- Email: [email protected]
A theoretical model for the intercistronic region
J. theor. Biol. (1972) 36, 147-151
A Theoretical Model for the Intercistronic Region L. FRONTALI AND G.MOWPURGO
Centro degli Acidi Nucleici &I C.N.R., Istituto di Fisiologia Generale, Una’versith di Roma and Istituto Superiore di Sanitri, Roma, Italy (Received 5 April 1971, and in revisedform 4 August 1971) Punctuation in polycistronic messages is very probably not restricted to a single nonsense triplet. In the present paper a simple theoretical model is proposed of an intercistronic region (having the length of 15 bases) which would protect the cell against the damage resulting from any suppressor or frameshift mutation. The model is discussed with reference to the experimental data reported in recent literature and to the possible experimental approach to test its validity.
Results recently obtained by Rechler & Martin (1970) in a mutant (his D 2352) of Salmonella typhimurium in which histidinol dehydrogenase has an extra amino acid as a result of a frameshift mutation near the -COOH terminal, have allowed the authors to demonstrate the existence in bacteria of an intercistronic region [different from that found in phage R17 (Steitz, 1969; Nichols, 1970)] beyond the chain terminating triplet. This result is very interesting, not only for the very good explanation provided by the authors of the effect of this mutation, but also in relation to the general problem of chain termination in polycistronic messages. It has often been suggested that the ochre triplet UAA is more probably involved in chain termination than other nonsense triplets: suppressors of UAA often have a low efficiency while suppressors of UAG (amber) and UGA (topaze) triplets are much more efficient (Smith, Abelson, Clark, Godman & Brenner, 1966; Gallucci 8z Garen, 1966; Garen, 1968). Therefore, in cells carrying suppressor mutations only UAA could act as a chain termination signal without severely damaging the cell. However, several lines of reasoning indicate that punctuation in polycistronic messages cannot be due to a single nonsense triplet; the necessity of a longer signal is suggested by the following considerations.
148
L. FRONTAL1
AND
G. MORPURGO
(i) If UAA alone was the chain termination signal, the lack of chain termination in ochre suppressor mutants would damage the cell more than it actually does. E. Sommerville (quoted by Salser, Fluck & Epstein, 1969) actually isolated a strain carrying a strong ochre suppressor mutation and having a normal growth rate. (ii) If only one nonsense triplet acted as a chain termination signal, a frameshift mutation in the last portion of a cistron would produce an alteration of the reading frame beyond the signal and would have a definite probability of producing a nonsense triplet in the first part of the following cistron. This would generally cause complete inactivation of the cistron immediately adjacent on the operator distal side and strong polarity in the following cistrons.7 This does not seem to be the case, as Martin, Silbert, Smith & Whitfield (1966) show that polarity is higher at the beginning than at the end of a cistron, and Rechler & Martin fmd that their mutant, though highly polar, still produces 2 ‘A of normal protein. (iii)
As far as this inactivation is concerned, a frameshift mutation due to a base insertion or deletion at the end of the first cistron should be corrected by a mutation of opposite sign at the beginning of the following cistron. This correction would be effective, as far as the enzymic activity is concerned, only if the resulting double protein retained the enzymic activity. Interaction between frameshift mutations in adjacent genes has been reported in the case of a deletion mutant of T4 in which the deletion involved the last portion of the A gene and the first portion of the B gene in the R II region, thus fusing the two cistrons (Crick, Barnett, Brenner & WattsTobin, 1961; Champe & Benzer, 1962). More recently Rechler & Bruni (1971) and Yourno, Kohno & Roth (1970) have demonstrated in two different mutants of S. typhimurium a double protein deriving from the fusion of the D and C genes of the histidine operon and retaining both enzyme activities. However, the genetic interpretation of these data is not clearcut. In the case reported by Rechler & Bruni (1971), the only interpretation compatible with the results obtained by Rechler & Martin (1970) in that the same mutant his D 2352 is actually the induction of a second frameshift of opposite sign between the original termination codon and the new one which induces termination in his D 2352 mutant. This
t In some cases re-initiation fragment (Newton, 1969).
within the cistron can occur, thus producing
a protein
THEORETICAL
MODEL
FOR
INTERCISTRONIC
REGION
149
second frameshift would abolish the new chain terminator and reestablish the normal reading frame in the following cistron. In the case reported by Yourno, Kobno & Roth (1970) the most probable explanation seems to be the following: after the first mutation (a deletion of a number of nucleotides different from three) a new terminator arises within the intercistronic region as in the preceding case. In fact, the analysis of the tryptic peptides of the D protein does not show the appearance of new peptides in this mutant as should happen if the new terminator was in the C gene. The second mutation leading to the fusion of the two proteins should be a new frameshift in the intercistronic space or a deletion eliminating the latter and hence the newly formed terminator. The above considerations suggest therefore that the chain-terminating signal should have the following two characteristics : (1) it should contain at least two different nonsense triplets in order to protect the cell against the effect of suppressor mutations [see point (i)]; and (2) it should have such a sequence that every base insertion or deletion in the operator proximal cistron (i.e. every shift of the reading frame in the intercistronic region) should always give a nonsense triplet [see points (ii) and (iii)]. This new nonsense triplet would act as a “barrier” against the effect of frameshift mutations and would therefore protect the cell against the effects of extension of “out of frame” reading beyond the chain terminator. The simplest model which would meet all these conditions is the following: AG . . . UAAXUGAXUGAXUGA.... AA
AG AA
In this model UAA is proposed as the fist chain-terminating triplet for the reasons summarized above; this view is further supported by the fact that both release factors recognize UAA; however, the existence of two release factors, each recognizing another triplet besides UAA (Scolmck, Tompkins, Caskey & Niremberg, 1968) suggests that the other two nonsenses should have a function in chain termination. A second nonsense, different from the Grst one and in phase with it, should be present to protect the cell against suppressor mutations, and is presented in this model at the end of the sequence, but could be adjacent to the first one. Taking into account the fact that suppressors of ochre also suppress amber, this second triplet should be UGA, otherwise a single suppressor mutation
150
L.
FRONTAL1
AND
G.
MORPURGO
would abolish the termination signal. The initiating triplet AUG should follow the proposed intercistronic region and should be properly exposed for the initiation of translation by the conformation of the adjacent region. This could be the reason of the strong polarity found by Rechler & Martin (1970) for cistron B in his D 2352 mutant in which the intercistronic region is strongly altered. In the above model X is any of the four bases but could be a group of n bases if n, the same for every X, is a positive integer different from three or multiples of three. In the sequence reported by Rechler & Martin (1970) n would be two. An intercistronic region of this kind would prevent damage to the cell consequent to the extension of the alteration of the reading frame beyond the chain termination signal. In fact any insertion or deletion would produce a new nonsense triplet as it actually happens in the case reported by Rechler & Martin (1970). Chain termination would be lacking (and fusion of the proteins would ensue) only when a second frameshift arises within the intercistronic region. As an example, we can imagine the COOH terminal of a hypothetical protein and of its messenger RNA as follows : intercistronic region I UCCCCAGUGGCCAAG UAAUUGACUGAUUGA I I I I I I II ser pro val ala Iys terminator t
AUG. start
The deletion of the base indicated by the upper arrow would give UCCCAGUGGCCAAGUAAUUGACUGAUUUGAAUG. IILII.1
ser
glu
trp
pro
ser
new terminator
asn
start
A base addition in the point indicated by the lower arrow would produce UCCCCAUGUGGCCAAGUAAUUGAC L
I
ser
I
pro
I
cys
I
gly
I
glu
UGAUUGA I
val
In both cases the frameshift mutation
I
ile
II
asp
new terminator
AUG.
I
start
only affects the gene in which the muta-
THEORETICAL
MODEL
FOR
INTERCISTRONIC
151
REGION
tion has occurred and a protein with one to three extra amino acids is produced. The following gene is not altered but its translation can be impaired by the altered, out-of-phase, position of AUG. In phage R17 (Steitz, 1969; Nichols, 1970) the intercistronic region, containing two nonsense triplets, only seems to protect the phage from any suppressor present in host cells and not against frameshift mutations. A possible experimental approach to test the existence of the proposed intercistronic region in bacteria could be the following : a frameshift mutation at the end of a cistron should extend to the following cistron in the presence of a given suppressor: the consequent alteration of the reading frame in the second cistron should result in an inactivation whose level would depend on the efficiency of the suppressor. Analogously a frameshift at the end of the first cistron should be corrected by a frameshift of opposite sign at the beginning of the following cistron in the presence of an amber, ochre or topaze suppressor. Moreover, a cell carrying an ochre (or amber) and a topaze suppressor mutation should have a strongly impaired viability, since chain-termination signals would be lacking.
CHAMPI?, S. & BENZER, S. CRICK, F. C. H., BARNJXT,
REFERENCES (1962). J. molec. Bill. 4, 288. L., BRE~R,
S. & WATIS-TOBIN,
R. J. (1961).
Nature,
Lomf.
192,1227. GALLIJCCI, E. & GAREN, A. (1966). J. molec. Biof. 15, 193. GAREN, A. (1968). Science, N. Y. 160,49. MARTIN, R. G., SILBERT, D. F., Smm, D. W. E. & WHITFIELD,
H. J., Jr. (1966).
J. molec.
Biol. 21, 357. J. L. (1970). Nature, Lmd. 225, 147. A. (1969). J. molec. Biol. 41, 329. RECHLER, M. M. & BRUNI, C. B. (1971). J. biof. Chem. 246, 1806. RE~HLER, M. M. & MARTIN, R. G. (1970). Nature, Lmd. 226, 908. SALSER, W., FLUCK, M. & EPSTEIN, R. (1969). Cold Spring Harb. Symp. quant. Biol. 34,520. SCOLNICK, E., TOMPKINS, R., CASKBY, T. & NIREMBBRG, M. (1968). Proc. mtn. Acud. Sci. NICHOLS, NEWTON,
U.S.A. 61, 768. SMITH, J. D., ABELSON, G. N., CLARK, B. F. C., GODMAN, H. M. & BRENNER, Cold Spring Harb. Symp. quant. Biol. 31,479. STRITZ, J. A. (1969). Nature, Lmd. 224, 957. YOURNO, J., KOHNO, T. 8c ROTH, J. R. (1970). Nature, Loud. 228, 820.
S. (195%.
A Theoretical Model for the Intercistronic Region L. FRONTALI AND G.MOWPURGO
Centro degli Acidi Nucleici &I C.N.R., Istituto di Fisiologia Generale, Una’versith di Roma and Istituto Superiore di Sanitri, Roma, Italy (Received 5 April 1971, and in revisedform 4 August 1971) Punctuation in polycistronic messages is very probably not restricted to a single nonsense triplet. In the present paper a simple theoretical model is proposed of an intercistronic region (having the length of 15 bases) which would protect the cell against the damage resulting from any suppressor or frameshift mutation. The model is discussed with reference to the experimental data reported in recent literature and to the possible experimental approach to test its validity.
Results recently obtained by Rechler & Martin (1970) in a mutant (his D 2352) of Salmonella typhimurium in which histidinol dehydrogenase has an extra amino acid as a result of a frameshift mutation near the -COOH terminal, have allowed the authors to demonstrate the existence in bacteria of an intercistronic region [different from that found in phage R17 (Steitz, 1969; Nichols, 1970)] beyond the chain terminating triplet. This result is very interesting, not only for the very good explanation provided by the authors of the effect of this mutation, but also in relation to the general problem of chain termination in polycistronic messages. It has often been suggested that the ochre triplet UAA is more probably involved in chain termination than other nonsense triplets: suppressors of UAA often have a low efficiency while suppressors of UAG (amber) and UGA (topaze) triplets are much more efficient (Smith, Abelson, Clark, Godman & Brenner, 1966; Gallucci 8z Garen, 1966; Garen, 1968). Therefore, in cells carrying suppressor mutations only UAA could act as a chain termination signal without severely damaging the cell. However, several lines of reasoning indicate that punctuation in polycistronic messages cannot be due to a single nonsense triplet; the necessity of a longer signal is suggested by the following considerations.
148
L. FRONTAL1
AND
G. MORPURGO
(i) If UAA alone was the chain termination signal, the lack of chain termination in ochre suppressor mutants would damage the cell more than it actually does. E. Sommerville (quoted by Salser, Fluck & Epstein, 1969) actually isolated a strain carrying a strong ochre suppressor mutation and having a normal growth rate. (ii) If only one nonsense triplet acted as a chain termination signal, a frameshift mutation in the last portion of a cistron would produce an alteration of the reading frame beyond the signal and would have a definite probability of producing a nonsense triplet in the first part of the following cistron. This would generally cause complete inactivation of the cistron immediately adjacent on the operator distal side and strong polarity in the following cistrons.7 This does not seem to be the case, as Martin, Silbert, Smith & Whitfield (1966) show that polarity is higher at the beginning than at the end of a cistron, and Rechler & Martin fmd that their mutant, though highly polar, still produces 2 ‘A of normal protein. (iii)
As far as this inactivation is concerned, a frameshift mutation due to a base insertion or deletion at the end of the first cistron should be corrected by a mutation of opposite sign at the beginning of the following cistron. This correction would be effective, as far as the enzymic activity is concerned, only if the resulting double protein retained the enzymic activity. Interaction between frameshift mutations in adjacent genes has been reported in the case of a deletion mutant of T4 in which the deletion involved the last portion of the A gene and the first portion of the B gene in the R II region, thus fusing the two cistrons (Crick, Barnett, Brenner & WattsTobin, 1961; Champe & Benzer, 1962). More recently Rechler & Bruni (1971) and Yourno, Kohno & Roth (1970) have demonstrated in two different mutants of S. typhimurium a double protein deriving from the fusion of the D and C genes of the histidine operon and retaining both enzyme activities. However, the genetic interpretation of these data is not clearcut. In the case reported by Rechler & Bruni (1971), the only interpretation compatible with the results obtained by Rechler & Martin (1970) in that the same mutant his D 2352 is actually the induction of a second frameshift of opposite sign between the original termination codon and the new one which induces termination in his D 2352 mutant. This
t In some cases re-initiation fragment (Newton, 1969).
within the cistron can occur, thus producing
a protein
THEORETICAL
MODEL
FOR
INTERCISTRONIC
REGION
149
second frameshift would abolish the new chain terminator and reestablish the normal reading frame in the following cistron. In the case reported by Yourno, Kobno & Roth (1970) the most probable explanation seems to be the following: after the first mutation (a deletion of a number of nucleotides different from three) a new terminator arises within the intercistronic region as in the preceding case. In fact, the analysis of the tryptic peptides of the D protein does not show the appearance of new peptides in this mutant as should happen if the new terminator was in the C gene. The second mutation leading to the fusion of the two proteins should be a new frameshift in the intercistronic space or a deletion eliminating the latter and hence the newly formed terminator. The above considerations suggest therefore that the chain-terminating signal should have the following two characteristics : (1) it should contain at least two different nonsense triplets in order to protect the cell against the effect of suppressor mutations [see point (i)]; and (2) it should have such a sequence that every base insertion or deletion in the operator proximal cistron (i.e. every shift of the reading frame in the intercistronic region) should always give a nonsense triplet [see points (ii) and (iii)]. This new nonsense triplet would act as a “barrier” against the effect of frameshift mutations and would therefore protect the cell against the effects of extension of “out of frame” reading beyond the chain terminator. The simplest model which would meet all these conditions is the following: AG . . . UAAXUGAXUGAXUGA.... AA
AG AA
In this model UAA is proposed as the fist chain-terminating triplet for the reasons summarized above; this view is further supported by the fact that both release factors recognize UAA; however, the existence of two release factors, each recognizing another triplet besides UAA (Scolmck, Tompkins, Caskey & Niremberg, 1968) suggests that the other two nonsenses should have a function in chain termination. A second nonsense, different from the Grst one and in phase with it, should be present to protect the cell against suppressor mutations, and is presented in this model at the end of the sequence, but could be adjacent to the first one. Taking into account the fact that suppressors of ochre also suppress amber, this second triplet should be UGA, otherwise a single suppressor mutation
150
L.
FRONTAL1
AND
G.
MORPURGO
would abolish the termination signal. The initiating triplet AUG should follow the proposed intercistronic region and should be properly exposed for the initiation of translation by the conformation of the adjacent region. This could be the reason of the strong polarity found by Rechler & Martin (1970) for cistron B in his D 2352 mutant in which the intercistronic region is strongly altered. In the above model X is any of the four bases but could be a group of n bases if n, the same for every X, is a positive integer different from three or multiples of three. In the sequence reported by Rechler & Martin (1970) n would be two. An intercistronic region of this kind would prevent damage to the cell consequent to the extension of the alteration of the reading frame beyond the chain termination signal. In fact any insertion or deletion would produce a new nonsense triplet as it actually happens in the case reported by Rechler & Martin (1970). Chain termination would be lacking (and fusion of the proteins would ensue) only when a second frameshift arises within the intercistronic region. As an example, we can imagine the COOH terminal of a hypothetical protein and of its messenger RNA as follows : intercistronic region I UCCCCAGUGGCCAAG UAAUUGACUGAUUGA I I I I I I II ser pro val ala Iys terminator t
AUG. start
The deletion of the base indicated by the upper arrow would give UCCCAGUGGCCAAGUAAUUGACUGAUUUGAAUG. IILII.1
ser
glu
trp
pro
ser
new terminator
asn
start
A base addition in the point indicated by the lower arrow would produce UCCCCAUGUGGCCAAGUAAUUGAC L
I
ser
I
pro
I
cys
I
gly
I
glu
UGAUUGA I
val
In both cases the frameshift mutation
I
ile
II
asp
new terminator
AUG.
I
start
only affects the gene in which the muta-
THEORETICAL
MODEL
FOR
INTERCISTRONIC
151
REGION
tion has occurred and a protein with one to three extra amino acids is produced. The following gene is not altered but its translation can be impaired by the altered, out-of-phase, position of AUG. In phage R17 (Steitz, 1969; Nichols, 1970) the intercistronic region, containing two nonsense triplets, only seems to protect the phage from any suppressor present in host cells and not against frameshift mutations. A possible experimental approach to test the existence of the proposed intercistronic region in bacteria could be the following : a frameshift mutation at the end of a cistron should extend to the following cistron in the presence of a given suppressor: the consequent alteration of the reading frame in the second cistron should result in an inactivation whose level would depend on the efficiency of the suppressor. Analogously a frameshift at the end of the first cistron should be corrected by a frameshift of opposite sign at the beginning of the following cistron in the presence of an amber, ochre or topaze suppressor. Moreover, a cell carrying an ochre (or amber) and a topaze suppressor mutation should have a strongly impaired viability, since chain-termination signals would be lacking.
CHAMPI?, S. & BENZER, S. CRICK, F. C. H., BARNJXT,
REFERENCES (1962). J. molec. Bill. 4, 288. L., BRE~R,
S. & WATIS-TOBIN,
R. J. (1961).
Nature,
Lomf.
192,1227. GALLIJCCI, E. & GAREN, A. (1966). J. molec. Biof. 15, 193. GAREN, A. (1968). Science, N. Y. 160,49. MARTIN, R. G., SILBERT, D. F., Smm, D. W. E. & WHITFIELD,
H. J., Jr. (1966).
J. molec.
Biol. 21, 357. J. L. (1970). Nature, Lmd. 225, 147. A. (1969). J. molec. Biol. 41, 329. RECHLER, M. M. & BRUNI, C. B. (1971). J. biof. Chem. 246, 1806. RE~HLER, M. M. & MARTIN, R. G. (1970). Nature, Lmd. 226, 908. SALSER, W., FLUCK, M. & EPSTEIN, R. (1969). Cold Spring Harb. Symp. quant. Biol. 34,520. SCOLNICK, E., TOMPKINS, R., CASKBY, T. & NIREMBBRG, M. (1968). Proc. mtn. Acud. Sci. NICHOLS, NEWTON,
U.S.A. 61, 768. SMITH, J. D., ABELSON, G. N., CLARK, B. F. C., GODMAN, H. M. & BRENNER, Cold Spring Harb. Symp. quant. Biol. 31,479. STRITZ, J. A. (1969). Nature, Lmd. 224, 957. YOURNO, J., KOHNO, T. 8c ROTH, J. R. (1970). Nature, Loud. 228, 820.
S. (195%.