- Email: [email protected]
A strategy of targeting B10 cell by CD19scFv-IL10R for tumor therapy
Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
A strategy of targeting B10 cell by CD19scFv-IL10R for tumor therapy Rong Zhao 1, Min Liu 1, Xin Li, Hanyu Chen, Jiahui Deng, Chun Huang, Xiao-lian Zhang*, Qin Pan** State Key Laboratory of Virology and Medical Research Institute, Hubei Province Key Laboratory of Allergy and Immunology and Department of Immunology, Wuhan University School of Medicine, Wuhan, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 17 October 2018 Accepted 30 October 2018 Available online xxx
IL-10 producing B (B10) cells, a subset of regulatory B (Breg) cells, produce IL-10 and play immunosuppressive roles in antitumor immunity. B10 cells are associated with enhanced tumor-aggressiveness and a poorer prognosis. To specifically inhibit the IL-10 secreted by B cells, we constructed the recombinant plasmid pcCD19scFv-IL10R, which contained the gene of anti-CD19 single-chain variable fragment (CD19scFv) and the extracellular domain of IL-10R1. Soluble CD19scFv-IL10R protein was identified in vitro and in vivo after the cells were transfected with pcCD19scFv-IL10R plasmid or the mice were injected with the plasmid. The fusion protein had the bispecific ability to target both IL-10 and CD19 molecules in vitro. Intramuscularly (i.m.) injecting mice with pcCD19scFv-IL-10R plasmid inhibited hepatocellular carcinoma growth in vivo. Mice treated with pcCD19scFv-IL-10R showed a significant reduction in B10 cells and regulatory T (Treg) cells, but an increase in the anti-tumor Th1 immune response and the cytotoxic CD8þ T cell response. Thus, targeting B10 cells by CD19scFv-IL10R molecule may offer a new avenue for tumor therapy. © 2018 Published by Elsevier Inc.
Keywords: B10 cell IL-10 CD19scFv Tumor
1. Introduction Bregs are associated with enhanced tumor-aggressiveness and a poorer prognosis [1,2]. These observations suggest that targeting of Bregs may be used to enhance immunotherapeutic outcomes of cancer. IL-10, as a major effector molecule of Bregs, has been thought to promote tumor immune escape by diminishing the antitumor immune response in the tumor microenvironment [3,4]. IL10 mediates its immunosuppressive effects via the IL-10 receptor (IL-10R). IL-10R is a complex composed of two IL-10R1 and two IL10R2 subunits. The extracellular domain of IL-10R1 binds to IL-10 [5]. IL-10R2, the cytoplasmic signaling/accessory subunit, activates the IL-10 signaling pathway upon ligation with IL-10 [6]. Single-chain miniAbs are recombinant monovalent Abs lacking the constant part of both the heavy and light chains. They are potentially useful as therapeutic reagents and are less likely to engender inflammatory responses [7]. CD19 is a B cell-specific
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (X.-l. Zhang), [email protected]. cn (Q. Pan). 1 Rong Zhao and Min Liu contributed equally to the work.
marker expressed at almost every stage of B cell development except after differentiation into plasma cells [8,9]. CD19 scFv miniAbs can be used as a means to specifically target B cells [10]. In the present study, we constructed the recombinant plasmid pcCD19scFv-IL10R, which contained CD19scFv and the extracellular domain of IL-10R1. We identified the fusion protein CD19scFv-IL10R specifically targeted both IL-10 and CD19 molecules in vitro. Injecting mice with the pcCD19scFv-IL-10R plasmid reduced B10 cells and inhibited the growth of tumors in vivo. 2. Methods 2.1. Mice and cell lines Murine hepatocellular carcinoma Hepa1-6 cells (ATCC® CRL1830™) and E. coli DH5a were preserved in our laboratory. The 6- to 8-week-old C57BL/6 mice were purchased from the Wuhan University Animal Experimental Center. All the mouse experiments were approved and supervised by the Institutional Animal Care and Use Committee of Animal Laboratory Center of Wuhan University. 2.2. Plasmid construction and preparation The cDNA fragment of IL-10, encoding the extracellular domain
https://doi.org/10.1016/j.bbrc.2018.10.191 0006-291X/© 2018 Published by Elsevier Inc.
Please cite this article as: R. Zhao et al., A strategy of targeting B10 cell by CD19scFv-IL10R for tumor therapy, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.10.191
2
R. Zhao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
of IL-10R1, was obtained from murine bone marrow-derived dendritic cells (DC). Bone marrow-derived DCs were prepared as pervious report [11]. The total RNA of DCs was extracted from the cells using Trizol reagent (Invitrogen, USA), and first strand cDNA was synthesized by the ReverTra Ace-a-Strand cDNA Synthesis Kit (Toyobo Biologics Inc., Japan) according to the manufacturer's protocol. The cDNA fragment, encoding the extracellular domain of IL-10R1, was obtained by PCR. The primers were as follows: sense primer: 50 GCAAGCTTATGCTAGAATTCATTGCA30 and anti-sense primer: 50 ATATCTCGAGGATGCTCAGGTTGGTC3’. The cDNA fragment of CD19scFv was obtained from the expression plasmid for CD19-scFv [10], which was kindly provided by Dr Jun Yan from the University of Louisville School of Medicine. The PCR was performed using the following primers: sense primer: 50 CAGGATCCATGGACATTCAGCTGACC30 and anti-sense primer: 50 ATAAGCTTCATGGTTCCTGGGCC 3’. The PCR product was first cloned in-frame between the BamHI and HindIII restriction sites of the pET-28a vector and was named pET-28a-CD19scFv. The IL-10R1 fragment was then cloned between the HindIII and XhoI restriction sites of pET-28a-CD19scFv and was named pET-28a-CD19scFv-IL10R. pET-28a-CD19scFv-IL-10R was then used as a template to constructed the eukaryotic expression plasmids pcDNA3.1()CD19scFv-IL-10R, pcDNA3.1()-CD19scFv and pcDNA3.1()-10R. The primers used for the eukaryotic expression plasmids were as follows: CD19scFv-IL-10R sense primer: 50 ATCTCGAGCTATGGACATTCAGCTGACCC3’; CD19scFv-IL-10R antisense primer: 50 ATGGATCCGATGCTCAGGTTGGTCACA3’; IL-10R sense primer: 50 GCCTCGAGGCATGCTAGAATTCATTGCAT3’; IL-10R anti-sense primer: 50 ATGGATCCGATGCTCAGGTTGGTCACA3’; CD19scFv sense primer: 50 CGCTCGAGATATGGACATTCAGCTGACCCAGTC3’; and CD19scFv anti-sense primer: 50 ATGGATCCCATGGTTCCTGGGCCCCAGTAAT3’. The CD19scFv-IL-10R, IL-10R and CD19scFv gene fragments were cloned between the XhoI and BamHI restriction sites of pcDNA3.1() and were named pcCD19scFv-IL-10R, pcIL-10R and pcCD19scFv, respectively. All the reconstructed plasmids were identified by sequencing. The plasmids were prepared with a nonendotoxin plasmid extraction kit (Sigma Chemicals, USA).
2.5. Pulldown assay The mouse splenocytes were stimulated with LPS (10 mg/ml) in the presence of IL-2 (30 IU/ml). After 72 h of stimulation, the cells were harvested and treated with RIPA buffer (Beyotime Biotechnology, China) on ice for 30 min. The supernatants were collected and mixed with the CD19scFv-IL-10R (IL-10R, or CD19scFv) conjugated Ni-NTA beads overnight at 4 C. The unbound proteins were removed from the beads by washing. The proteins bound with the beads were subjected to immunoblotting for detecting the IL-10 and CD19 molecules. 2.6. Determination of the expression of CD19scFv-IL-10R, IL-10R and CD19scFv in vivo The mice were randomized to four groups. At day 0, the mice were injected i.m. at the posterior tibialis muscle with 20 mg of DNA plasmid by electroporation with an Electric Square Porator (TERESA, ShangHai, China). Electroporation was administered as six 1 Hz pulses of 60 V/cm and 50 ms in duration and 1 s apart [12]. The groups were as follows: pcCD19scFv-IL-10R, pcIL-10R, pcCD19scFv and pcDNA. On days 3 and 5, 3 mice from each group were sacrificed for blood collection. The serum was mixed with Ni-NTA beads overnight at 4 C. The unbound proteins were removed from the beads. The proteins bound with beads were subjected to immunoblotting for detecting the CD19scFv-IL-10R, IL-10R and CD19scFv proteins. 2.7. In vivo tumor model At day 0, mice were injected inguinal s.c. with 2 106 Hepa16 cells/mouse. The mice were randomly divided into four groups as follow: pcCD19scFv- IL-10R, pcIL-10R, pcCD19scFv and pcDNA. On day 1, the mice were injected i.m. at the posterior tibialis muscle with 20 mg of DNA plasmid by electroporation [12]. On day 8, the mice were reinjected with the plasmids. The tumor size was measured every 2 days. 2.8. Intracellular cytokine staining
2.3. Transfection and protein expression in vitro Hepa1-6 cells (2 105 cells/ml) were transfected with 2 mg/well of DNA using Neofect (2 ml/well, Neofect Biotech, Beijing, China) according to the manufacturer's instructions, followed by incubation at 37 C for 12 h and 48 h. The supernatants from the transfected cells were harvested and incubated with Ni-NTA beads (Qiagen, Germany) overnight on ice. The protein-binding-Ni-NTA beads were washed with PBS and were resuspended with 2 SDS loading buffer and boiled at 90 C for 10 min. The samples were subjected to immunoblotting for detecting the expression of CD19scFv-IL-10R, IL-10R and CD19scFv.
2.4. Immunoblotting analysis PcCD19scFv-IL-10R, pcIL-10R and pcCD19scFv were transfected into the Hepa1-6 cells. The cell culture supernatant was collected and mixed with Ni-NTA beads. After washing, the proteins bound with the beads were subject to immunoblotting analysis. The primary Abs used included anti b-actin (Cell Signaling Technology, USA), anti-His-Tag (Cell Signaling Technology, USA), anti-IL-10R1 (Bio X Cell, USA) and anti-CD19 (Santa Cruz, USA) antibodies. The blots were developed using ECL Plus Western Blotting Detection Reagents (GE Healthcare, USA).
Splenocytes (2 106 in 2 ml/well) in the plates were stimulated with anti-CD3 mAb (5 mg/ml, coated on the plate), soluble antiCD28 (2 mg/ml, Biolegend, USA), LPS (10 mg/ml, Sigma, USA) and IL-2 (30 U/ml, Poprotech, USA). Five days later, the B10 cells, Tregs (Foxp3þCD4þ T cells), IFN-g/IL-4/IL-17A production by CD4þ T cells and perforin/granzyme production by CD8þ T cells were assessed by flow cytometry (FCM). Intracellular cytokine staining was performed using the BD Cytofix/Cytoperm Kit with BD GolgiPlug (BD Pharmingen, USA) according to the manufacturer's protocol. The antibodies used were APC-anti-CD19, APC-anti-CD3, FITC-anti-CD4, FITC-anti-CD8, PE-Cy5-anti-CD4, PE-anti-IL-10, PE-anti-IFN-g, PEanti-IL-4, PE-anti-IL-17A, PE-anti-perforin, PE-anti-granzyme B, and AF-488-anti-Foxp3. All the antibodies were purchased from Biolegend (USA). Samples were measured using BD FACSAria™ III flow cytometry in Medical Structural Biology Research Center of Wuhan University. 2.9. Cytotoxicity assay The LDH release assay CytoTox 96 (Promega, USA) was used to detect splenocyte cytotoxicity. The splenocytes from the mice in tumor model were stimulated with anti-CD3 mAb, anti-CD28, LPS and IL-2 for 5 days and were used as effector cells. Hepa1-6 cells were used as target cells (10,000 per well). The effector cells and target cells were cocultured for 14 h, and lactate dehydrogenase
Please cite this article as: R. Zhao et al., A strategy of targeting B10 cell by CD19scFv-IL10R for tumor therapy, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.10.191
R. Zhao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
(LDH) release in the supernatant was measured by spectrophotometry. The data were analyzed according to the manufacturer's instructions. 2.10. Statistical analysis The data are expressed as the means ± SD. An unpaired Student t-test was used to determine the significance of the differences. Significance was assumed to be reached at p < 0.05. The statistical analysis was performed using Prism 5.0 (GraphPad Software). 3. Results 3.1. Construct the pcCD19scFv-IL-10R plasmid and identify the secreted CD19scFv-IL-10R protein in vitro To build a bispecific molecule recognizing both CD19 and IL-10, we constructed the recombinant eukaryotic expression plasmid encoding fusion protein CD19scFv-IL-10R. As shown in Fig. 1A, pcCD19scFv-IL-10R, pcIL-10R and pC-CD19scFv were successfully cloned, and the sizes of the DNA fragments cut with the restriction enzymes were identified. We also identified the expressions of
3
recombinant proteins. As shown in Fig. 1B, the recombinant fusion proteins were blotted and probed with an anti-His-tag Ab at the expected sizes. The results demonstrated that the CD19scFv-IL-10R, IL-10R and CD19scFv proteins were produced and secreted by the cells transfected with the corresponding plasmids (Fig. 1B).
3.2. CD19scFv-IL-10R is produced and secreted in the serum from the mice injected with the pcCD19scFv-IL-10R plasmid Next we examined the protein CD19scfv-IL-10R expression in vivo. The mice were injected i.m. with pcCD19scFv-IL-10R, pcIL10R and pcCD19scFv plasmids. The serum was collected and was incubated with Ni-NTA beads. An immunoblotting analysis was performed to detect the recombinant proteins CD19scFv-IL-10R, IL10R and CD19scFv in the serum. As shown in Fig. 1C, the recombinant proteins CD19scFv-IL-10R, IL-10R and CD19scFv were detected in the serum 5 days after treatment with the corresponding plasmids. Recombinant IL-10R was also detected in the serum from pcCD19scFv-IL-10 group (Fig. 1C), probably because the IL-10R DNA fragment in the pcCD19scFv-IL-10R plasmid retained its start codon at the 5’ end leading to IL-10R expression.
Fig. 1. Construction of the pcCD19scFv-IL-10R plasmid and identification of the secreted CD19scFv-IL-10R protein. A, Gel electrophoresis. The plasmids were digested with XhoI and BamHI. B, The expression of secreted CD19scFv-IL-10R, IL-10R and CD19scFv in vitro. pcCD19scFv-IL-10R, pcIL-10R and pcCD19scFv were transfected into the Hepa1-6 cells. The cell culture supernatant was collected and was mixed with Ni-NTA beads. The protein bound with the beads was analyzed by immunoblotting with a His-Tag antibody.
Please cite this article as: R. Zhao et al., A strategy of targeting B10 cell by CD19scFv-IL10R for tumor therapy, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.10.191
4
R. Zhao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3.3. Fusion protein CD19scFv-IL-10R binds to both CD19 and IL-10 in vitro We assessed whether CD19scFv-IL-10R protein bound both CD19 and IL-10 in vitro. The splenocytes were stimulated with LPS to trigger the B cells to produce IL-10 [13]. The cells were lysed, and the lysate containing the CD19 and IL-10 molecules was mixed with CD19scFv-IL-10R conjugated beads. After pull down by the beads, the proteins binding to CD19scFv-IL-10R were identified by immunoblotting. As expected, the results indicated that the fusion protein CD19scFv-IL-10R was bound to both CD19 and IL-10 (Fig. 2). Additionally, our results also showed that the recombinant protein IL-10R and CD19scFv bound to IL-10 and CD19, respectively (Fig. 2). 3.4. PcCD19scFv-IL-10R treatment inhibits tumor growth in mice Since CD19scFv-IL-10R has the bispecific ability to bind both CD19 and IL-10, the fusion protein might be loaded onto the B cell surface via binding to CD19 and capture the IL-10 produced by the B cells to hinder the B10 cell function. We employed an in vivo tumor model to investigate the effects of CD19scFv-IL-10R on B10 cells and antitumor immunity. The mice were treated with the pcCD19scFvIL-10R plasmid on day 0 and day 8 and were inoculated subcutaneously (s.c.) with Hepa1-6 cells on day 2 (Fig. 3A). The tumor size was monitored every 2 days. As shown in Fig. 3B, the tumors in pcDNA control group grow significantly faster than pcCD19scFv-IL10R group and pcIL-10R group after day 12. On day 16, the tumor sizes in the mice treated with pcCD19scFv-IL-10R were significantly smaller than other groups (Fig. 3C). These results demonstrated that treatment with pcCD19scFv-IL-10R plasmid inhibited tumor growth in mice. 3.5. PcCD19scFv-IL-10R treatment decreases the B10 cells and Tregs in vivo To address the effects of pcCD19scFv-IL-10R treatment on B10 cells and Tregs in vivo, we examined the B10 cells and Tregs in the tumor-burden model. The B10 cell percentage in pcCD19scFvIL-10R group was significantly decreased compared with the other groups (Fig. 4A and Supplementary Fig. 1), suggesting that treatment with pcCD19scFv-IL-10R caused a reduction in B10 cells
in the mice inoculated with the Hepa1-6 cells. The B10 cells were also reduced in pcIL-10R group, indicating that the IL-10R protein partly caused the reduction of B10 cells (Fig. 4A and Supplementary Fig. 1). An injection with pcCD19scFv-IL-10R and pcIL-10R also reduced the Tregs in the mice (Fig. 4B and Supplementary Fig. 1). There might be two reasons for the Treg reduction. First, the B10 cells are involved in CD4þ T cell differentiation into Tregs [14e16]. Treatment with pcCD19scFv-IL-10R and pcIL-10R decreased B10 cells, contributing to the Treg reduction. Second, the recombinant protein IL-10R might be produced in both the pcCD19scFv-IL-10R and pcIL-10R groups, and soluble IL-10R might directly neutralize IL-10, resulting in Treg reduction. Consistent with our finding, Hiraki et al. reported that the neutralization of IL-10 by a neutralizing antibody decreased the percentage of Tregs in septic mice [17]. There were no significant differences in the B10 cells and Tregs between the pcCD19scFv and pcDNA groups, indicating that CD19scFv alone did not have an effect on B10 cells and Tregs (Fig. 4 A-B and Supplementary Fig. 1). Together, the results demonstrated that treatment with pcCD19scFv-IL-10R plasmid decreased the B10 cells and Tregs in vivo. 3.6. PcCD19scFv-IL-10R treatment enhances CD4þ Th1 responses in vivo To determine whether the T cell responses were influenced by the pcCD19scFv-IL-10R plasmid treatment, splenocytes from the tumor-bearing mice were collected and stimulated in vitro. The Th1/Th2/Th17 were determined by FCM. We found that the frequency of the IFN-g-producing CD4þ T cells in the pcCD19scFv-IL10R group was the highest among all the groups (Fig. 4C and Supplementary Fig. 2), indicating that blocking B10 cell function by CD19scFv-IL-10R might increase the Th1 response in the mice. Treatment with pcCD19scFv-IL-10R seemed to be more effective to promote a Th1 response than pcIL-10R treatment did, because the frequency of IFN-g-producing CD4þ T cells in the pcCD19scFv-IL10R group was significantly higher than the pcIL-10R group (Fig. 4C and Supplementary Fig. 2). PcIL-10R treatment also increased the Th1 response compared with the pcDNA group (Fig. 4C and Supplementary Fig. 2), indicating that IL-10R alone partly increased the Th1 response. The pcCD19scFv treatment caused a minor increase in IFN-g production by the CD4þ T cells, but no significant difference was observed compared with the pcDNA group. There were no significant differences in IL-4 and IL-17A production by CD4þ T cells among all the groups, indicating that the pcCD19scFv-IL-10R treatment had no effects on Th2 and Th17 cells (Fig. 4DeE and Supplementary Fig. 2). These results demonstrated that treatment with the pcCD19scFv-IL-10R plasmid enhanced CD4þ Th1 responses in vivo. 3.7. PcCD19scFv-IL-10R treatment increases CD8þ T cell responses and cytotoxicity activity against tumor cells in vivo
Fig. 2. Fusion protein CD19scFv-IL-10R binds to both CD19 and IL-10 in vitro. Splenocytes were stimulated with LPS to trigger the B cells to produce IL-10 as described in the Methods. The cell lysate, containing the CD19 and IL-10 molecules, was mixed with CD19scFv-IL-10R/IL-10R/CD19scFv-conjugated beads. The proteins binding to the CD19scFv-IL-10R were identified by immunoblotting with anti-CD19 and anti-IL-10 antibodies.
It has been reported that B10 cell depletion leads to effective CTL-mediated tumor eradication [2]. To access the cytotoxicity against Hepa1-6 cells, granzyme B and perforin production by splenic CD8þ T cells from the tumor-bearing mice was determined by FCM. As shown in Fig. 4FeG and Supplementary Fig. 3, the CD8þ T cells from the pcCD19scFv-IL-10R group produced more granzyme B and perforin than the other groups (p < 0.01), indicating that the CD19scFv-IL-10R protein contributed to promoting the cytotoxic activity of CD8þ T cells in vivo. We also observed the cytotoxicity of splenocytes by an LDH assay. After stimulation in vitro, the splenocytes were mixed with
Please cite this article as: R. Zhao et al., A strategy of targeting B10 cell by CD19scFv-IL10R for tumor therapy, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.10.191
R. Zhao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 3. Reduced tumor burden upon pcCD19scFv-IL-10R treatment. The mice were challenged with the Hepa1-6 cells on day 0. On day 1 and day 8, the mice were treated with pcCD19scFv-IL-10R, pcIL-10R, pcCD19scFv and pcDNA. A, Schematic diagram. The tumor growth B and the final tumor sizes C on day 16 were recorded. The data are representative of three experiments. The data in B and C are shown as the means ± SD (n ¼ 6).
Fig. 4. Detection of immune response after pcCD19scFv-IL-10R treatment in tumor burden model. Splenocytes from the mice were stimulated with anti-CD3, anti-CD28, LPS and IL-2 in vitro. (A-B)The B10 cells and Foxp3þCD4þ T cells were determined by FCM. (CeE) IFN-g/IL-4/IL-17A production by the CD4þ T cells were determined by FCM. (FeG) Granzyme B and perforin production by the CD8þ T cells were determined by FCM. H, The splenocytes were used as effector cells and were mixed with the target Hepa1-6 cells at different E:T ratios (1:1, 1:3 and 1:10) for 14 h. The released LDH in the supernatant was measured. The data are shown as the means ± SD (n ¼ 3). Error bars represent the SD of at least 3 replicate experiments.
the target Hepa1-6 cells at various E:T (effector:target) ratios. As shown in Fig. 4H, the highest level of cytotoxic activity of the
splenocytes was observed in pcCD19scFv-IL-10R group at E:T ratios of 3:1 and 10:1. These results indicated that the pcCD19scFv-IL-10R
Please cite this article as: R. Zhao et al., A strategy of targeting B10 cell by CD19scFv-IL10R for tumor therapy, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.10.191
6
R. Zhao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
increased the splenocytes’ cytotoxicity against the target cells. There was no difference in the cytotoxic activity of the splenocytes between the pcIL-10R and pcDNA groups (Fig. 4H). These results demonstrated that treatment with pcCD19scFv-IL-10R plasmid increased CD8þ T cell responses and cytotoxic activity against tumor cells in vivo. 4. Discussion The goal of the present study was to create a new anti-tumor strategy based on blocking the IL-10 secreted by B cells. We identified that the CD19scFv-IL-10R protein had the bispecific ability to bind both CD19 and IL-10 in vitro. We also validated that treatment with pcCD19scFv-IL-10R decreased B10 cells and inhibited tumor growth in mice. To the best of our knowledge, this is the first report about a molecule specific targeting B10 cells as a means for tumor therapy. Studies show that the proportion of Bregs and IL-10 in the serum of patients with primary hepatocellular carcinoma is higher than in healthy people [18]. In our current study, a hepatocellular carcinoma model was established to investigate the effect of a CD19scFv-IL-10R fusion protein on B10 cells. We found that the B10 cells were significantly decreased in vivo after the mice were treated with pcCD19scFv-IL-10R treatment (Fig. 4A). It has been reported that IL-10 also acts in an autocrine manner to regulate the differentiation of B cells [19,20]. B cells differentiation into B10 cells might be hindered by CD19scFv-IL-10R, because the fusion protein blocked IL-10 to bind to the IL-10 receptor on B cells. After B10 cell function was blocked in vivo by the pcCD19scFv-IL10R treatment, an increase in IFN-g producing CD4þ T cells was observed (Fig. 4C). Our results are consistent with previous reports, which demonstrate that B10 cells have the immunomodulatory function to inhibit T cell activation, as well as IFN-g cytokine responses in vivo [21]. Several reports also indicate that B10 cells suppress Th17 generation [14]. However, in our study there was no difference in the Th17 cell response in the mice treated with the pcCD19scFv-IL-10R plasmid compared with the other groups. The reason needs to be further elucidated. It is interesting that tumor growth was also partly inhibited in the pcIL-10R and pcCD19scFv groups (Fig. 3B). Soluble recombinant IL-10R protein in the mouse serum neutralized IL-10, inhibiting the immunosuppression driven by IL-10. This enhanced antitumor immunity in the mice. CD19scFv has been used to crosslink the CD19 and the B cell receptor on B cells to enhance B cell activation, indicating that CD19scFv might facilitate B cell activation [10]. Therefore, pcCD19scFv treatment might have a mild effect on inhibiting tumor growth. Similarly, Ma et al. also used a fusion protein containing CD19scFv and tumor-associated antigen her-2/ neu extracellular domain to promote B cell activation, which elicited a higher level of antitumor immunity [10]. However, both the pcIL-10R and pcCD19scFv treatments caused a comparatively lower level of antitumor immunity than the CD19scFv-IL-10R treatment did. CD19scFv-IL-10R might bind to B cells and be delivered into the tumor tissue. Therefore, CD19scFvIL-10R might neutralize IL-10 more effectively in the tumor microenvironment. The distribution of CD19scFv-IL-10R in the tumor tissue should be examined in future studies. Taken together, in the present study, we constructed a recombinant plasmid encoding the fusion protein CD19scFv-IL10R. The fusion protein specifically targeted both the IL-10 and CD19 molecules. Injecting i.m. mice with pcCD19scFv-IL-10R inhibited Hepa16 growth and caused a reduction in B10 cells and Tregs, but increased in anti-tumor Th1 immune response and cytotoxic CD8þ T cell response. This approach provides a novel molecule to inhibit B10 cells, which can be used as a strategy for tumor therapy.
Disclosure of potential conflicts of interest The authors declare no conflicts of interest. Acknowledgement This work was supported by grants from the National Key R&D Program of China (2018YFA0507603), the National Natural Science Foundation of China (81471910, 31770145, 31221061, 31370197 21572173 and 81501377), the National Outstanding Youth Foundation of China (81025008), the Major Projects of Technological Innovation of Hubei Province (2016ACA150), the Natural Science Foundation Key Project of Hubei Province (2016CFA062) and the Outstanding Youth Foundation of Hubei Province (2018CFA037). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2018.10.191. Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2018.10.191. References [1] X. Xiao, X.M. Lao, M.M. Chen, R.X. Liu, Y. Wei, F.Z. Ouyang, D.P. Chen, X.Y. Zhao, Q. Zhao, X.F. Li, C.L. Liu, L. Zheng, D.M. Kuang, PD-1hi identifies a novel regulatory B-cell population in human hepatoma that promotes disease progression, Cancer Discov. 6 (2016) 546e559. [2] H. Tao, L. Lu, Y. Xia, F. Dai, Y. Wang, Y. Bao, S.K. Lundy, F. Ito, Q. Pan, X. Zhang, F. Zheng, G. Shu, B. Fang, J. Jiang, J. Xia, S. Huang, Q. Li, A.E. Chang, Antitumor effector B cells directly kill tumor cells via the Fas/FasL pathway and are regulated by IL-10, Eur. J. Immunol. 45 (2015) 999e1009. [3] M.H. Mannino, Z. Zhu, H. Xiao, Q. Bai, M.R. Wakefield, Y. Fang, The paradoxical role of IL-10 in immunity and cancer, Cancer Lett. 367 (2015) 103e107. [4] P. Castillo, J.K. Kolls, IL-10: a paradigm for counterregulatory cytokines, J. Immunol. 197 (2016) 1529e1530. [5] T. Tanikawa, C.M. Wilke, I. Kryczek, G.Y. Chen, J. Kao, G. Nunez, W. Zou, Interleukin-10 ablation promotes tumor development, growth, and metastasis, Cancer Res. 72 (2012) 420e429. [6] V. Khare, G. Paul, O. Movadat, A. Frick, M. Jambrich, A. Krnjic, B. Marian, F. Wrba, C. Gasche, IL10R2 overexpression promotes IL22/STAT3 signaling in colorectal carcinogenesis, Canc. Immunol. Res. 3 (2015) 1227e1235. [7] D. Kim, S. Jang, J. Oh, S. Han, S. Park, P. Ghosh, D.K. Rhee, S. Lee, Molecular characterization of single-chain antibody variable fragments (scFv) specific to Pep 27 from Streptococcus pneumoniae, Biochem. Biophys. Res. Commun. 501 (2018) 718e723. [8] M. Sadelain, CAR therapy: the CD19 paradigm, J. Clin. Invest. 125 (2015) 3392e3400. [9] T. Tsukahara, K. Ohmine, C. Yamamoto, R. Uchibori, H. Ido, T. Teruya, M. Urabe, H. Mizukami, A. Kume, M. Nakamura, J. Mineno, K. Takesako, I. Riviere, M. Sadelain, R. Brentjens, K. Ozawa, CD19 target-engineered T-cells accumulate at tumor lesions in human B-cell lymphoma xenograft mouse models, Biochem. Biophys. Res. Commun. 438 (2013) 84e89. [10] Y. Ma, D. Xiang, J. Sun, C. Ding, M. Liu, X. Hu, G. Li, G. Kloecker, H.G. Zhang, J. Yan, Targeting of antigens to B lymphocytes via CD19 as a means for tumor vaccine development, J. Immunol. 190 (2013) 5588e5599. [11] N. Ning, Q. Pan, F. Zheng, S. Teitz-Tennenbaum, M. Egenti, J. Yet, M. Li, C. Ginestier, M.S. Wicha, J.S. Moyer, M.E. Prince, Y. Xu, X.L. Zhang, S. Huang, A.E. Chang, Q. Li, Cancer stem cell vaccination confers significant antitumor immunity, Cancer Res. 72 (2012) 1853e1864. [12] Q. Ding, Y. Shen, D. Li, J. Yang, J. Yu, Z. Yin, X.L. Zhang, Ficolin-2 triggers antitumor effect by activating macrophages and CD8(þ) T cells, Clin. Immunol. 183 (2017) 145e157. [13] D. Pore, K. Matsui, N. Parameswaran, N. Gupta, Cutting edge: ezrin regulates inflammation by limiting B cell IL-10 production, J. Immunol. 196 (2016) 558e562. [14] N.A. Carter, R. Vasconcellos, E.C. Rosser, C. Tulone, A. Munoz-Suano, M. Kamanaka, M.R. Ehrenstein, R.A. Flavell, C. Mauri, Mice lacking endogenous IL-10-producing regulatory B cells develop exacerbated disease and present with an increased frequency of Th1/Th17 but a decrease in regulatory T cells, J. Immunol. 186 (2011) 5569e5579. [15] A. Kessel, T. Haj, R. Peri, A. Snir, D. Melamed, E. Sabo, E. Toubi, Human CD19(þ) CD25(high) B regulatory cells suppress proliferation of CD4(þ) T cells and
Please cite this article as: R. Zhao et al., A strategy of targeting B10 cell by CD19scFv-IL10R for tumor therapy, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.10.191
R. Zhao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx enhance Foxp3 and CTLA-4 expression in T-regulatory cells, Autoimmun. Rev. 11 (2012) 670e677. [16] M. Tarique, H. Naz, S.V. Kurra, C. Saini, R.A. Naqvi, R. Rai, M. Suhail, N. Khanna, D.N. Rao, A. Sharma, Interleukin-10 producing regulatory B cells transformed CD4(þ)CD25(-) into Tregs and enhanced regulatory T cells function in human leprosy, Front. Immunol. 9 (2018) 1636. [17] S. Hiraki, S. Ono, H. Tsujimoto, M. Kinoshita, R. Takahata, H. Miyazaki, D. Saitoh, K. Hase, Neutralization of interleukin-10 or transforming growth factor-beta decreases the percentages of CD4þ CD25þ Foxp3þ regulatory T cells in septic mice, thereby leading to an improved survival, Surgery 151 (2012) 313e322. [18] T. Chen, D. Song, Z. Min, X. Wang, Y. Gu, B. Wei, J. Yao, K. Chen, Z. Jiang, H. Xie, L. Zhou, S. Zheng, Perioperative dynamic alterations in peripheral regulatory T
7
and B cells in patients with hepatocellular carcinoma, J. Transl. Med. 10 (2012) 14. [19] F. Figueiro, L. Muller, S. Funk, E.K. Jackson, A.M. Battastini, T.L. Whiteside, Phenotypic and functional characteristics of CD39(high) human regulatory B cells (Breg), OncoImmunology 5 (2016), e1082703. [20] G. Heine, G. Drozdenko, J.R. Grun, H.D. Chang, A. Radbruch, M. Worm, Autocrine IL-10 promotes human B-cell differentiation into IgM- or IgG-secreting plasmablasts, Eur. J. Immunol. 44 (2014) 1615e1621. [21] K. Kang, S.H. Park, J. Chen, Y. Qiao, E. Giannopoulou, K. Berg, A. Hanidu, J. Li, G. Nabozny, K. Kang, K.H. Park-Min, L.B. Ivashkiv, Interferon-gamma represses M2 gene expression in human macrophages by disassembling enhancers bound by the transcription factor MAF, Immunity 47 (2017) 235e250 e234.
Please cite this article as: R. Zhao et al., A strategy of targeting B10 cell by CD19scFv-IL10R for tumor therapy, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.10.191
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
A strategy of targeting B10 cell by CD19scFv-IL10R for tumor therapy Rong Zhao 1, Min Liu 1, Xin Li, Hanyu Chen, Jiahui Deng, Chun Huang, Xiao-lian Zhang*, Qin Pan** State Key Laboratory of Virology and Medical Research Institute, Hubei Province Key Laboratory of Allergy and Immunology and Department of Immunology, Wuhan University School of Medicine, Wuhan, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 17 October 2018 Accepted 30 October 2018 Available online xxx
IL-10 producing B (B10) cells, a subset of regulatory B (Breg) cells, produce IL-10 and play immunosuppressive roles in antitumor immunity. B10 cells are associated with enhanced tumor-aggressiveness and a poorer prognosis. To specifically inhibit the IL-10 secreted by B cells, we constructed the recombinant plasmid pcCD19scFv-IL10R, which contained the gene of anti-CD19 single-chain variable fragment (CD19scFv) and the extracellular domain of IL-10R1. Soluble CD19scFv-IL10R protein was identified in vitro and in vivo after the cells were transfected with pcCD19scFv-IL10R plasmid or the mice were injected with the plasmid. The fusion protein had the bispecific ability to target both IL-10 and CD19 molecules in vitro. Intramuscularly (i.m.) injecting mice with pcCD19scFv-IL-10R plasmid inhibited hepatocellular carcinoma growth in vivo. Mice treated with pcCD19scFv-IL-10R showed a significant reduction in B10 cells and regulatory T (Treg) cells, but an increase in the anti-tumor Th1 immune response and the cytotoxic CD8þ T cell response. Thus, targeting B10 cells by CD19scFv-IL10R molecule may offer a new avenue for tumor therapy. © 2018 Published by Elsevier Inc.
Keywords: B10 cell IL-10 CD19scFv Tumor
1. Introduction Bregs are associated with enhanced tumor-aggressiveness and a poorer prognosis [1,2]. These observations suggest that targeting of Bregs may be used to enhance immunotherapeutic outcomes of cancer. IL-10, as a major effector molecule of Bregs, has been thought to promote tumor immune escape by diminishing the antitumor immune response in the tumor microenvironment [3,4]. IL10 mediates its immunosuppressive effects via the IL-10 receptor (IL-10R). IL-10R is a complex composed of two IL-10R1 and two IL10R2 subunits. The extracellular domain of IL-10R1 binds to IL-10 [5]. IL-10R2, the cytoplasmic signaling/accessory subunit, activates the IL-10 signaling pathway upon ligation with IL-10 [6]. Single-chain miniAbs are recombinant monovalent Abs lacking the constant part of both the heavy and light chains. They are potentially useful as therapeutic reagents and are less likely to engender inflammatory responses [7]. CD19 is a B cell-specific
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (X.-l. Zhang), [email protected]. cn (Q. Pan). 1 Rong Zhao and Min Liu contributed equally to the work.
marker expressed at almost every stage of B cell development except after differentiation into plasma cells [8,9]. CD19 scFv miniAbs can be used as a means to specifically target B cells [10]. In the present study, we constructed the recombinant plasmid pcCD19scFv-IL10R, which contained CD19scFv and the extracellular domain of IL-10R1. We identified the fusion protein CD19scFv-IL10R specifically targeted both IL-10 and CD19 molecules in vitro. Injecting mice with the pcCD19scFv-IL-10R plasmid reduced B10 cells and inhibited the growth of tumors in vivo. 2. Methods 2.1. Mice and cell lines Murine hepatocellular carcinoma Hepa1-6 cells (ATCC® CRL1830™) and E. coli DH5a were preserved in our laboratory. The 6- to 8-week-old C57BL/6 mice were purchased from the Wuhan University Animal Experimental Center. All the mouse experiments were approved and supervised by the Institutional Animal Care and Use Committee of Animal Laboratory Center of Wuhan University. 2.2. Plasmid construction and preparation The cDNA fragment of IL-10, encoding the extracellular domain
https://doi.org/10.1016/j.bbrc.2018.10.191 0006-291X/© 2018 Published by Elsevier Inc.
Please cite this article as: R. Zhao et al., A strategy of targeting B10 cell by CD19scFv-IL10R for tumor therapy, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.10.191
2
R. Zhao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
of IL-10R1, was obtained from murine bone marrow-derived dendritic cells (DC). Bone marrow-derived DCs were prepared as pervious report [11]. The total RNA of DCs was extracted from the cells using Trizol reagent (Invitrogen, USA), and first strand cDNA was synthesized by the ReverTra Ace-a-Strand cDNA Synthesis Kit (Toyobo Biologics Inc., Japan) according to the manufacturer's protocol. The cDNA fragment, encoding the extracellular domain of IL-10R1, was obtained by PCR. The primers were as follows: sense primer: 50 GCAAGCTTATGCTAGAATTCATTGCA30 and anti-sense primer: 50 ATATCTCGAGGATGCTCAGGTTGGTC3’. The cDNA fragment of CD19scFv was obtained from the expression plasmid for CD19-scFv [10], which was kindly provided by Dr Jun Yan from the University of Louisville School of Medicine. The PCR was performed using the following primers: sense primer: 50 CAGGATCCATGGACATTCAGCTGACC30 and anti-sense primer: 50 ATAAGCTTCATGGTTCCTGGGCC 3’. The PCR product was first cloned in-frame between the BamHI and HindIII restriction sites of the pET-28a vector and was named pET-28a-CD19scFv. The IL-10R1 fragment was then cloned between the HindIII and XhoI restriction sites of pET-28a-CD19scFv and was named pET-28a-CD19scFv-IL10R. pET-28a-CD19scFv-IL-10R was then used as a template to constructed the eukaryotic expression plasmids pcDNA3.1()CD19scFv-IL-10R, pcDNA3.1()-CD19scFv and pcDNA3.1()-10R. The primers used for the eukaryotic expression plasmids were as follows: CD19scFv-IL-10R sense primer: 50 ATCTCGAGCTATGGACATTCAGCTGACCC3’; CD19scFv-IL-10R antisense primer: 50 ATGGATCCGATGCTCAGGTTGGTCACA3’; IL-10R sense primer: 50 GCCTCGAGGCATGCTAGAATTCATTGCAT3’; IL-10R anti-sense primer: 50 ATGGATCCGATGCTCAGGTTGGTCACA3’; CD19scFv sense primer: 50 CGCTCGAGATATGGACATTCAGCTGACCCAGTC3’; and CD19scFv anti-sense primer: 50 ATGGATCCCATGGTTCCTGGGCCCCAGTAAT3’. The CD19scFv-IL-10R, IL-10R and CD19scFv gene fragments were cloned between the XhoI and BamHI restriction sites of pcDNA3.1() and were named pcCD19scFv-IL-10R, pcIL-10R and pcCD19scFv, respectively. All the reconstructed plasmids were identified by sequencing. The plasmids were prepared with a nonendotoxin plasmid extraction kit (Sigma Chemicals, USA).
2.5. Pulldown assay The mouse splenocytes were stimulated with LPS (10 mg/ml) in the presence of IL-2 (30 IU/ml). After 72 h of stimulation, the cells were harvested and treated with RIPA buffer (Beyotime Biotechnology, China) on ice for 30 min. The supernatants were collected and mixed with the CD19scFv-IL-10R (IL-10R, or CD19scFv) conjugated Ni-NTA beads overnight at 4 C. The unbound proteins were removed from the beads by washing. The proteins bound with the beads were subjected to immunoblotting for detecting the IL-10 and CD19 molecules. 2.6. Determination of the expression of CD19scFv-IL-10R, IL-10R and CD19scFv in vivo The mice were randomized to four groups. At day 0, the mice were injected i.m. at the posterior tibialis muscle with 20 mg of DNA plasmid by electroporation with an Electric Square Porator (TERESA, ShangHai, China). Electroporation was administered as six 1 Hz pulses of 60 V/cm and 50 ms in duration and 1 s apart [12]. The groups were as follows: pcCD19scFv-IL-10R, pcIL-10R, pcCD19scFv and pcDNA. On days 3 and 5, 3 mice from each group were sacrificed for blood collection. The serum was mixed with Ni-NTA beads overnight at 4 C. The unbound proteins were removed from the beads. The proteins bound with beads were subjected to immunoblotting for detecting the CD19scFv-IL-10R, IL-10R and CD19scFv proteins. 2.7. In vivo tumor model At day 0, mice were injected inguinal s.c. with 2 106 Hepa16 cells/mouse. The mice were randomly divided into four groups as follow: pcCD19scFv- IL-10R, pcIL-10R, pcCD19scFv and pcDNA. On day 1, the mice were injected i.m. at the posterior tibialis muscle with 20 mg of DNA plasmid by electroporation [12]. On day 8, the mice were reinjected with the plasmids. The tumor size was measured every 2 days. 2.8. Intracellular cytokine staining
2.3. Transfection and protein expression in vitro Hepa1-6 cells (2 105 cells/ml) were transfected with 2 mg/well of DNA using Neofect (2 ml/well, Neofect Biotech, Beijing, China) according to the manufacturer's instructions, followed by incubation at 37 C for 12 h and 48 h. The supernatants from the transfected cells were harvested and incubated with Ni-NTA beads (Qiagen, Germany) overnight on ice. The protein-binding-Ni-NTA beads were washed with PBS and were resuspended with 2 SDS loading buffer and boiled at 90 C for 10 min. The samples were subjected to immunoblotting for detecting the expression of CD19scFv-IL-10R, IL-10R and CD19scFv.
2.4. Immunoblotting analysis PcCD19scFv-IL-10R, pcIL-10R and pcCD19scFv were transfected into the Hepa1-6 cells. The cell culture supernatant was collected and mixed with Ni-NTA beads. After washing, the proteins bound with the beads were subject to immunoblotting analysis. The primary Abs used included anti b-actin (Cell Signaling Technology, USA), anti-His-Tag (Cell Signaling Technology, USA), anti-IL-10R1 (Bio X Cell, USA) and anti-CD19 (Santa Cruz, USA) antibodies. The blots were developed using ECL Plus Western Blotting Detection Reagents (GE Healthcare, USA).
Splenocytes (2 106 in 2 ml/well) in the plates were stimulated with anti-CD3 mAb (5 mg/ml, coated on the plate), soluble antiCD28 (2 mg/ml, Biolegend, USA), LPS (10 mg/ml, Sigma, USA) and IL-2 (30 U/ml, Poprotech, USA). Five days later, the B10 cells, Tregs (Foxp3þCD4þ T cells), IFN-g/IL-4/IL-17A production by CD4þ T cells and perforin/granzyme production by CD8þ T cells were assessed by flow cytometry (FCM). Intracellular cytokine staining was performed using the BD Cytofix/Cytoperm Kit with BD GolgiPlug (BD Pharmingen, USA) according to the manufacturer's protocol. The antibodies used were APC-anti-CD19, APC-anti-CD3, FITC-anti-CD4, FITC-anti-CD8, PE-Cy5-anti-CD4, PE-anti-IL-10, PE-anti-IFN-g, PEanti-IL-4, PE-anti-IL-17A, PE-anti-perforin, PE-anti-granzyme B, and AF-488-anti-Foxp3. All the antibodies were purchased from Biolegend (USA). Samples were measured using BD FACSAria™ III flow cytometry in Medical Structural Biology Research Center of Wuhan University. 2.9. Cytotoxicity assay The LDH release assay CytoTox 96 (Promega, USA) was used to detect splenocyte cytotoxicity. The splenocytes from the mice in tumor model were stimulated with anti-CD3 mAb, anti-CD28, LPS and IL-2 for 5 days and were used as effector cells. Hepa1-6 cells were used as target cells (10,000 per well). The effector cells and target cells were cocultured for 14 h, and lactate dehydrogenase
Please cite this article as: R. Zhao et al., A strategy of targeting B10 cell by CD19scFv-IL10R for tumor therapy, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.10.191
R. Zhao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
(LDH) release in the supernatant was measured by spectrophotometry. The data were analyzed according to the manufacturer's instructions. 2.10. Statistical analysis The data are expressed as the means ± SD. An unpaired Student t-test was used to determine the significance of the differences. Significance was assumed to be reached at p < 0.05. The statistical analysis was performed using Prism 5.0 (GraphPad Software). 3. Results 3.1. Construct the pcCD19scFv-IL-10R plasmid and identify the secreted CD19scFv-IL-10R protein in vitro To build a bispecific molecule recognizing both CD19 and IL-10, we constructed the recombinant eukaryotic expression plasmid encoding fusion protein CD19scFv-IL-10R. As shown in Fig. 1A, pcCD19scFv-IL-10R, pcIL-10R and pC-CD19scFv were successfully cloned, and the sizes of the DNA fragments cut with the restriction enzymes were identified. We also identified the expressions of
3
recombinant proteins. As shown in Fig. 1B, the recombinant fusion proteins were blotted and probed with an anti-His-tag Ab at the expected sizes. The results demonstrated that the CD19scFv-IL-10R, IL-10R and CD19scFv proteins were produced and secreted by the cells transfected with the corresponding plasmids (Fig. 1B).
3.2. CD19scFv-IL-10R is produced and secreted in the serum from the mice injected with the pcCD19scFv-IL-10R plasmid Next we examined the protein CD19scfv-IL-10R expression in vivo. The mice were injected i.m. with pcCD19scFv-IL-10R, pcIL10R and pcCD19scFv plasmids. The serum was collected and was incubated with Ni-NTA beads. An immunoblotting analysis was performed to detect the recombinant proteins CD19scFv-IL-10R, IL10R and CD19scFv in the serum. As shown in Fig. 1C, the recombinant proteins CD19scFv-IL-10R, IL-10R and CD19scFv were detected in the serum 5 days after treatment with the corresponding plasmids. Recombinant IL-10R was also detected in the serum from pcCD19scFv-IL-10 group (Fig. 1C), probably because the IL-10R DNA fragment in the pcCD19scFv-IL-10R plasmid retained its start codon at the 5’ end leading to IL-10R expression.
Fig. 1. Construction of the pcCD19scFv-IL-10R plasmid and identification of the secreted CD19scFv-IL-10R protein. A, Gel electrophoresis. The plasmids were digested with XhoI and BamHI. B, The expression of secreted CD19scFv-IL-10R, IL-10R and CD19scFv in vitro. pcCD19scFv-IL-10R, pcIL-10R and pcCD19scFv were transfected into the Hepa1-6 cells. The cell culture supernatant was collected and was mixed with Ni-NTA beads. The protein bound with the beads was analyzed by immunoblotting with a His-Tag antibody.
Please cite this article as: R. Zhao et al., A strategy of targeting B10 cell by CD19scFv-IL10R for tumor therapy, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.10.191
4
R. Zhao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3.3. Fusion protein CD19scFv-IL-10R binds to both CD19 and IL-10 in vitro We assessed whether CD19scFv-IL-10R protein bound both CD19 and IL-10 in vitro. The splenocytes were stimulated with LPS to trigger the B cells to produce IL-10 [13]. The cells were lysed, and the lysate containing the CD19 and IL-10 molecules was mixed with CD19scFv-IL-10R conjugated beads. After pull down by the beads, the proteins binding to CD19scFv-IL-10R were identified by immunoblotting. As expected, the results indicated that the fusion protein CD19scFv-IL-10R was bound to both CD19 and IL-10 (Fig. 2). Additionally, our results also showed that the recombinant protein IL-10R and CD19scFv bound to IL-10 and CD19, respectively (Fig. 2). 3.4. PcCD19scFv-IL-10R treatment inhibits tumor growth in mice Since CD19scFv-IL-10R has the bispecific ability to bind both CD19 and IL-10, the fusion protein might be loaded onto the B cell surface via binding to CD19 and capture the IL-10 produced by the B cells to hinder the B10 cell function. We employed an in vivo tumor model to investigate the effects of CD19scFv-IL-10R on B10 cells and antitumor immunity. The mice were treated with the pcCD19scFvIL-10R plasmid on day 0 and day 8 and were inoculated subcutaneously (s.c.) with Hepa1-6 cells on day 2 (Fig. 3A). The tumor size was monitored every 2 days. As shown in Fig. 3B, the tumors in pcDNA control group grow significantly faster than pcCD19scFv-IL10R group and pcIL-10R group after day 12. On day 16, the tumor sizes in the mice treated with pcCD19scFv-IL-10R were significantly smaller than other groups (Fig. 3C). These results demonstrated that treatment with pcCD19scFv-IL-10R plasmid inhibited tumor growth in mice. 3.5. PcCD19scFv-IL-10R treatment decreases the B10 cells and Tregs in vivo To address the effects of pcCD19scFv-IL-10R treatment on B10 cells and Tregs in vivo, we examined the B10 cells and Tregs in the tumor-burden model. The B10 cell percentage in pcCD19scFvIL-10R group was significantly decreased compared with the other groups (Fig. 4A and Supplementary Fig. 1), suggesting that treatment with pcCD19scFv-IL-10R caused a reduction in B10 cells
in the mice inoculated with the Hepa1-6 cells. The B10 cells were also reduced in pcIL-10R group, indicating that the IL-10R protein partly caused the reduction of B10 cells (Fig. 4A and Supplementary Fig. 1). An injection with pcCD19scFv-IL-10R and pcIL-10R also reduced the Tregs in the mice (Fig. 4B and Supplementary Fig. 1). There might be two reasons for the Treg reduction. First, the B10 cells are involved in CD4þ T cell differentiation into Tregs [14e16]. Treatment with pcCD19scFv-IL-10R and pcIL-10R decreased B10 cells, contributing to the Treg reduction. Second, the recombinant protein IL-10R might be produced in both the pcCD19scFv-IL-10R and pcIL-10R groups, and soluble IL-10R might directly neutralize IL-10, resulting in Treg reduction. Consistent with our finding, Hiraki et al. reported that the neutralization of IL-10 by a neutralizing antibody decreased the percentage of Tregs in septic mice [17]. There were no significant differences in the B10 cells and Tregs between the pcCD19scFv and pcDNA groups, indicating that CD19scFv alone did not have an effect on B10 cells and Tregs (Fig. 4 A-B and Supplementary Fig. 1). Together, the results demonstrated that treatment with pcCD19scFv-IL-10R plasmid decreased the B10 cells and Tregs in vivo. 3.6. PcCD19scFv-IL-10R treatment enhances CD4þ Th1 responses in vivo To determine whether the T cell responses were influenced by the pcCD19scFv-IL-10R plasmid treatment, splenocytes from the tumor-bearing mice were collected and stimulated in vitro. The Th1/Th2/Th17 were determined by FCM. We found that the frequency of the IFN-g-producing CD4þ T cells in the pcCD19scFv-IL10R group was the highest among all the groups (Fig. 4C and Supplementary Fig. 2), indicating that blocking B10 cell function by CD19scFv-IL-10R might increase the Th1 response in the mice. Treatment with pcCD19scFv-IL-10R seemed to be more effective to promote a Th1 response than pcIL-10R treatment did, because the frequency of IFN-g-producing CD4þ T cells in the pcCD19scFv-IL10R group was significantly higher than the pcIL-10R group (Fig. 4C and Supplementary Fig. 2). PcIL-10R treatment also increased the Th1 response compared with the pcDNA group (Fig. 4C and Supplementary Fig. 2), indicating that IL-10R alone partly increased the Th1 response. The pcCD19scFv treatment caused a minor increase in IFN-g production by the CD4þ T cells, but no significant difference was observed compared with the pcDNA group. There were no significant differences in IL-4 and IL-17A production by CD4þ T cells among all the groups, indicating that the pcCD19scFv-IL-10R treatment had no effects on Th2 and Th17 cells (Fig. 4DeE and Supplementary Fig. 2). These results demonstrated that treatment with the pcCD19scFv-IL-10R plasmid enhanced CD4þ Th1 responses in vivo. 3.7. PcCD19scFv-IL-10R treatment increases CD8þ T cell responses and cytotoxicity activity against tumor cells in vivo
Fig. 2. Fusion protein CD19scFv-IL-10R binds to both CD19 and IL-10 in vitro. Splenocytes were stimulated with LPS to trigger the B cells to produce IL-10 as described in the Methods. The cell lysate, containing the CD19 and IL-10 molecules, was mixed with CD19scFv-IL-10R/IL-10R/CD19scFv-conjugated beads. The proteins binding to the CD19scFv-IL-10R were identified by immunoblotting with anti-CD19 and anti-IL-10 antibodies.
It has been reported that B10 cell depletion leads to effective CTL-mediated tumor eradication [2]. To access the cytotoxicity against Hepa1-6 cells, granzyme B and perforin production by splenic CD8þ T cells from the tumor-bearing mice was determined by FCM. As shown in Fig. 4FeG and Supplementary Fig. 3, the CD8þ T cells from the pcCD19scFv-IL-10R group produced more granzyme B and perforin than the other groups (p < 0.01), indicating that the CD19scFv-IL-10R protein contributed to promoting the cytotoxic activity of CD8þ T cells in vivo. We also observed the cytotoxicity of splenocytes by an LDH assay. After stimulation in vitro, the splenocytes were mixed with
Please cite this article as: R. Zhao et al., A strategy of targeting B10 cell by CD19scFv-IL10R for tumor therapy, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.10.191
R. Zhao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 3. Reduced tumor burden upon pcCD19scFv-IL-10R treatment. The mice were challenged with the Hepa1-6 cells on day 0. On day 1 and day 8, the mice were treated with pcCD19scFv-IL-10R, pcIL-10R, pcCD19scFv and pcDNA. A, Schematic diagram. The tumor growth B and the final tumor sizes C on day 16 were recorded. The data are representative of three experiments. The data in B and C are shown as the means ± SD (n ¼ 6).
Fig. 4. Detection of immune response after pcCD19scFv-IL-10R treatment in tumor burden model. Splenocytes from the mice were stimulated with anti-CD3, anti-CD28, LPS and IL-2 in vitro. (A-B)The B10 cells and Foxp3þCD4þ T cells were determined by FCM. (CeE) IFN-g/IL-4/IL-17A production by the CD4þ T cells were determined by FCM. (FeG) Granzyme B and perforin production by the CD8þ T cells were determined by FCM. H, The splenocytes were used as effector cells and were mixed with the target Hepa1-6 cells at different E:T ratios (1:1, 1:3 and 1:10) for 14 h. The released LDH in the supernatant was measured. The data are shown as the means ± SD (n ¼ 3). Error bars represent the SD of at least 3 replicate experiments.
the target Hepa1-6 cells at various E:T (effector:target) ratios. As shown in Fig. 4H, the highest level of cytotoxic activity of the
splenocytes was observed in pcCD19scFv-IL-10R group at E:T ratios of 3:1 and 10:1. These results indicated that the pcCD19scFv-IL-10R
Please cite this article as: R. Zhao et al., A strategy of targeting B10 cell by CD19scFv-IL10R for tumor therapy, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.10.191
6
R. Zhao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
increased the splenocytes’ cytotoxicity against the target cells. There was no difference in the cytotoxic activity of the splenocytes between the pcIL-10R and pcDNA groups (Fig. 4H). These results demonstrated that treatment with pcCD19scFv-IL-10R plasmid increased CD8þ T cell responses and cytotoxic activity against tumor cells in vivo. 4. Discussion The goal of the present study was to create a new anti-tumor strategy based on blocking the IL-10 secreted by B cells. We identified that the CD19scFv-IL-10R protein had the bispecific ability to bind both CD19 and IL-10 in vitro. We also validated that treatment with pcCD19scFv-IL-10R decreased B10 cells and inhibited tumor growth in mice. To the best of our knowledge, this is the first report about a molecule specific targeting B10 cells as a means for tumor therapy. Studies show that the proportion of Bregs and IL-10 in the serum of patients with primary hepatocellular carcinoma is higher than in healthy people [18]. In our current study, a hepatocellular carcinoma model was established to investigate the effect of a CD19scFv-IL-10R fusion protein on B10 cells. We found that the B10 cells were significantly decreased in vivo after the mice were treated with pcCD19scFv-IL-10R treatment (Fig. 4A). It has been reported that IL-10 also acts in an autocrine manner to regulate the differentiation of B cells [19,20]. B cells differentiation into B10 cells might be hindered by CD19scFv-IL-10R, because the fusion protein blocked IL-10 to bind to the IL-10 receptor on B cells. After B10 cell function was blocked in vivo by the pcCD19scFv-IL10R treatment, an increase in IFN-g producing CD4þ T cells was observed (Fig. 4C). Our results are consistent with previous reports, which demonstrate that B10 cells have the immunomodulatory function to inhibit T cell activation, as well as IFN-g cytokine responses in vivo [21]. Several reports also indicate that B10 cells suppress Th17 generation [14]. However, in our study there was no difference in the Th17 cell response in the mice treated with the pcCD19scFv-IL-10R plasmid compared with the other groups. The reason needs to be further elucidated. It is interesting that tumor growth was also partly inhibited in the pcIL-10R and pcCD19scFv groups (Fig. 3B). Soluble recombinant IL-10R protein in the mouse serum neutralized IL-10, inhibiting the immunosuppression driven by IL-10. This enhanced antitumor immunity in the mice. CD19scFv has been used to crosslink the CD19 and the B cell receptor on B cells to enhance B cell activation, indicating that CD19scFv might facilitate B cell activation [10]. Therefore, pcCD19scFv treatment might have a mild effect on inhibiting tumor growth. Similarly, Ma et al. also used a fusion protein containing CD19scFv and tumor-associated antigen her-2/ neu extracellular domain to promote B cell activation, which elicited a higher level of antitumor immunity [10]. However, both the pcIL-10R and pcCD19scFv treatments caused a comparatively lower level of antitumor immunity than the CD19scFv-IL-10R treatment did. CD19scFv-IL-10R might bind to B cells and be delivered into the tumor tissue. Therefore, CD19scFvIL-10R might neutralize IL-10 more effectively in the tumor microenvironment. The distribution of CD19scFv-IL-10R in the tumor tissue should be examined in future studies. Taken together, in the present study, we constructed a recombinant plasmid encoding the fusion protein CD19scFv-IL10R. The fusion protein specifically targeted both the IL-10 and CD19 molecules. Injecting i.m. mice with pcCD19scFv-IL-10R inhibited Hepa16 growth and caused a reduction in B10 cells and Tregs, but increased in anti-tumor Th1 immune response and cytotoxic CD8þ T cell response. This approach provides a novel molecule to inhibit B10 cells, which can be used as a strategy for tumor therapy.
Disclosure of potential conflicts of interest The authors declare no conflicts of interest. Acknowledgement This work was supported by grants from the National Key R&D Program of China (2018YFA0507603), the National Natural Science Foundation of China (81471910, 31770145, 31221061, 31370197 21572173 and 81501377), the National Outstanding Youth Foundation of China (81025008), the Major Projects of Technological Innovation of Hubei Province (2016ACA150), the Natural Science Foundation Key Project of Hubei Province (2016CFA062) and the Outstanding Youth Foundation of Hubei Province (2018CFA037). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2018.10.191. Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2018.10.191. References [1] X. Xiao, X.M. Lao, M.M. Chen, R.X. Liu, Y. Wei, F.Z. Ouyang, D.P. Chen, X.Y. Zhao, Q. Zhao, X.F. Li, C.L. Liu, L. Zheng, D.M. Kuang, PD-1hi identifies a novel regulatory B-cell population in human hepatoma that promotes disease progression, Cancer Discov. 6 (2016) 546e559. [2] H. Tao, L. Lu, Y. Xia, F. Dai, Y. Wang, Y. Bao, S.K. Lundy, F. Ito, Q. Pan, X. Zhang, F. Zheng, G. Shu, B. Fang, J. Jiang, J. Xia, S. Huang, Q. Li, A.E. Chang, Antitumor effector B cells directly kill tumor cells via the Fas/FasL pathway and are regulated by IL-10, Eur. J. Immunol. 45 (2015) 999e1009. [3] M.H. Mannino, Z. Zhu, H. Xiao, Q. Bai, M.R. Wakefield, Y. Fang, The paradoxical role of IL-10 in immunity and cancer, Cancer Lett. 367 (2015) 103e107. [4] P. Castillo, J.K. Kolls, IL-10: a paradigm for counterregulatory cytokines, J. Immunol. 197 (2016) 1529e1530. [5] T. Tanikawa, C.M. Wilke, I. Kryczek, G.Y. Chen, J. Kao, G. Nunez, W. Zou, Interleukin-10 ablation promotes tumor development, growth, and metastasis, Cancer Res. 72 (2012) 420e429. [6] V. Khare, G. Paul, O. Movadat, A. Frick, M. Jambrich, A. Krnjic, B. Marian, F. Wrba, C. Gasche, IL10R2 overexpression promotes IL22/STAT3 signaling in colorectal carcinogenesis, Canc. Immunol. Res. 3 (2015) 1227e1235. [7] D. Kim, S. Jang, J. Oh, S. Han, S. Park, P. Ghosh, D.K. Rhee, S. Lee, Molecular characterization of single-chain antibody variable fragments (scFv) specific to Pep 27 from Streptococcus pneumoniae, Biochem. Biophys. Res. Commun. 501 (2018) 718e723. [8] M. Sadelain, CAR therapy: the CD19 paradigm, J. Clin. Invest. 125 (2015) 3392e3400. [9] T. Tsukahara, K. Ohmine, C. Yamamoto, R. Uchibori, H. Ido, T. Teruya, M. Urabe, H. Mizukami, A. Kume, M. Nakamura, J. Mineno, K. Takesako, I. Riviere, M. Sadelain, R. Brentjens, K. Ozawa, CD19 target-engineered T-cells accumulate at tumor lesions in human B-cell lymphoma xenograft mouse models, Biochem. Biophys. Res. Commun. 438 (2013) 84e89. [10] Y. Ma, D. Xiang, J. Sun, C. Ding, M. Liu, X. Hu, G. Li, G. Kloecker, H.G. Zhang, J. Yan, Targeting of antigens to B lymphocytes via CD19 as a means for tumor vaccine development, J. Immunol. 190 (2013) 5588e5599. [11] N. Ning, Q. Pan, F. Zheng, S. Teitz-Tennenbaum, M. Egenti, J. Yet, M. Li, C. Ginestier, M.S. Wicha, J.S. Moyer, M.E. Prince, Y. Xu, X.L. Zhang, S. Huang, A.E. Chang, Q. Li, Cancer stem cell vaccination confers significant antitumor immunity, Cancer Res. 72 (2012) 1853e1864. [12] Q. Ding, Y. Shen, D. Li, J. Yang, J. Yu, Z. Yin, X.L. Zhang, Ficolin-2 triggers antitumor effect by activating macrophages and CD8(þ) T cells, Clin. Immunol. 183 (2017) 145e157. [13] D. Pore, K. Matsui, N. Parameswaran, N. Gupta, Cutting edge: ezrin regulates inflammation by limiting B cell IL-10 production, J. Immunol. 196 (2016) 558e562. [14] N.A. Carter, R. Vasconcellos, E.C. Rosser, C. Tulone, A. Munoz-Suano, M. Kamanaka, M.R. Ehrenstein, R.A. Flavell, C. Mauri, Mice lacking endogenous IL-10-producing regulatory B cells develop exacerbated disease and present with an increased frequency of Th1/Th17 but a decrease in regulatory T cells, J. Immunol. 186 (2011) 5569e5579. [15] A. Kessel, T. Haj, R. Peri, A. Snir, D. Melamed, E. Sabo, E. Toubi, Human CD19(þ) CD25(high) B regulatory cells suppress proliferation of CD4(þ) T cells and
Please cite this article as: R. Zhao et al., A strategy of targeting B10 cell by CD19scFv-IL10R for tumor therapy, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.10.191
R. Zhao et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx enhance Foxp3 and CTLA-4 expression in T-regulatory cells, Autoimmun. Rev. 11 (2012) 670e677. [16] M. Tarique, H. Naz, S.V. Kurra, C. Saini, R.A. Naqvi, R. Rai, M. Suhail, N. Khanna, D.N. Rao, A. Sharma, Interleukin-10 producing regulatory B cells transformed CD4(þ)CD25(-) into Tregs and enhanced regulatory T cells function in human leprosy, Front. Immunol. 9 (2018) 1636. [17] S. Hiraki, S. Ono, H. Tsujimoto, M. Kinoshita, R. Takahata, H. Miyazaki, D. Saitoh, K. Hase, Neutralization of interleukin-10 or transforming growth factor-beta decreases the percentages of CD4þ CD25þ Foxp3þ regulatory T cells in septic mice, thereby leading to an improved survival, Surgery 151 (2012) 313e322. [18] T. Chen, D. Song, Z. Min, X. Wang, Y. Gu, B. Wei, J. Yao, K. Chen, Z. Jiang, H. Xie, L. Zhou, S. Zheng, Perioperative dynamic alterations in peripheral regulatory T
7
and B cells in patients with hepatocellular carcinoma, J. Transl. Med. 10 (2012) 14. [19] F. Figueiro, L. Muller, S. Funk, E.K. Jackson, A.M. Battastini, T.L. Whiteside, Phenotypic and functional characteristics of CD39(high) human regulatory B cells (Breg), OncoImmunology 5 (2016), e1082703. [20] G. Heine, G. Drozdenko, J.R. Grun, H.D. Chang, A. Radbruch, M. Worm, Autocrine IL-10 promotes human B-cell differentiation into IgM- or IgG-secreting plasmablasts, Eur. J. Immunol. 44 (2014) 1615e1621. [21] K. Kang, S.H. Park, J. Chen, Y. Qiao, E. Giannopoulou, K. Berg, A. Hanidu, J. Li, G. Nabozny, K. Kang, K.H. Park-Min, L.B. Ivashkiv, Interferon-gamma represses M2 gene expression in human macrophages by disassembling enhancers bound by the transcription factor MAF, Immunity 47 (2017) 235e250 e234.
Please cite this article as: R. Zhao et al., A strategy of targeting B10 cell by CD19scFv-IL10R for tumor therapy, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2018.10.191