A stress responsive alternative splicing mechanism in Citrus clementina leaves

Journal of Plant Physiology 168 (2011) 952–959

Contents lists available at ScienceDirect

Journal of Plant Physiology journal homepage: www.elsevier.de/jplph

A stress responsive alternative splicing mechanism in Citrus clementina leaves Renata Del Carratore a,∗ , Eleonora Magaldi a,b , Alessandra Podda b , Pascale Beffy a , Quirico Migheli c , Bianca Elena Maserti b a

Institute of Clinical Physiology, National Council of Research, Via Moruzzi 1, 56124 Pisa, Italy Institute of Biophysics, U.O. Pisa, National Council of Research, Via Moruzzi 1, 56124 Pisa, Italy c Plant Protection Department, University of Sassari, Via De Nicola 9, I – 07100 Sassari, Italy b

a r t i c l e

i n f o

Article history: Received 24 May 2010 Received in revised form 12 November 2010 Accepted 15 November 2010 Keywords: Citrus clementina Chitinase Tetranychus urticae Alternative splicing Methyl jasmonate

a b s t r a c t Chitinases are often considered pathogenesis-related proteins since their activity can be induced by viral infections, fungal and bacterial cell wall components, and also by more general sources of stress such as wounding, salicylic acid, ethylene, auxins and cytokinins. In the present study, comparative proteomic analysis showed the defense-related acidic chitinase II to be specifically induced in Citrus clementina leaves infested by the two-spotted spider mite Tetranychus urticae or treated with MeJA. In parallel, changes in the mRNA profiles of two partially homologous chitinase forms were shown by RT-PCR. In particular, the appearance of an additional cDNA chitinase fragment in T. urticae-infested and MeJA-treated leaves was observed. This finding may indicate a specific regulatory mechanism of chitinase expression. We report evidence for alternative splicing in T. urticae-infested C. clementina, where a premature stop codon after the first 135 amino acids was introduced. We observed inducible chitinase activity after MeJA treatment, indicative of a rapid plant response to infestation. This work provides the first evidence of chitinase alternative splicing in C. clementina. In addition, the presence of the dual-band pattern for chitinase cDNA by RT-PCR may represent a suitable predictive marker for early diagnosis of plant biotic stress. © 2011 Elsevier GmbH. All rights reserved.

Introduction Plants have evolved a wide range of defense mechanisms to recognize and respond to feeding herbivores, attacking pathogens, physical agents and wounding events. Complex signaling pathways in which phytohormone jasmonic acid (JA) as well as its derivative methyl jasmonate (MeJA) and salicylic acid function as key signaling molecules, trigger the defense reaction of plants to insects or arthropods (Howe and Jander, 2008; Bari and Jones, 2009). The twospotted spider mite Tetranychus urticae (Koch) is a cell-sucking mite species that lives in dry environments. It represents a dangerous pest on many economically important plant species including citrus, one of the most widely grown fruit crops in the world. In a recent work we reported differentially expressed proteins in Citrus clementina leaves under T. urticae infestation or MeJA elicitor treatment, using comparative proteomic analysis. Several defense proteins have been evidenced, including an acidic chitinase class II (Maserti et al., 2011). Chitinases are pathogenesis-related proteins that hydrolyze chitin and have been found to be widely expressed in citrus tissues (Terol et al., 2007). Since chitin constitutes a large

∗ Corresponding author. Tel.: +39 3476644425. E-mail address: [email protected] (R. Del Carratore). 0176-1617/$ – see front matter © 2011 Elsevier GmbH. All rights reserved. doi:10.1016/j.jplph.2010.11.016

fraction of the insect cuticle and of the cell walls of many phytopathogenic fungi, it was suggested that chitinases could play a role in defense against plant pathogens (Rakwal et al., 2004; Van Loon et al., 2006; Takenaka et al., 2009). Induction of an acidic chitinase was observed in leaves of rough lemon after mechanical wounding, MeJA treatment and fungal infection (Gomi et al., 2002). Kant et al. (2004) found overexpression of chitinase genes in tomato leaves infested with T. urticae. The exact role of chitinase in response to insect and arthropods in Citrus is still largely unknown. The aim of this work was to investigate the molecular mechanism controlling chitinase expression in C. clementina in response to different types of stress, including T. urticae infestation, MeJA treatment, salicylic acid treatment, and wounding. Materials and methods Plant materials and treatments Citrus x clementina (“Clementine de Corse”, clone SRA 63; Station de Recherche INRA, S. Giuliano, Corse, France) plants were used as the leaf source. Plants were reproduced by scions excised from a single mother plant and grafted on Poncirus trifoliata (cv Kryder) rootstocks. Plants were grown in separate pots (7 L) in com-

R. Del Carratore et al. / Journal of Plant Physiology 168 (2011) 952–959

953

mercially available substrate for citrus plants, under greenhouse condition for two years. Plants were watered every three days and received the proper dose of fertilizer for citrus plants (NPK 6.5.11Gesal, Italy: 6% N; 5% P2 O5 ; 6% K2 O; 0.01% B; 0.002% Cu; 0.02% Fe; 0.01% Mn; 0.001% Mo; 0.002% Zn) once a week. Three months before the experiments, the plants were transferred to controlled growth chambers. The experimental conditions were as follows: 28 ± 1 ◦ C; light/dark cycle of 16/8 h; relative humidity 60–80%. Fluorescent tubes (General Electric F36W/54 and Osram Fluora L36W/77) were used to produce a 100 ␮mol m−2 s−1 PAR. No other plants were present in the room at the time of the experiment. Different experiments were performed in separate growth chambers with the same environmental conditions. Each experiment was performed in triplicate, with each sample consisting of a pool of four leaves of the same age and similar size (8 × 3.5 cm), collected from four independent plants. Treatments and leaf sampling were carried out in the middle of day photoperiod. Harvested leaves were carefully washed with double distilled water, frozen in liquid nitrogen and stored at −80 ◦ C until analysis.

protein markers from Sigma–Aldrich (S8445), and the resulting gels were stained with colloidal Coomassie (Neuhoff et al., 1988).

Tetranychus urticae infestation Infestation by T. urticae was carried out by transferring about 50 spider mites collected from naturally infested C. clementina onto leaves of test plants. Infested leaves were closed into nest bags to avoid mite escape. Control leaves were closed into nest bags with no mites. Leaves were harvested at 24 h after infestation.

Protein identification by LC–MS/MS

Chemical treatments Treatments were performed by spraying the upper and lower leaf sheet with an aqueous solution of 1% (v/v) glycerol supplemented with 100 ␮M MeJA or 1 mM salicylic acid. MeJA or salicylic acid was diluted in water from a 1000-fold stock solution in 96% ethanol. Control leaves were treated with aqueous solution containing 1% (v/v) glycerol. For the MeJA dose–effect experiments leaves were treated with 0.5, 10, 50 or 100 ␮M and harvested after 24 h. Leaf material was harvested at 2, 6, 24, 48 and 72 h after 100 ␮M MeJA treatment or at 0, 24 h after salicylic acid treatment. Wounding Wounding was performed by rubbing citrus leaves with autoclaved carborundum (Geonatura, Spain). Leaf tissue was harvested at 0 and 24 h after wounding. Protein extraction and solubilization For each treatment, total protein extracts were prepared in duplicate for each sample as previously described (Maserti et al., 2007), with the following modification: 0.01% protease inhibitor cocktail (P 9599 Sigma–Aldrich, Italy) was added to lysis buffer. Protein concentration of crude extract was assayed using RC/DC assay (BioRad, USA). Bovine serum albumin was used to create a standard curve. The final average protein concentration was 3 ± 1.5 mg/g F.W. Protein samples were stored at −80 ◦ C for analysis. 2-DE analysis 2-DE analysis was performed according to Maserti et al. (2011) with the following slight modifications. Briefly, a total of 100 ␮g of proteins were dissolved in 125 ␮l of rehydration buffer and loaded on 7 cm immobilized pH gradient (IPG) strips pH 3–10 nonlinear (GE-Healthcare), from the same batch. In-gel rehydration was performed in passive mode and IPGs were focused until total 12,000 V h. Focused strips were equilibrated and applied to the top of 13% w/v lab-cast polyacrylamide gel. Second dimension electrophoresis was carried out on Mini Protean 3 (Bio-Rad) at constant 150 V. Molecular masses were determined by running standard

Image and statistical analysis The 2-DE gel images were analyzed and the protein volume of each identified spot was quantified using REDFIN basic software (http://www.ludesi.com) in which gel images are wrapped around each other after setting specific vector points. A fusion gel image was then created, spots were detected and transferred back to all the analyzed gels, and then the intensity of each protein spot was normalized to the total intensity of all valid spots detected on each gel. For each treatment, three 2-DE gels representing three biological replicates were used for data analyses. Spots were defined up-regulated when the ratio between normalized volume in treated leaves/control leaves was ≥1.5, and downregulated when the ratio was ≤1.5 with paired t-tests (p < 0.05). Spots were manually excised from gels and subjected to LC–MS/MS followed by a database search for identification.

Spots were processed using a MultiProbe II liquid handling automate (PerkinElmer). Briefly, after an extensive wash with ammonium bicarbonate and acetonitrile, proteins were digested using trypsin (0.1 ␮g) and, after peptide extraction with ammonium carbonate and acetonitrile, the volume of digests was reduced to about 10 ␮L. LC–MS experiments were performed using an Agilent 1200 LC chain fitted with the Chip Cube (Agilent) and coupled to an Esquire-HCT ion trap mass spectrometer (Bruker). Tryptic peptides (2 ␮L) were resolved on a Chip containing an enrichment precolumn and a 43 mm × 75 ␮m RP column, using a linear gradient (7 min) from 3% to 45% of an 80% acetonitrile mobile phase in 0.1% formic acid. The overall system performance was assessed by introducing a bovine serum albumin sample (25 fmol) every 10 samples. Raw data were processed using the Data Analysis software (Bruker) to generate files for database searching with the Mascot software (Matrix Sciences). The NCBI Viridiplantae taxonomy was selected to search the MSDB database (20063108 release) using the following parameters: one missed cleavage allowed, carboxymethylated cystein as fixed modification, mass tolerance of ±0.6 Da for both precursor and product ions. Ion scores above 38 were considered as significant (p < 0.05). RNA extraction and RT-PCR Total RNA extraction was performed by modifying the method suggested for the TaqMan Gene Expression Cells-to-CT TM Kit (Applied Biosystems). Ten mg of liquid-nitrogen frozen leaves was extracted with PBS; 5 ␮L of the extracted suspension was added to lysis buffer plus DNAse to exclude genomic contamination as described by the manufacturer. Two ␮L of the reverse transcribed samples was used for PCR amplification performed with GoTaq Green Mastermix (Promega, USA). As the Applied Biosystems extraction method is performed for cell culture we validated the method using a standard RNA extraction procedure (Quiagen). Fw1: CCTGCCAGAGGCTTCTACAC, Rev1: TCCCCAAGCATATTCTCCAC primers (underlined in Fig. 2) were designed based on the cDNA sequence deduced from the identification peptide REMFEDLLPYRN (underlined in Fig. 3) found in two spots at 33 kDa and 23 kDa of C. clementina leaf proteome and matching with acidic chitinase class II (UniProtKB accession number Q8H985). Fw2: ATC GAC GAA TGG AAA CCA TC, Rev2: ATT GTC ACC AGG CTG AAT CC; Fw3: CCTGCCAGAGGCTTCTACAC, Rev3: TAAACTCTTGTTGTGCCCCC primers, were designed in other parts of the sequence (see Results). Transcript levels were compared with citrus elongation factor 1-alpha gene (EF1) AY498567 (Distefano et al., 2008) as internal control (elong

954

R. Del Carratore et al. / Journal of Plant Physiology 168 (2011) 952–959

Fw: GGT CAG ACT CGT GAG CAT GC, elong Rev: CAT CT ACC TAG CCT TTG AGT ACT TG). The following standard thermal profile was used for all PCR: 94 ◦ C for 3 min; 35 cycles of 90 ◦ C for 30 s, 59 ◦ C for 40 s, and 72 ◦ C for 40 s; 72 ◦ C for 7 min as final extension. PCR products were separated on 1% agarose gel electrophoresis and stained with ethidium bromide. cDNA fragments were purified from gels and sequenced by BMR-Genomics (Italy). For each PCR, the concentration of cDNA and the number of cycles were optimized to observe a quantifiable signal within the linear range of amplification, according to the putative level of each mRNA amplified and the size of the corresponding PCR product. Control reactions were performed in the absence of reverse transcriptase. Genomic DNA extraction Ten mg of liquid-nitrogen frozen leaves was suspended in buffer and genomic DNA was extracted using DNA Promega Kit, following the manufacturer’s protocol. Fig. 1. Enlargement of representative 2-DE acidic chitinase spots (A) and acidic chitinase cDNA expression pattern (B). (A) 33 kDa (upper panels) and 23 kDa (lower panels) acidic chitinase in control leaves (C) and 24 h after Tetranychus urticae infestation (T. ur). (B) 33 kDa (upper panels) and 23 kDa acidic chitinase (lower panels) at time 0 (C0), or 24 h after MeJA application (MeJA24). Relative spot intensities of the proteins expressed in parts per million are reported in histograms. Standard deviation (error bars) was calculated from three independent sample replicates and two technical replicates for each sample. (C) Typical pattern of acidic chitinase expression analyzed by RT-PCR in control leaves (0), and 24 h after T. urticae infestation (24). Constitutively expressed elongation factor was amplified as an internal control. Chitinase genomic fragment amplified by the same pair of primers is reported on the right.

Data sources and sequence analysis C. clementina ESTs were obtained from TIGR (http://blast.jcvi. org/euk-blast/plantta blast.cgi) or NCBI (http://www.ncbi.nlm. nih.gov/sites/entrez) databases. BLAST was used to align our experimentally obtained chitinase sequence to the plant ESTs. Chitinase in-gel-activity assay The chitinase activity was monitored after semi-native gel electrophoresis according to Trudel and Asselin (1989) with minor modification. Briefly, citrus leaf tissues (about 100 mg) were +1

TA6704_85681---------------AACTGTTGCTTTCAAAATGAGGCTTATTGCGTCCTTACTAGTTTTC.30 TA2041_85681---------------AACTGTTGCTTTCAAAATGAGGCTTATTGCGTCCTTACTAGTTTTC TA6704_85681-TCTCTAGTTTTATCTTTCGTACTAGGAGGCTCAGCACGGAATTGTGGAAGCGGCGTTGTG 90 TA2041_85681-TCTCTAGTTTTATCTTTCGTACTAGGAGGCTCAGCACGGAATTGTGGAAGCGGCGTTGTG TA6704_85681-TGCGGTGAACGTGATACCGGCCACGGGACGGATGGCGGTGAACTGGGCAAGATCATCTCA 150 TA2041_85681-TGCGGTGAACGTGATACCGGCCACGGGACGGATGGCGGTGAACTGGGCAAGATCATCTCA TA6704_85681-AGGGAGATGTTTGAAGACTTGCTTCCGTATAGAAATGATGTACGATGCCCTGCCAGAGGC 210 TA2041_85681-AGGGAGATGTTTGAAGACTTGCTTCCGTATAGAAATGATGTACGATGCCCTGCCAGAGGC TA6704_85681-TTCTACACTTATGATGCTTTTATAGAGGCAGCCAAAGCTTTTCCAGCCTTTGGTAACTCT 270 TA2041_85681-TTCTACACTTATGATGCTTTTATAGAGGCAGCCAAAGCTTTTCCAGCCTTTGGTAACTCT TA6704_85681-GGAAATGAAACCATGCGTACAAGAGAAATTGCTGCCTTTTTTGCCCAAACTGGCCATGAA 330 TA2041_85681-GGAAATGAAACCATGCGTACAAGAGAAATTGCTGCCTTTTTTGCCCAAACTGGCCATGAA TA6704_85681-ACTACTGGTTTGTTTCAATTCCTGATCAGCTTAATTAAATTTAAAGATTCCTTTTTCCGG 390

TA2041_85681-ACTACTGGT-----------------------------------TA6704_85681-TGCACTAACAAGTAATGTTCAAGTATTAAATTATAAATAAACAGCATCACCCAATCTCCA TA2041_85681-------------------------------------------------------------

450

TA6704_85681-ATCGGTATTTTAATTTGTTACTAATCAATTTTTGTGGTTAATAAACTTACAGGGGGATGG 510 TA2041_85681----------------------------------------------------GGGGGATGG

TA6704_85681-CGCGATGCACCTGGTGGAGAATATGCTTGGGGATATTGCTTTATAAGCGAAATTAGCCCT 570 TA2041_85681-CGCGATGCACCTGGTGGAGAATATGCTTGGGGATATTGCTTTATAAGCGAAATTAGCCCT TA6704_85681-CCGTCCCCCTACTGTAATCTTAACTATCCATGTCGAGGGAAGTACTATGGCCGAGGTCCA 630 TA2041_85681-CCGTCCCCCTACTGTAATCTTAACTATCCATGTCGAGGGAAGTACTATGGCCGAGGTCCA Fig. 2. Matching between the 320 bp (between underlined primers) and the 180 bp sequence: an additional sequence of 162 bp from 339 to 501 (in bold) was present in the larger fragment. Accession codes of TIGR database sequences (TA6704 85681 and TA2041 85681) showing 100% homology with the 320 bp and 180 bp sequences, respectively, are indicated. The additional sequence is delimitated by canonical splicing couple border nucleotides GT–GG (in boldface, large font).

R. Del Carratore et al. / Journal of Plant Physiology 168 (2011) 952–959

A

B

955

TA2041_85681

atgaggcttattgcgtccttactagttttctctctagttttatctttcgtactaggaggc M R L I A S L L V F S L V L S F V L G G tcagcacggaattgtggaagcggcgttgtgtgcggtgaacgtgataccggccacgggacg S A R N C G S G V V C G E R D T G H G T gatggcggtgaactgggcaagatcatctcaagggagatgtttgaagacttgcttccgtat D G G E L G K I I S R E M F E D L L P Y agaaatgatgtacgatgccctgccagaggcttctacacttatgatgcttttatagaggca R N D V R C P A R G F Y T Y D A F I E A gccaaagcttttccagcctttggtaactctggaaatgaaaccatgcgtacaagagaaatt A K A F P A F G N S G N E T M R T R E I gctgccttttttgcccaaactggccatgaaactactgggggatggcgcgatgcacctggt A A F F A Q T G H E T T G G W R D A P G ggagaatatgcttggggatattgctttataagcgaaattagccctccgtccccctactgt G E Y A W G Y C F I S E I S P P S P Y C aatcttaactatccatgtcgagggaagtactatggccgaggtccaattcaactcacttgg N L N Y P C R G K Y Y G R G P I Q L T W aattacaattacttacggtgcggagaagacctagggctaggagaggagttgttgaacaat N Y N Y L R C G E D L G L G E E L L N N ccagaccttcttgctactgatccagtactatcattcaagtcagcaatctggttctggatg P D L L A T D P V L S F K S A I W F W M accgcacagccaccaaagccatcatgccacgaagtcattaccgacgaatggaaaccatca T A Q P P K P S C H E V I T D E W K P S gcaaatgacgtaaacgccggccggcttccgggatacggtctaaccacaaatataatcaac A N D V N A G R L P G Y G L T T N I I N ggtggaattgaatgtggccaaggttggaatgacgctgtacgtaaccgtattgggttcttt G G I E C G Q G W N D A V R N R I G F F agcactttctgtggcaagtttgggattcagcctggttacaatcttgattgctaccaccaa S T F C G K F G I Q P G Y N L D C Y H Q Cagccttttggccttattctgatggcacgatctatgtgatcatcatgatcaacgttttag Q P F G L I L M A R S M Stop

TA6704_85681

atgaggcttattgcgtccttactagttttctctctagttttatctttcgtactaggaggc M R L I A S L L V F S L V L S F V L G G tcagcacggaattgtggaagcggcgttgtgtgcggtgaacgtgataccggccacgggacg S A R N C G S G V V C G E R D T G H G T gatggcggtgaactgggcaagatcatctcaagggagatgtttgaagacttgcttccgtat D G G E L G K I I S R E M F E D L L P Y agaaatgatgtacgatgccctgccagaggcttctacacttatgatgcttttatagaggca R N D V R C P A R G F Y T Y D A F I E A gccaaagcttttccagcctttggtaactctggaaatgaaaccatgcgtacaagagaaatt A K A F P A F G N S G N E T M R T R E I gctgccttttttgcccaaactggccatgaaactactggtttgtttcaattcctgatcagc A A F F A Q T G H E T T G L F Q F L I S ttaattaaatttaaagattcctttttccggtgcactaacaagtaatgttcaagtattaaa L I K F K D S F F R C T N K Stop

Fig. 3. Predicted protein sequence of the 180 bp fragment (A) and 320 bp fragment (B). Experimental sequences are marked in boldface; identification peptides are underlined.

homogenized using a pestle and mortar in 200 ␮l of 100 mM sodium acetate buffer solution pH 5.0 containing 0.1% PVP and 0.5% CHAPS at 4 ◦ C for 30 min. The homogenates were centrifuged (12,000 × g for 30 min at 4 ◦ C), and protein concentration in supernatants was determined by the Bradford method. Aliquots containing 40 ␮g of citrus leaf proteins was mixed with nonreducing sample buffer (final concentration 50 mM Tris–HCl, pH 6.8, 1% sodium dodecylsulfate). The samples were loaded on 10% gel containing 0.01% glycol chitin and subjected to electrophoresis at 15 mA/gel. After electrophoresis, gels were washed twice with 10 mM pH 5.0 acetate buffer containing 25% isopropanol for 10 min. Gels were then washed for 15 min with 10 mM acetate buffer pH 5.0 and transferred into fresh acetate buffer at 37 ◦ C for 2 h for enzymatic reaction. After incubation gels were transferred into staining solution containing 0.01% Calcofluor (F3543-Sigma–Aldrich, Italy) in 500 mM Tris–HCl, pH 8.9 for 5 min. After washing in MilliQ water, reaction products were visualized with a UV lamp (dark bands on fluorescent background) indicating the position of chitinase enzyme.

Results Expression of chitinase gene In a recent study on C. clementina leaves challenged with T. urticae or MeJA, bidimensional polyacrilamide gel electrophoresis (2-DE) and liquid chromatography analysis coupled to mass spectrometry (LC–MS/MS) identified two differentially expressed proteins of 23 kDa and 33 kDa, respectively (Maserti et al., 2011). The identification peptide, REMFEDLLPYRN, allowed the characterization of the two proteins as acidic chitinase class II (UniProtKB accession no. Q8H985). The presence of two different molecular weight forms of the same protein prompted us to further analyze the expression of the two chitinase forms, at both the RNA and protein levels, in order to understand underlying mechanisms. Fig. 1 shows enlargements of the chitinase spots differentially expressed after T. urticae infestation (Fig. 1A), and MeJA treatment (Fig. 1B). Relative intensities of the two chitinase isoform signals were quantified as shown in the corresponding histograms. To investigate

956

R. Del Carratore et al. / Journal of Plant Physiology 168 (2011) 952–959

chitinase gene expression, RT-PCR analysis was carried out. Primer pair Fw1 and Rev1, designed to specifically match the acidic chitinase cDNA deduced from the identification peptide sequence (as described in Materials and methods) was used (Fig. 1C). A single cDNA band of 180 bp was amplified from C. clementina leaves collected at time 0 before T. urticae infestation (0 h), while two different cDNA bands of 180 and 320 bp, respectively, were evidenced 24 h after pathogen attack. Constitutively expressed elongation factor was used as internal control. Differential expression evidenced after treatments suggested a role for acidic chitinase in response to arthropod attack. Transcript analysis Both 320 bp and 180 bp bands were extracted from gel, purified and sequenced. Matching the two sequences together, the 320 bp fragment (between underlined primers) showed an additional 162 bp sequence (from nucleotide 339 to 501, in bold) as compared to the 180 bp fragment, with a perfect match shown throughout the sequence in common (Fig. 2). The two sequences revealed 100% homology with TA6704 85681 (320 bp) and TA2041 85681 (180 bp) (Fig. 2). Accession numbers were derived from TIGR GenBank (http://blast.jcvi.org/euk-blast/plantta blast.cgi). The hypothesis of alternatively spliced transcripts was considered. cDNA sequence analysis revealed the presence of the canonical couple border nucleotides GT–GG (Fig. 2, in bold-large font), which are recognized by the splisosomal machinery as corresponding to intron initiation and termination sites (Reddy, 2007). To measure the size of the intronic sequence, genomic DNA was amplified by PCR using the same pair of primers (Fw1 and Rev1), with the entire Citrus genomic chitinase sequence still unavailable in the BAC database (Terol et al., 2008). The genomic fragment obtained showed the same 320 bp size as the cDNA band (Fig. 1C) and its sequencing confirmed the homology with cDNA. Primers Fw2 and Rev2, designed in a different region of the chitinase gene (between 643 and 825 nucleotides) were used. Only one fragment was amplified, allowing us to exclude the interference of some other conserved chitinase genes. An additional longer cDNA region was amplified between nucleotides 229 and 1148 (primers Fw3 and Rev3), confirming the presence of the two different size fragments (data not shown). Both longer TA6704 85681 and shorter TA2041 85681 nucleotide sequences were translated into proteins. The shorter transcript produced a full length 33 kDa protein (Fig. 3A), while the longer intron retaining transcript generated a truncated protein of 135 amino acids (16 kDa) due to the presence of a premature TAA stop codon (Fig. 3B). Experimental sequences are marked in boldface The predicted molecular mass of the full length chitinase

Fig. 4. Dose–effect experiments and time course of acidic chitinase expression by RT-PCR. (A) RT-PCR at 24 h after treatment with increasing concentrations of MeJA (from 5 to 100 ␮M). Densitometric values (320D and 180D) are indicated. (B) RTPCR products monitored at 2, 6, 24, 48 and 72 h after 100 ␮M MeJA application. Constitutively expressed elongation factor was amplified as an internal control.

was consistent with the 2-DE position, namely 33 kDa, while the predicted MW of the truncated chitinase was 16 kDa, smaller than the 23 kDa 2-DE corresponding position. Effect of MeJA treatment A dose–effect experiment was performed to verify a relationship between chitinase expression and MeJA concentration (Fig. 4A). MeJA concentrations from 5 to 100 ␮M were used and leaves collected at 24 h after treatment. A dose–effect dependent increase of the 320 bp band was found as indicated by densitometric values (320D) reported in Fig. 4A. As the MeJA pathway is triggered by T. urticae attack (Howe and Jander, 2008), we carried out a time-course experiment on acidic chitinase expression after 100 ␮M MeJA treatment at both the transcript and protein levels. RT-PCR products (Fig. 4B) and 2DE pattern (Fig. 5) were monitored at 2, 6, 24, 48 and 72 h after MeJA application. The 320 bp fragment was already detectable 2 h after treatment and it progressively increased until 48 h. Interestingly, an inverse relationship between the intensity of the lower and the upper band was observed. A positive correlation between time-course expression at the transcript and protein levels was also found.

Fig. 5. Time course of acidic chitinase expression. Enlargements of representative 2-DE spots at 0, 2, 6, 24, 48 or 72 h after 100 ␮M MeJA treatment. Relative spot intensities expressed in parts per million are reported in histograms; standard deviation (error bars) is shown.

R. Del Carratore et al. / Journal of Plant Physiology 168 (2011) 952–959

957

Fig. 6. Time course of acidic chitinase activity at 0, 2, 6, 24 h after 100 ␮M MeJA treatment. The two main fluorescent signals at 33 and 23 kDa are shown. Gel is representative of at least three independent experiments. Values of activity are reported in histograms; standard deviation (error bars) is shown.

Fig. 7. Effects of different elicitors on acidic chitinase expression. RT-PCR analysis of mRNA from control leaves (C), leaves treated with salicylic acid (SA), MeJA, wounding, and Tetranychus urticae (T. ur). Constitutively expressed elongation factor was amplified as an internal control.

Chitinase activity One of the main roles for intron retention, and for alternative splicing in general, seems to be the production of multiple functional truncated isoforms of a protein (Ali and Reddy, 2008). In order to verify whether the truncated chitinase induced by MeJA still maintained its enzymatic activity, an activity assay was performed on semi-native gel. Two main fluorescent signals were detectable at 33 kDa and 23 kDa (Fig. 6, left panel). The 33 kDa signal, present in all samples, was probably produced by the constitutive acidic chitinase. The 23 kDa signal, strongly induced by MeJA treatment and absent in the control, was indicative of chitinase activity possibly derived by a shorter protein. Activity values determined by densitometry of the fluorescent signals are reported in the histogram (Fig. 6). Effect of other elicitors To investigate the specificity of the observed alternative splicing event, we tested the effect of different elicitor classes such as salicylic acid and wounding, on the acidic chitinase RNA expression. As shown in Fig. 7, the 320 bp fragment was specifically induced by T. urticae infestation and by MeJA treatment. Discussion Acidic chitinases are a group of important defense-related proteins in plants. In the present study, we showed that both T. urticae attack and MeJA treatment induced the expression of two chitinase proteins in C. clementina leaves, and possible underlying regulating mechanisms were investigated. The presence of two different sized mRNA fragments, amplified by RT-PCR using the same pair of primers, was evidenced both after T. urticae infestation and after MeJA treatment. Remarkably, the alignment of the transcripts revealed perfect matching between the two sequences, with the greater molecular weight sequence containing an addi-

tional 162 bp fragment (Fig. 2), thus leading to the hypothesis of a differential splicing event. Alternative splicing has been extensively studied in mammalian systems, but its use in plants systems is still in its infancy (Kim et al., 2007; Filichkin et al., 2010), although it appears to be important for gene expression regulation at the post-transcriptional level as in mammals and it contributes to proteome complexity (Ali and Reddy, 2008). Environmental conditions can also modulate the splicing pattern of specific genes (Simpson et al., 2008). Large-scale computational analyses and experimental approaches focused on selected genes have been revealing that alternative splicing constitutes an integral part of gene regulation in the stress response (Ali and Reddy, 2008). In plants, a substantial fraction (∼30%) of genes is alternatively spliced. Further, stress conditions, such as exposure to cold, heavy metals, and anaerobiosis, were shown to affect efficiency and/or patterns of splicing (Simpson et al., 2008). Intron retention is one of the most ancestral mechanisms of alternative splicing and it is very common in plants (Ner-Gaon et al., 2004), where virtually all introns contain the typical conserved GU–GG couple border nucleotides (Reddy, 2007). In our experimental system, both genomic and cDNA analysis revealed GT and GG nucleotide couples at 5 and 3 boundaries, respectively, within the internal additional sequence of the bigger transcript, strongly suggesting the presence of a retained intron (intron 1). The majority of alternative splicing events reported in plants have not been functionally characterized to date. Intron-retaining transcripts generally seem to encode for truncated peptides with specific functions, different from the corresponding full length proteins (Gassmann, 2008). A great number of stress responsive genes display specific alternative splicing, suggesting a role in stress response for those rapidly obtained isoforms (Palusa et al., 2007; Tanabe et al., 2007). However, mechanisms triggering stressinduced splicing are largely unknown. In our study, cDNA sequence translation showed that the alternatively spliced acidic chitinase transcript contained a premature stop codon, and the resulting protein was 158 amino acids shorter than the full length protein. Very few examples of truncated chitinase have been reported thus far. Examples include a study in Bombyx mori, where a putative chitinase gene was found to encode a 22 amino acid shorter isoform of the protein (Babiker et al., 2002). Moreover, a recent paper reported that the first 137 N-terminal amino acids were sufficient for retaining chitinase activity in Vibrio parahaemolyticus (Chuang and Lin, 2007). The deletion of the 304 C-terminal amino acid residues of AcD1ChiA, by removing the presumably entire chitinbinding region of Q815-N865 residues, did not significantly affect chitinase enzymatic properties against soluble and insoluble substrates (Lin et al., 2009). Furthermore, a series of deletions in the C-terminal region of Aeromonas caviae, V. parahaemolyticus and Bacillus licheniformis chitinases either increased enzyme activity

958

R. Del Carratore et al. / Journal of Plant Physiology 168 (2011) 952–959

or only negligibly affected the enzymatic properties of the corresponding full-length protein (Lin et al., 2009; Chuang et al., 2008). The gene expression regulation mechanism of MeJA through alternative splicing is largely unknown. Fung et al. (2006) reported that treatment of tomatoes with MeJA increased resistance to cold, causing inhibition of the oxidase splicing with production of an aberrant non-functional transcript. MeJA has been reported to play a role in the activation of defense mechanisms after insect and arthropod attack in several plant species as well as during growth and development (Bari and Jones, 2009; Howe and Jander, 2008). To investigate the functional role of the truncated chitinase isoform, we tested enzymatic activity in C. clementina leaf protein extracts by non-reducing polyacrilamide gel separation. Our results show that at least two bands (33 kDa and 23 kDa, respectively) of chitinase activity were present, with the activity of the 23 kDa protein starting very early and strongly inducible during the 24 h time course after MeJA treatment. This finding is in line with data regarding pathogen-induced defense-oriented reprogramming of the transcriptome (Thompson and Goggin, 2006). Alternative splicing could be recruited by plant organisms as an election mechanism to produce multiple chitinase forms as a defense-induced mechanism, and the shorter transcript that we found might be a rapid way for the cells to respond to damage. The inconsistency of the predicted molecular mass of the truncated protein (16 kDa instead of 23 kDa) might be explained by the presence of post-translational modifications (PTM). In particular, PTM sumoylation that is involved in various cellular processes, such as nuclear-cytosolic transport, transcriptional regulation, apoptosis, protein stability, response to stress, and progression through the cell cycle (Hay, 2005) could justify the difference in molecular weight. Using dedicated sumoplot prediction software (http://www.abgent.com/tools/sumoplot), we noted that the truncated chitinase contained an AKAF motif, which could be a possible sumoylation target. Further investigation will be required to confirm this hypothesis. To clarify the specificity of the intron retention event, we tested whether other types of stress or different elicitors were able to induce the truncated chitinase isoform. In general, MeJAmediated signaling pathways are implicated in the regulation of anti-herbivore defense, while the salicylic acid pathway is associated with defense responses against pathogens. However, a recent work suggested that interactions between the MeJA and salicylic acid pathways may play important roles in fine-tuning defense responses (Smith et al., 2009). In our experiments, alternatively spliced chitinase seemed to be specifically induced by MeJA and not triggered by salicylic acid. Moreover, as wounding effects on gene expression are generally transduced by MeJA-dependent pathways, we expected the truncated chitinase to also be induced by wounding. However, no alternative spliced chitinase was observed after mechanical wounding (Fig. 7), suggesting the presence of a different signal transduction pathway specifically regulated by other plant hormones as shown by Bove et al. (2008). This study is the first evidence of an active truncated acidic chitinase in C. clementina and it demonstrates that the spliced variant is specifically induced by MeJA in a wounding or salicylic acid-independent manner. Alternative splicing appears to generate transcriptome/proteome complexity that is likely to be important for stress adaptation. This work contributes to clarification of the possible function(s) of variant transcripts/protein isoforms and the potential roles that those factors could play during plant stress. In addition, the presence of the dual-band pattern for chitinase cDNA by RT-PCR may represent a suitable predictive marker for early diagnosis of plant biotic stress. At present, it seems that more than one functional chitinase is activated by arthropod attack and the dual-band pattern we found by RT-PCR analysis may be a predictive and suitable marker for

plant infestation. Plants devote considerable resources in response to stress by reprogramming their gene expression profile. The functional relevance of most alternatively spliced gene isoforms in disease resistance remains unknown, and assessing the role of alternative splicing in agronomically important traits should be a priority in the near future. Acknowledgments Work at IBF, and UNISS-INBB was carried out with financial support from the Provincia di Livorno (Italy) with Mis 3.1 –PIC INTERREG IIIA – Italia – Francia – Isole 2000/2006, research program CITRUS: Citrus as a model system for the Mediterranean area (study on varieties resistant to biotic and abiotic stresses). 2-DE protein separation analyses were performed at CNR-IBF; LC–MS/MS protein analyses were performed at Proteomique Platform (INRA, Montpellier). The PhD fellowship for A. Podda was provided by the Master & Back program (Regione Sardegna). We would like to thank Antonio Pratelli for support in plant maintenance. We thank Dr. Mike Minks and Dr. Edi Cecchini for critical review of the paper. References Ali GS, Reddy ASN. Regulation of alternative splicing of pre-mRNAs by stresses. Curr Top Microbiol Immunol 2008;326:257–75. Babiker MA, Banat A, Koga D. Alternative splicing of the primary transcript generates heterogeneity within the products of the gene for Bombyx mori chitinase. J Biol Chem 2002;277:30524–34. Bari R, Jones JDG. Role of plant hormones in plant defense responses. Plant Mol Biol 2009;69:473–88. Bove J, Cha YK, Gibson CA, Assmann SM. Characterization of wound-responsive RNA-binding proteins and their splice variants in Arabidopsis. Plant Mol Biol 2008;67:71–88. Chuang HH, Lin FP. New role of C-terminal 30 amino acids on the insoluble chitin hydrolysis in actively engineered chitinase from Vibrio parahaemolyticus. Appl Microbiol Biotechnol 2007;76:123–33. Chuang HH, Lin HY, Lin FP. Biochemical characteristics of C-terminal region of recombinant chitinase from Bacillus licheniformis implication of necessity for enzyme properties. FEBS J 2008;275:2240–54. Distefano G, La Malfa S, Vitale A, Lorito M, Deng Z, Gentile A. Defence-related gene expression in transgenic lemon plants producing an antimicrobial Trichoderma harzianum endochitinase during fungal infection. Transgenic Res 2008;17:873–9. Filichkin SA, Priest HD, Givan SA, Shen R, Bryant DW, Fox SE, et al. Genomewide mapping of alternative splicing in Arabidopsis thaliana. Genome Res 2010;20:45–58. Fung RW, Wang CY, Smith DL, Gross KC, Tao Y, Tian M. Characterization of alternative oxidase (AOX) gene expression in response to methyl salicylate and methyl jasmonate pre-treatment and low temperature in tomatoes. J Plant Physiol 2006;163:1049–60. Gassmann W. Alternative splicing in plant defense. Curr Top Microbiol Immunol 2008;326:219–33. Gomi K, Itoh N, Yamamoto H, Akimitsu K. Characterization and functional analysis of class I and II acidic chitinase cDNA from rough lemon. J Gen Plant Pathol 2002;68:191–9. Hay RT. Sumo: a history of modification. Mol Cell 2005;18:1–12. Howe GA, Jander G. Plant immunity to insect herbivores. Annu Rev Plant Biol 2008;59:41–66. Kant MR, Ament K, Sabelis MW, Haring MA, Schuurink RC. Differential timing of spider-mite direct and indirect defenses in tomato plants. Plant Physiol 2004;135:483–95. Kim E, Magen A, Ast G. Different levels of alternative splicing among eukaryotes. Nucleic Acids Res 2007;35:125–31. Lin FP, Chuang HH, Liu YH, Hsieh CY, Lin PW, Lin HY. Effects of C-terminal amino acids truncation on enzyme properties of Aeromonas caviae D1 chitinase. Arch Microbiol 2009;191:265–73. Maserti BE, Della Croce CM, Luro F, Morillon R, Cini M, Caltavuturo L. A general method for the extraction of citrus leaf proteins and separation by 2D electrophoresis: a follow up. J Chromatogr B 2007;849:351–6. Maserti BE, Del Carratore R, Della Croce CM, Podda A, Migheli Q, Froelicher Y, et al. Comparative analysis of proteome changes induced by the two spotted spider mite Tetranychus urticae and methyljasmonate in citrus leaves. J Plant Physiol 2011;168:392–402. Neuhoff V, Arold N, Taube D, Ehrhardt W. Improved staining of proteins in polyacrylamide gels including isoelectric focusing gels with clear background at nanogram sensitivity using Coomassie Brilliant Blue G-250 and R-250. Electrophoresis 1988;9:255–62.

R. Del Carratore et al. / Journal of Plant Physiology 168 (2011) 952–959 Ner-Gaon H, Halachmi R, Savaldi-Goldstein S, Rubin E, Ophir R, Fluhr R. Intron retention is a major phenomenon in alternative splicing in Arabidopsis. Plant J 2004;39:877–85. Palusa SG, Ali GS, Reddy AS. Alternative splicing of pre-mRNAs of Arabidopsis serine/arginine-rich proteins: regulation by hormones and stresses. Plant J 2007;9:1091–107. Rakwal R, Yang G, Komatsu S. Chitinase induced by jasmonic acid, methyl jasmonate, ethylene and protein phosphatase inhibitors in rice. Mol Biol Rep 2004;31:113–9. Reddy ASN. Alternative splicing of pre-messenger RNAs in plants in the genomic era. Annu Rev Plant Biol 2007;58:267–94. Simpson CG, Lewandowska D, Fuller J, Maronova M, Kalyna M, Davidson D, et al. Alternative splicing in plants. Biochem Soc Trans 2008;36:508–10. Smith JL, De Moraes CM, Mescher MC. Jasmonate- and salicylate-mediated plant defense responses to insect herbivores, pathogens and parasitic plants. Pest Manag Sci 2009;65:497–503. Tanabe N, Yoshimura K, Kimura A, Yabuta Y, Shigeoka S. Differential expression of alternatively spliced mRNAs of Arabidopsis SR protein homologs,

959

atSR30 and atSR45a, in response to environmental stress. Plant Cell Physiol 2007;48:1036–49. Takenaka Y, Nakano S, Tamoi M, Sakuda S, Fukamizo T. Chitinase gene expression in response to environmental stresses in Arabidopsis thaliana: chitinase inhibitor allosamidin stress tolerance. Biosci Biotechnol Biochem 2009;73:1066–71. Terol J, Conesa A, Colmenero JM, Cercos M, Tadeo F, Agustì J, et al. Analysis of 13000 unique Citrus clusters associated with fruit quality, production and salinity tolerance. BMC Genomics 2007;25:8–31. Terol J, Naranjo MA, Ollitrault P, Talon M. Development of genomic resources for Citrus clementina: characterization of three deep-coverage BAC libraries and analysis of 46,000 BAC end sequences. BMC Genomics 2008;18:9–423. Thompson GA, Goggin FL. Transcriptomics and functional genomics of plant defense induction by phloem-feeding insects. J Exp Bot 2006;57:755–66. Trudel J, Asselin A. Detection of chitinase activity after gel electrophoresis. Anal Biochem 1989;178:362–6. Van Loon LC, Rep M, Pieterse CMJ. Significance of inducible defense-related proteins in infected plants. Annu Rev Phytopathol 2006;44:132–62.