme when exposed to up to 1mM SDS and 50 mM EDTA (Table 4). Lu et al. (2013) showed the stimulatory effect of 1 mM SDS on laccase activity from B. licheniformis, which indicates the resistance of the recombinant laccase against SDS mediated denaturation (Lu et al., 2013). In contrast, Guan et al. (2014) reported a 43% decrease in laccase activity in the presence of 0.5 mM SDS for the enzyme obtained from B. pumilus W3 (Guan et al., 2014). Resistance towards the EDTA was also shown in other studies (Lu et al., 2013; Lu et al., 2012), and was ascribed to possible low accessibility of EDTA to the structural copper atoms in the spore laccase. Cabana et al. (2007) have reported that the aggregation of laccase as CLEAs (cross-linked enzyme aggregates) improved its stability against EDTA due to hindering mass transfer of EDTA into the structure (Cabana et al., 2007). However, a 15% inactivation was observed for laccase from B. pumilus W3 in the presence of 5 mM EDTA (Guan et al., 2014). Also, complete inactivation was 14

observed for laccase from Thermus thermophilus (Miyazaki, 2005) in the presence of 1.0 mM EDTA, which has been related to the deprived copper ions from copper centers revealing its important role in laccase function (Dwivedi et al., 2011). No inhibition was observed in the presence of 0.1 mM sodium azide, and only 34% inactivation was caused by increasing its concentration up to 1 mM. However, Lu et al. (2013) were reported up to 12% and 78% inhibition of laccase from B. licheniformis LS04 in the presence of 0.1 and 1 mM concentrations of NaN3, respectively (Lu et al., 2013). Also there are reports where addition of even smaller amount of NaN3 has led to strong inhibition of laccase. For example a complete inhibition of laccase from B. pumilus W3 was shown in the presence of 0.05 mM sodium azide (Guan et al., 2014). The inhibition by sodium azide was attributed to the binding of N3¯ to the trinuclear copper center affecting internal electron transfer, which ultimately diminishes the overall oxidation process catalyzed by laccase (Sondhi et al., 2014). The disagreement between the levels of laccase inhibition by NaN3 shown in this study and those reported elsewhere may be due to the differences in the primary structure of the enzyme (rpCotA(SL-1) sequence compared to laccase from B. pumilus W3) or the posttranslational modifications as the result of host expression system (laccase from B. licheniformis LS04 expressed in Pichia pastoris). The recombinant CotA(SL-1) laccase was strongly inhibited by low concentration (0.1 mM) of dithiothreitol (DTT) and L-Cystein which may suggest the strong reduction of the disulphide bridges between domains 1 and 2, which stabilizes the structure of laccase. On the other hand, this can be due to the reduction of the oxidized substrate by the sulfhydryl groups of the reducing reagents (Johannes and Majcherczyk, 2000). However partial inactivation of B. pumilus W3 laccases was caused by 0.5 mM of redox reagents (Guan et al., 2014). The strong inhibitory effects of redox reagents have also been observed with other laccases from bacterial and fungal origin (Singh et al., 2007). The considerable differences in laccase activity in the presence of different inhibitors can be the result of its nature, native sensitivity and the source from which the enzyme is isolated. Enzymatic reactions in compatible organic solvents mean more availability of water insoluble substrates to the enzyme and hence readily detoxifications of such substances like persistent organic pollutants by the enzyme (Torres et al., 2003). The laccase from Bacillus sp. SL-1 was relatively stable and more than 30% of its activity remained intact in 30% (V/V) of 15

ethanol, methanol, acetonitrile and DMSO (Figure 5). Even enhanced enzyme activity was observed in 10% methanol suggesting potential application of CotA(SL-1) in mixed methanolic solutions. Previous studies of Keum and Li (2004) have shown that the fungal laccase were rapidly inactivated in organic solvents at the concentrations 10% and beyond (V/V) (Keum and Li, 2004), while at this concentration of organic solvents (i.e., 10% V/V) the activity of bacterial laccases either remained unaffected or showed 10 to 40% increase, according to data presented in Figure 5 and those reported elsewhere (Guan et al., 2014; Lu et al., 2013). It has been shown that the hydrophobic interaction between enzyme and organic solvents in some cases may affect the three-dimensional conformation leading to the altered enzyme stability and activity. Substitution of water molecules at the active sites by organic solvents can occur and hence the effective pH can be altered by the presence of organic solvents (Keum and Li, 2004). The purified rpCotA(SL-1) showed increased activity in the presence of 10% methanol, however, other studied organic solvents at the same concentration caused decreased activity (Figure 5). An interesting result was found by correlating the residual activity of rpCotA(SL-1) in the presence of 10% (V/V) organic solvents to the dipole moment (μ) values of these solvents. The dipole moment, which is a measure of the polarity of the solvents as well as the final mixed solvent system (mixture of organic and aqueous solvents used in the experiment) showed a very strong inverse correlation (R2 of 0.82) to the enzyme activity. This means, the higher the μ of the solvent, the higher its inhibitory effect. However, the ultimate effects of different solvent on the activity may vary for different enzymes depending on the nature of the protein under investigation. In summary, current investigation introduces an efficient expression strategy requiring reasonable time and cost for the production of rpCotA(SL-1) in modified E.coli strain (OrigamiTM B (DE3)) under micro-aerobic condition. The choice of Origami was dictated by the fact that disulfide bridges formation is necessary for proper folding of laccase. To the best of our knowledge, this is the first study optimizing adequate yield of soluble and functional 6×Histagged Bacillus sp. SL-1 laccase production in modified E.coli. The purified laccase was highly thermostable and tolerant to the presence of different concentrations of inhibitors and organic solvents. Biochemical properties observed for the produced laccase indicate its suitability for industrial applications. 16

Conflict of interest The authors declare that they have no conflict of interest. Contributors AS performed the all experiments and contributed to the preparation of the manuscript. MHM analyzed the data and prepared the manuscript. RM and SD planned, supervised the experiments and interpreted the data of the study. Acknowledgment The authors would like to thank the Anatomical Science Research Center, Kashan University of Medical Science for providing financial support under the Postgraduate Research Grant scheme toward the PhD thesis of AS (grant no. 9171). The aid of Biotechnology Research Center, Tabriz University of Medical Sciences for providing all necessary research facilitates is highly appreciated. The kind help of Dr B Sokouti in preparation of images highly appreciated. The authors also would like to thank Dr Kazemi from Shahid Beheshti University of Medical Sciences for kindly providing pET22b+ vector.

17

References Baneyx, F., Mujacic, M., 2004. Recombinant protein folding and misfolding in Escherichia coli. Nat. Biotechnol. 22, 1399-1408. Berkmen, M., 2012. Production of disulfide-bonded proteins in Escherichia coli. Protein. Expr. Purif. 82, 240-251. Brander, S., Mikkelsen, J.D., Kepp, K.P., 2014. Characterization of an alkali-and halide-resistant laccase expressed in E. coli: CotA from Bacillus clausii. Plos. One. 9, e99402. Cabana, H., Jones, J.P., Agathos, S.N., 2007. Preparation and characterization of cross-linked laccase aggregates and their application to the elimination of endocrine disrupting chemicals. J. Biotechnol. 132, 23-31. Casali, N., 2003. Escherichia coli host strains. E. coli Plasmid Vectors. Springer, pp. 27-48. Claus, H., 2003. Laccases and their occurrence in prokaryotes. Arch. Microbiol. 179, 145-150. Durao, P., Chen, Z., Fernandes, A.T., Hildebrandt, P., Murgida, D.H., Todorovic, S., Pereira, M.M., Melo, E.P., Martins, L.O., 2008. Copper incorporation into recombinant CotA laccase from Bacillus subtilis: characterization of fully copper loaded enzymes. J. Biol. Inorg. Chem. 13, 183-193. Dwivedi, U.N., Singh, P., Pandey, V.P., Kumar, A., 2011. Structure–function relationship among bacterial, fungal and plant laccases. J. Mol. Catal. B: Enzym. 68, 117-128. Fang, Z., Li, T., Wang, Q., Zhang, X., Peng, H., Fang, W., Hong, Y., Ge, H., Xiao, Y., 2011. A bacterial laccase from marine microbial metagenome exhibiting chloride tolerance and dye decolorization ability. Appl. Microbiol. Biotechnol. 89, 1103-1110. Fang, Z., Zhou, P., Chang, F., Yin, Q., Fang, W., Yuan, J., Zhang, X., Xiao, Y., 2014. Structurebased rational design to enhance the solubility and thermostability of a bacterial laccase Lac15. Plos. One. 9, e102423. Guan, Z.-B., Song, C.-M., Zhang, N., Zhou, W., Xu, C.-W., Zhou, L.-X., Zhao, H., Cai, Y.-J., Liao, X.-R., 2014. Overexpression, characterization, and dye-decolorizing ability of a thermostable, pH-stable, and organic solvent-tolerant laccase from Bacillus pumilus W3. J. Mol. Catal. B: Enzym. 101, 1-6. Gunne, M., Al-Sultani, D., Urlacher, V.B., 2013. Enhancement of copper content and specific activity of CotA laccase from Bacillus licheniformis by coexpression with CopZ copper chaperone in E. coli. J. Biotechnol. 168, 252-255. Halaburgi, V.M., Sharma, S., Sinha, M., Singh, T.P., Karegoudar, T.B., 2011. Purification and characterization of a thermostable laccase from the ascomycetes Cladosporium cladosporioides and its applications. Process. Biochem. 46, 1146-1152. Ihssen, J., Reiss, R., Luchsinger, R., Thöny-Meyer, L., Richter, M., 2015. Biochemical properties and yields of diverse bacterial laccase-like multicopper oxidases expressed in Escherichia coli. Sci. Rep. 5. Johannes, C., Majcherczyk, A., 2000. Laccase activity tests and laccase inhibitors. J. Biotechnol. 78, 193-199. 18

Keum, Y.S., Li, Q.X., 2004. Fungal laccase-catalyzed degradation of hydroxy polychlorinated biphenyls. Chemosphere. 56, 23-30. Koschorreck, K., Richter, S.M., Ene, A.B., Roduner, E., Schmid, R.D., Urlacher, V.B., 2008. Cloning and characterization of a new laccase from Bacillus licheniformis catalyzing dimerization of phenolic acids. Appl. Microbiol. Biotechnol. 79, 217-224. Lu, L., Wang, T.-N., Xu, T.-F., Wang, J.-Y., Wang, C.-L., Zhao, M., 2013. Cloning and expression of thermo-alkali-stable laccase of Bacillus licheniformis in Pichia pastoris and its characterization. Bioresource. Technol. 134, 81-86. Lu, L., Zhao, M., Wang, T.-N., Zhao, L.-Y., Du, M.-H., Li, T.-L., Li, D.-B., 2012. Characterization and dye decolorization ability of an alkaline resistant and organic solvents tolerant laccase from Bacillus licheniformis LS04. Bioresource. Technol. 115, 35-40. Marchler-Bauer, A., Derbyshire, M.K., Gonzales, N.R., Lu, S., Chitsaz, F., Geer, L.Y., Geer, R.C., He, J., Gwadz, M., Hurwitz, D.I., 2014. CDD: NCBI's conserved domain database. Nuc. Acids Res. 43, 222-226. Martins, L.O., Soares, C.M., Pereira, M.M., Teixeira, M., Costa, T., Jones, G.H., Henriques, A.O., 2002. Molecular and biochemical characterization of a highly stable bacterial laccase that occurs as a structural component of the Bacillus subtilis endospore coat. J. Biol. Chem. 277, 18849-18859. Mayer, A.M., Staples, R.C., 2002. Laccase: new functions for an old enzyme. Phytochemistry 60, 551-565. Middelberg, A.P., 2002. Preparative protein refolding. Trends. Biotechnol. 20, 437-443. Miyazaki, K., 2005. A hyperthermophilic laccase from Thermus thermophilus HB27. Extremophiles. 9, 415-425. Mohammadian, M., Fathi-Roudsari, M., Mollania, N., Badoei-Dalfard, A., Khajeh, K., 2010. Enhanced expression of a recombinant bacterial laccase at low temperature and microaerobic conditions: purification and biochemical characterization. J. Ind. Microbiol. Biotechnol. 37, 863-869. Mollania, N., Khajeh, K., Ranjbar, B., Rashno, F., Akbari, N., Fathi-Roudsari, M., 2013. An efficient in vitro refolding of recombinant bacterial laccase in Escherichia coli. Enzyme. Microb. Technol. 52, 325-330. Mot, A., Silaghi-Dumitrescu, R., 2012. Laccases: complex architectures for one-electron oxidations. Biochemistry (Moscow). 77, 1395-1407. Pacheco, B., Crombet, L., Loppnau, P., Cossar, D., 2012. A screening strategy for heterologous protein expression in Escherichia coli with the highest return of investment. Protein. Expr. Purif. 81, 33-41. Peti, W., Page, R., 2007. Strategies to maximize heterologous protein expression in Escherichia coli with minimal cost. Protein. Expr. Purif. 51, 1-10.

19

Rabhi-Essafi, I., Sadok, A., Khalaf, N., Fathallah, D.M., 2007. A strategy for high-level expression of soluble and functional human interferon α as a GST-fusion protein in E. coli. Protein. Eng. Des. Sel. 20, 201-209. Roberts, S.A., Wildner, G.F., Grass, G., Weichsel, A., Ambrus, A., Rensing, C., Montfort, W.R., 2003. A labile regulatory copper ion lies near the T1 copper site in the multicopper oxidase CueO. J. Biol. Chem. 278, 31958-31963. Rosano, G.L., Ceccarelli, E.A., 2014. Recombinant protein expression in Escherichia coli: advances and challenges. Front. Microbiol. 5. Ruijssenaars, H., Hartmans, S., 2004. A cloned Bacillus halodurans multicopper oxidase exhibiting alkaline laccase activity. Appl. Microbiol. Biotechnol. 65, 177-182. Safary, A., Moniri, R., Mirhashemi, S.M., Nikzad, H., Khiavi, M.A., 2012. Phylogenetic and biochemical characterization of a new halo-thermotolerant, biofilm-forming Bacillus from Saline Lake of Iran. Pol. J. Microbiol. 62, 419-425. Santhanam, N., Vivanco, J.M., Decker, S.R., Reardon, K.F., 2011. Expression of industrially relevant laccases: prokaryotic style. Trends. Biotechnol. 29, 480-489. Singh, G., Capalash, N., Goel, R., Sharma, P., 2007. A pH-stable laccase from alkali-tolerant γproteobacterium JB: purification, characterization and indigo carmine degradation. Enzyme. Microb. Technol. 41, 794-799. Sondhi, S., Sharma, P., Saini, S., Puri, N., Gupta, N., 2014. Purification and characterization of an extracellular, thermo-alkali-stable, metal tolerant laccase from Bacillus tequilensis SN4. Plos. One. 9, e96951. Sørensen, H.P., Mortensen, K.K., 2005. Soluble expression of recombinant proteins in the cytoplasm of Escherichia coli. Microb. Cell. Fact. 4, 1. Tallarida, R.J., Murray, R.B., 1987. Enzyme Kinetics I: Michaelis—Menten equation. Manual of pharmacologic calculations: with computer programs. Springer New York, New York, NY, pp. 61-63. Torres, E., Bustos-Jaimes, I., Le Borgne, S., 2003. Potential use of oxidative enzymes for the detoxification of organic pollutants. Appl. Catal. B: Environ. 46, 1-15. Wang, T.-N., Lu, L., Wang, J.-Y., Xu, T.-F., Li, J., Zhao, M., 2015. Enhanced expression of an industry applicable CotA laccase from Bacillus subtilis in Pichia pastoris by non-repressing carbon sources together with pH adjustment: Recombinant enzyme characterization and dye decolorization. Process. Biochem. 50, 97-103.

20

Tables

Table 1 The alignment for N- and C-terminal regions of coding sequences for laccases from different Bacillus strains.

Bacillus strains

Partial sequence alignment for Laccases from different sources N-terminal coding sequence

Bacillus sp. SL-1 Bacillus sp. LS04 Bacillus licheniformis ATCC 14580 Bacillus subtilis Bacillus amyloliquefaciens Bacillus sonorensis L12

C-terminal coding sequence

ATGAAACTTGAAAAATTCGTTGACC…CTTGAAGTGACAGATGTTCGTCATCAATAA ATGAAACTTGAAAAATTCGTTGACC…CTTGAAGTGACAGATGTTCGTCATCAATAA ATGAAACTTGAAAAATTCGTTGACC…CTTGAAGTGACAGATGTTCGTCATCAATAA ATGACACTTGAAAAATTTGTGGATG…CCGATGGATATAACTGATCCCCATAAATAA ATGAAACTTGAAAAATTCGTTGACA…ACGCGGATCCCGATACAGATGCCAACATTA ATGAAACTTGAAAAATTTGTCGACC…GACGTCACAGATTTTCGCATCCAATCATAA

21

NCBI reference sequence KU711667 GU972589.1 NC_006270.3 NC_000964.3 JZDI01000041 AOFM01000005

Table 2 Purification steps of recombinant laccase produced in Origami expression system under micro-aerobic condition.

Cell extract

Total protein (mg) 12.48

Total activity (U) 4.58

Temp.shock (70 °C)

2.80

4.51

Ni sepharose affinity column

0.16

2.07

Purification steps

Specific activity (U/mg) 0.36

Yields (%)

Purification fold

100

1

1.61

98

4.39

13.00

45

35.2

22

Table 3 Kinetic properties of recombinant CotA(SL-1) from Bacillus sp. SL-1 compared to the CotA from B. subtilis and B. licheniformis. SGZ Source of laccase Bacillus sp. SL-1 Bacillus licheniformis Bacillus licheniformis Bacillus subtilis

ABTS

Km(µM)

Kcat(S-1)

Km(µM)

Kcat(S -1)

19.6 4.1 4.3 18

24 3.3 100 80

46 44 6.5 124

23 5.6 83 322

23

References This study (Lu et al., 2013) (Koschorreck et al., 2008) (Durao et al., 2008)

Table 4 Effects of inhibitors on activity of the recombinant laccase from Bacillus sp. SL-1. Inhibitor

Concentration

Residual activity (%)

(mM)

None NaCl

EDTA

SDS NaN3 L-cysteine Dithiothreitol

100 500 1000 10 25 50 0.1 1 0.1 1 0.1 1 0.1 1

100.00 104.80±2.45 82.81±1.40 75.99±4.25 111.11±1.07 102.60±1.36 100.61±7.60 104.45±7.88 102.71±3.08 101.41±0.85 65.42±2.31 0 0 0 0

24

Figure captions Figure 1 The SDS-PAGE gel electrophoresis and western blot analysis of His-tagged laccase with the size of ~65 kDa can be observed. (A) SDS-PAGE analysis of samples prepared from the soluble fraction of bacterial lysates. lane 1, molecular size markers (Fermentas); lane 2, Origami expression sample in micro-aerobic condition; lane 3, E. coli BL21 sample in micro-aerobic condition; lane 4, Origami expression sample in aerobic condition; lane 5, E. coli BL21 in aerobic condition. (B) Western blot analysis of 6×His-tagged laccase production in various conditions. Lane 1, Origami expression sample in micro-aerobic condition; lane 2, E. coli BL21 sample in micro-aerobic condition; lane 3, Origami expression sample in aerobic condition; lane 4, E. coli BL21 in aerobic condition.

Figure 2 UV-visible spectra of the rpCotA(SL-1), produced under micro-aerobic and aerobic conditions shown by dashed and solid lines, respectively.

25

Figure 3 Effect of pH on activity of the rpCotA(SL-1) at 35 °C with ABTS, pH 2.5–8.5 and syringaldazine, pH 2.5–10.

26

Figure 4 Effect of temperature on the stability of rpCotA(SL-1) and its oxidative activity on SGZ as the substrate at pH 6.5. (A) Laccase (oxidative) activity measured at different temperatures (25-60 °C) (B) Residual activity of enzyme was determined after incubation at 70°C for 4 h and 80°C for 2 h.

27

Figure 5 Effects of 10, 20, 30 and 50% of ethanol, methanol, acetonitrile and DMSO on activity of the rpCotA(SL-1)

28

29