- Email: [email protected]
A TPR-family membrane protein gene is required for light-activated heterotrophic growth of the cyanobacterium Synechocystis sp. PCC 6803
FEMS Microbiology Letters 219 (2003) 75^79
www.fems-microbiology.org
A TPR-family membrane protein gene is required for light-activated heterotrophic growth of the cyanobacterium Synechocystis sp. PCC 6803 Renqiu Kong, Xudong Xu , Zhengyu Hu Institute of Hydrobiology, the Chinese Academy of Sciences, Wuhan, Hubei 430072, PR China Received 30 October 2002; received in revised form 4 December 2002; accepted 5 December 2002 First published online 16 January 2003
Abstract The unicellular cyanobacterium Synechocystis sp. PCC6803 can grow heterotrophically in complete darkness, given that a brief period of illumination is supplemented every day (light-activated heterotrophic growth, LAHG), or under very weak ( 6 0.5 Wmol m32 s31 ) but continuous light. By random insertion of the genome with an antibiotic resistance cassette, mutants defective in LAHG were generated. In two identical mutants, sll0886, a tetratricopeptide repeat (TPR)-family membrane protein gene, was disrupted. Targeted insertion of sll0886 and three downstream genes showed that the phenotype was not due to a polar effect. The sll0886 mutant shows normal photoheterotrophic growth when the light intensity is at 2.5 Wmol m32 s31 or above, but no growth at 0.5 Wmol m32 s31 . Homologs to sll0886 are also present in cyanobacteria that are not known of LAHG. sll0886 and homologs may be involved in controlling different physiological processes that respond to light of low fluence. 7 2003 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Light-activated heterotrophic growth; Tetratricopeptide repeat-family protein ; Gene; Synechocystis PCC6803
1. Introduction Cyanobacteria are a group of prokaryotic microbes that carry out plant-like oxygenic photosynthesis. For the study of certain physiological processes in plants, a unicellular cyanobacterium Synechocystis sp. PCC 6803 (Synechocystis 6803) is widely used as a model species. Like higher plants, some processes of this strain are regulated in response to very weak light. Cells of Synechocystis 6803 move towards visible light and away from UV light on plates. For a positive phototactic response, the intensity of white stimulant light could be as low as 0.002 Wmol m32 s31 [1]. A phytochrome-like photoreceptor and CheA/ CheY-type signal transduction system are required for the phototactic movements [2,3]. Synechocystis 6803 is incapable of chemoheterotrophic growth on glucose under conditions without any light [4]. Using a glucose-tolerant variant, Anderson and McIntosh [5] found that Synechocystis 6803 grew heterotrophically in darkness when sup-
* Corresponding author. Fax: +86 (27) 87875132. E-mail address : [email protected] (X. Xu).
plemented with a short period light pulse every day and that the intensity of the light pulse could be 0.5 Wmol m32 s31 . The light-activated heterotrophic growth (LAHG) was only responsive to blue light with maximal sensitivity at 450 nm and not reversible by red light, which is similar to a blue-light response in plants. The physiological basis for the LAHG is largely unknown. Apparently, the LAHG includes at least two basic biological processes, light-sensing/signal transduction and heterotrophic growth. A phytochrome-like gene, plpA, was found to be necessary to autotrophic growth in blue-light, but no information on its e¡ect on LAHG was documented [6]. A photolyase-like protein in Synechocystis 6803, presumptively a bacterial cryptochrome, could be an alternative blue-light photoreceptor in the light-sensing process [7]. To analyze the light-sensing/signal transduction pathway, we employed a random insertion method to isolate mutants that are defective in LAHG but unchanged in photoheterotrophic growth. In this report, we present genetic evidence that a tetratricopeptide repeat (TPR)-family membrane protein is required for the LAHG of Synechocystis 6803. TPR motif is a degenerate conserved sequence of 34 amino acid residues and known
0378-1097 / 03 / $22.00 7 2003 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. doi:10.1016/S0378-1097(02)01205-3
FEMSLE 10824 6-2-03
76
R. Kong et al. / FEMS Microbiology Letters 219 (2003) 75^79
for its role in protein interactions [8,9]. Proteins of TPR family could be involved in variable biological processes, such as organelle targeting [10], protein complex formation [11] and signal transduction [12]. In human, the TPR protein 1, Tpr1, and the protein serine/threonine phosphatase 5 that contains the TPR motif speci¢cally interact with a blue-light photoreceptor hCRY2 [13].
2. Materials and methods 2.1. Culture conditions for the cyanobacterium Synechocystis 6803 was from J. Zhao of Peking University. The cyanobacterium was grown in BG11 medium in 50-ml £asks in the light (V50 Wmol m32 s31 ) at 28V30‡C without shaking. To the media for culture of C.K2-containing strains, kanamycin was added to 10 Wg ml31 . Tests of autotrophic growth of the mutants were done under light of V20 Wmol m32 s31 . For photoheterotrophic growth, the strains were cultured in BG11 with 5 mM glucose and 5 WM DCMU (Sigma) under continuous illumination of 8 Wmol m32 s31 or as described in the text. For LAHG, the culture was exposed to light of 5 Wmol m32 s31 for 5 min per day and kept otherwise in darkness. 2.2. DNA manipulations Genes to be interrupted were ampli¢ed by polymerase chain reactions using the primers listed in Table 1. The PCR products were puri¢ed with a glass milk kit (MBI Fermentas, Canada), restricted with EcoRI and cloned into pRL500 [14]. Polymerase chain reactions consisted of initial denaturation at 94‡C for 5 min and 30 cycles of: 94‡C for 1 min, 60‡C for 1 min, 72‡C for 1 min and a ¢nal extension at 72‡C for 4 min. The kanamycin-resistance cassette C.K2 was excised from pRL446 [14] with PvuII. Before insertion of C.K2 into ClaI, HindIII sites of sll0888 and sll0178 respectively, the cohesive-ends were ¢rst blunted with T4 DNA polymerase (Promega). Because there are two ClaI sites on the PCR fragment containing sll0888, insertion of sll0888 was facilitated by partial digestion of the plasmid. 2.3. Generation of cyanobacterial mutants Synechocystis 6803 was transformed with plasmids carrying certain genes interrupted by C.K2 or a mixture of plasmids of a random-insertion library following the procedure for transformation described by William JGK [15]. Transformants or preliminarily identi¢ed mutants were repeatedly streaked on plates and cultured in liquid medium with kanamycin under photoheterotrophic conditions. Targeted gene disruptions were con¢rmed by PCR using the primers listed in Table 1. Locations of C.K2 in the genomes of randomly generated mutants were determined
by cloning EcoRI fragments containing the interrupted regions, sequencing from the ends of C.K2 using oligos 5P-TTGAGACACAACGTGGCT-3P and 5P-ACTGGCAGAGCATTACGCTG-3P and searching the CyanoBase (www.kazusa.or.jp/cyano/cyano.html). 2.4. Bioinformatics Transmembrane regions were detected using software packages SOSUI (sosui.proteome.bio.tuat.ac.jp/sosuiframe0.html), and Tmpred (http://www.ch.embnet.org/software/TMPRED_form.html). Similarity searches and identi¢cation of conserved domains were performed using NCBI (www.ncbi.nlm.nih.gov) BLAST programs.
3. Results and discussion 3.1. Selection of LAHG mutants by a random insertion method A gene library of Synechocystis 6803 was constructed by cloning 2 to 9-kb Sau3AI-cut chromosomal DNA fragments at the BamHI site of pUC19. The library consists of ca. 22 000 colonies and 70% of them contain inserts. Total plasmid DNA of the library was partially restricted with Sau3AI until the majority of the empty vector was cut once. On an electrophoretogram of total plasmid DNA, the empty vector band can be easily recognized and used as an indicator for controlling the partial digestion. The total plasmids linearized as so were ligated with C.K2, a kanamycin-resistance cassette, excised from pRL446 with BamHI and electroporated into Escherichia coli DH10B to construct a secondary random-insertion library for mutagenesis of Synechocystis 6803. Random insertion mutants of Synechocystis 6803 were generated by transformation with total plasmid DNA of the secondary library. Kanamycin-resistant transformants were tested on plates under mixotrophic and LAHG conditions respectively. Eight mutants defective in LAHG were selected. One of them was slow in autotrophic growth and defective in both LAHG and photoheterotrophic growth (type I), two of them showed normal autotrophic growth and slower photoheterotrophic growth (type II), while the rest were similar to wild-type in both autotrophic and
Table 1 A list of the PCR primers (5P s 3P) sll0886 sll0887 sll0888 sll0178
FEMSLE 10824 6-2-03
1. 2. 1. 2. 1. 2. 1. 2.
ttgaattcggaagaaccgtagatgtca cagaattcggtcggaagtcaagttcac acgaattcccactgccatgcactttag ttgaattcgtagatagccgttaccaaga ttgaattcgataatgaccctctaaccag acgaattcaacggtttgacggcgaag cagaattcgtgtcctcgctcaggtaaca acgaattctcacttcttctgagtccaac
R. Kong et al. / FEMS Microbiology Letters 219 (2003) 75^79
77
Fig. 1. Growth of mutants under di¡erent conditions. (I) targeted gene disruptions with C.K2 cassette ; (II) growth under autotrophic conditions ; (III) growth under photoheterotrophic conditions ; (IV) growth under LAHG conditions. All data presented are the means of three independent culture measurements.
photoheterotrophic growth (type III). By DNA sequencing and search of the Cyanobase, two mutants of type III were found to be identical and disrupted in sll0886. The choromosomal DNA of the two mutants was extracted and used to transform the wild-type PCC6803. After repeated streaking on plates and transfer in liquid medium, the transformants showed the same phenotype as the original mutants. 3.2. Targeted gene disruptions Downstream of sll0886 are three open reading frames whose expression may be a¡ected in the sll0886 mutants. To make sure that the phenotype of LAHG minus was not due to a polar e¡ect, targeted interruptions were generated for each of the ORFs. C.K2, a kanamycin-resistance cassette was inserted at the SmaI site of sll0886, SmaI site of sll0887, ClaI site of sll0888, and HindIII site of sll0178 respectively in cloned PCR fragments and transformed into the cyanobacterium by homologous recombinations (Fig. 1). PCR detections showed that all the mutants were completely segregated after repeated streaking (Fig. 2).
sll0887 : :C.K2, sll0888 : :C.K2 and sll0178: : C.K2 grew as the wild-type. These results indicate that sll0886 but not any of its downstream genes is required for LAHG. In the CyanoBase, M. Babykin reported that interruption of sll0886 at BamHI site with a kanamycin-resistance marker led to loss of viability of Synechocystis 6803, but did not describe how the mutant was grown. Because the heterotrophic growth of Synechocystis 6803 can also be undergone under weak but continuous light, we further tested the photoheterotrophic growth at lower light intensity. In the light of 2.5 Wmol m32 s31 , starting from 0.015 T 0.010
1
2
3
4
5
6
7
8
23.13 9.42 6.56 4.36 2.32 2.03
3.3. Growth characters of the mutants The mutants were tested for growth under di¡erent conditions. Because kanamycin was supplemented to the media, a pKW1188-transformed strain of Synechocystis 6803 was used as the wild-type control. This strain is similar to the original Synechocystis 6803 in growth characters. As shown in Fig. 1, all the strains showed normal autotrophic and photoheterotrophic growth. The mutant sll0886 : : C.K2 was unable to grow under LAHG conditions, while
0.56 ( kb ) Fig. 2. PCR detections of targeted gene disruptions. The primers used are listed in Table 1. Lane 1, sll0886: :C.K2 ; lane 2, sll0886; lane 3, sll0887: :C.K2 ; lane 4, sll0887; lane 5, sll0888: :C.K2 ; lane 6, sll0888; lane 7, sll0178: :C.K2 ; lane 8, sll0178.
FEMSLE 10824 6-2-03
78
R. Kong et al. / FEMS Microbiology Letters 219 (2003) 75^79
Table 2 Homologs of sll0886 in cyanobacterial strains Strains
PCC7120
ATCC29133
WH8102
MIT9313
IMS101
ORFs E-value
all2893 6e-98
Npun-p-1721 4e-97
Synwh-p-130 2e-54
Pmit-p-258 2e-53
Tery-p-3547 8e-84
In each of the strains, only one with the highest similarity is shown.
(OD730 , turbidity of the culture), wild-type and sll0886: :CK2 grew up to 0.990 T 0.092 and 1.103 T 0.067 respectively in 10 days; at 0.5 Wmol m32 s31 , wild-type grew up to 0.694 T 0.060, while sll0886: :CK2 showed virtually no growth (OD730 0.053 T 0.036 on the 10th day). Apparently, the growth of sll0886 mutant on glucose is strictly dependent on the availability of certain amount of light. Because sll0886 mutants showed growth similar to wild-type on glucose in presence of DCMU, this gene is not directly required for import or metabolism of the sugar or cell division, but is for connection of the light stimulation with growth on glucose. 3.4. sll0886 and homologs encode membrane proteins with TPR motif structure The LAHG gene sll0886 is predicted to encode a membrane protein with three copies of TPR motifs. According to the Cyano2Dbase (proteome project of Synechocystis 6803 in CyanoBase), Sll0886 appears in the thylakoid membrane fraction. It would be interesting to know whether this protein also appears in the cytoplasmic membrane fraction and which protein(s) it interacts with. In our knowledge, the only example that a TPR family protein may be involved in signal transduction for blue light photoreceptor is in human [13]. Although we need more evidence to show that Sll0886 is directly involved as a component in the signal transduction pathway for LAHG, its e¡ect on the regulation of heterotrophic growth of Synechocystis 6803 is unambiguous. Homologs of sll0886 were found in three ¢lamentous cyanobacteria, Anabaena (or Nostoc) sp. PCC7120, Nostoc punctiforme ATCC29133, Trichodesmium erythraeum IMS101, and two unicellular cyanobacteria, Synechococcus sp. WH8102 and Prochlorococcus marinus MIT9313, but not in a thermophilic species Thermosynechococcus elongatus BP-1 (Table 2). Unlike Synechocystis 6803, the other species are either not known of heterotrophic growth or heterotrophic without requirement of light stimulation. It is possible that the homologs in these species play a role in connecting light stimulation to processes other than heterotrophic growth. Even in Synechocystis 6803, it is not known whether heterotrophic growth is the only process that requires stimulation of dim blue light. The e¡ects of light of low £uence (very weak but continuous light or complete darkness with daily short pulse of light) on other cyanobacterial species and the possible role of homologs
of sll0886 in the relevant processes merit further investigations.
Acknowledgements This work was supported by the One-Hundred-Talents Project of the Chinese Academy of Sciences.
References [1] Choi, J.S., Chung, Y.H., Moon, Y.J., Kim, C., Watanabe, M., Song, P.S., Joe, C.O., Bogorad, L. and Park, Y.M. (1999) Photomovement of the gliding cyanobacterium Synechocystis sp. PCC 6803. Photochem. Photobiol. 70, 95^102. [2] Yoshihara, S., Suzuki, F., Fujita, H., Geng, X.X. and Ikeuchi, M. (2000) Novel putative photoreceptor and regulatory genes required for the positive phototactic movement of the unicellular motile cyanobacterium Synechocystis sp. PCC 6803. Plant Cell Physiol. 41, 1299^1304. [3] Bhaya, D., Takahashi, A. and Grossman, A.R. (2001) Light regulation of type IV pilus-dependent motility by chemosensor-like elements in Synechocystis PCC6803. Proc. Natl. Acad. Sci. USA 98, 7540^7545. [4] Rippka, R. (1972) Photoheterotrophy and chemoheterotrophy among unicellular blue-green algae. Arch. Microbiol. 87, 93^98. [5] Anderson, S.L. and McIntosh, L. (1991) Light-activated heterotrophic growth of the cyanobacterim Synechocystis sp. strain PCC 6803 a blue-light-requiring process. J. Bacteriol. 173, 2761^2767. [6] Wilde, A., Churin, Y., Schubert, H. and Borner, T. (1997) Disruption of a Synechocystis sp. PCC 6803 gene with partial similarity to phytochrome genes alters growth under changing light qualities. FEBS Lett. 406, 89^92. [7] Hitomi, K., Okamoto, K., Daiyasu, H., Miyashita, H., Iwai, S., Toh, H., Ishiura, M. and Todo, T. (2000) Bacterial cryptochrome and photolyase: characterization of two photolyase-like genes of Synechocystis sp. PCC. Nucleic Acids Res. 28, 2353^2362. [8] Goebl, M. and Yanagida, M. (1991) The TPR snap helix: a novel protein repeat motif from mitosis to transcription. Trends Biochem. Sci. 16, 173^177. [9] Das, A.K., Cohen, P.W. and Barford, D. (1998) The structure of the tetratricopeptide repeats of protein phosphatase 5: implications for TPR-mediated protein-protein interactions. EMBO J. 17, 1192^1199. [10] Wimmer, C., Schmid, M., Veenhuis, M. and Gietl, C. (1998) The plant PTS1 receptor : similarities and di¡erences to its human and yeast counterparts. Plant J. 16, 453^464. [11] Lapouge, K., Smith, S.J., Walker, P.A., Gamblin, S.J., Smerdon, S.J. and Rittinger, K. (2000) Structure of the TPR domain of p67phox in complex with Rac. GTP. Mol. Cell 6, 899^907. [12] Ma, Q. and Whitlock, J.P.Jr. (1997) A novel cytoplasmic protein that interacts with the Ah receptor, contains tetratricopeptide repeat motifs, and augments the transcriptional response to 2,3,7,8-tetrachlorodibenzo-p-dioxin. J. Biol. Chem. 272, 8878^8884.
FEMSLE 10824 6-2-03
R. Kong et al. / FEMS Microbiology Letters 219 (2003) 75^79 [13] Zhao, S. and Sancar, A. (1997) Human blue-light photoreceptor hCRY2 speci¢cally interacts with protein serine/threonine phosphatase 5 and modulates its activity. Photochem. Photobiol. 66, 727^ 731. [14] Elhai, J. and Wolk, C.P. (1988) A versatile class of positive-selection
79
vectors based on the nonviability of palindrome-containing plasmids that allows the cloning into long polylinkers. Gene 68, 119^138. [15] Williams, J.G.K. (1988) Construction of speci¢c mutations in photosystem II photosynthetic reaction center by genetic engineering methods in Synechocystis 6803. Methods Enzymol. 167, 766^778.
FEMSLE 10824 6-2-03
www.fems-microbiology.org
A TPR-family membrane protein gene is required for light-activated heterotrophic growth of the cyanobacterium Synechocystis sp. PCC 6803 Renqiu Kong, Xudong Xu , Zhengyu Hu Institute of Hydrobiology, the Chinese Academy of Sciences, Wuhan, Hubei 430072, PR China Received 30 October 2002; received in revised form 4 December 2002; accepted 5 December 2002 First published online 16 January 2003
Abstract The unicellular cyanobacterium Synechocystis sp. PCC6803 can grow heterotrophically in complete darkness, given that a brief period of illumination is supplemented every day (light-activated heterotrophic growth, LAHG), or under very weak ( 6 0.5 Wmol m32 s31 ) but continuous light. By random insertion of the genome with an antibiotic resistance cassette, mutants defective in LAHG were generated. In two identical mutants, sll0886, a tetratricopeptide repeat (TPR)-family membrane protein gene, was disrupted. Targeted insertion of sll0886 and three downstream genes showed that the phenotype was not due to a polar effect. The sll0886 mutant shows normal photoheterotrophic growth when the light intensity is at 2.5 Wmol m32 s31 or above, but no growth at 0.5 Wmol m32 s31 . Homologs to sll0886 are also present in cyanobacteria that are not known of LAHG. sll0886 and homologs may be involved in controlling different physiological processes that respond to light of low fluence. 7 2003 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Light-activated heterotrophic growth; Tetratricopeptide repeat-family protein ; Gene; Synechocystis PCC6803
1. Introduction Cyanobacteria are a group of prokaryotic microbes that carry out plant-like oxygenic photosynthesis. For the study of certain physiological processes in plants, a unicellular cyanobacterium Synechocystis sp. PCC 6803 (Synechocystis 6803) is widely used as a model species. Like higher plants, some processes of this strain are regulated in response to very weak light. Cells of Synechocystis 6803 move towards visible light and away from UV light on plates. For a positive phototactic response, the intensity of white stimulant light could be as low as 0.002 Wmol m32 s31 [1]. A phytochrome-like photoreceptor and CheA/ CheY-type signal transduction system are required for the phototactic movements [2,3]. Synechocystis 6803 is incapable of chemoheterotrophic growth on glucose under conditions without any light [4]. Using a glucose-tolerant variant, Anderson and McIntosh [5] found that Synechocystis 6803 grew heterotrophically in darkness when sup-
* Corresponding author. Fax: +86 (27) 87875132. E-mail address : [email protected] (X. Xu).
plemented with a short period light pulse every day and that the intensity of the light pulse could be 0.5 Wmol m32 s31 . The light-activated heterotrophic growth (LAHG) was only responsive to blue light with maximal sensitivity at 450 nm and not reversible by red light, which is similar to a blue-light response in plants. The physiological basis for the LAHG is largely unknown. Apparently, the LAHG includes at least two basic biological processes, light-sensing/signal transduction and heterotrophic growth. A phytochrome-like gene, plpA, was found to be necessary to autotrophic growth in blue-light, but no information on its e¡ect on LAHG was documented [6]. A photolyase-like protein in Synechocystis 6803, presumptively a bacterial cryptochrome, could be an alternative blue-light photoreceptor in the light-sensing process [7]. To analyze the light-sensing/signal transduction pathway, we employed a random insertion method to isolate mutants that are defective in LAHG but unchanged in photoheterotrophic growth. In this report, we present genetic evidence that a tetratricopeptide repeat (TPR)-family membrane protein is required for the LAHG of Synechocystis 6803. TPR motif is a degenerate conserved sequence of 34 amino acid residues and known
0378-1097 / 03 / $22.00 7 2003 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. doi:10.1016/S0378-1097(02)01205-3
FEMSLE 10824 6-2-03
76
R. Kong et al. / FEMS Microbiology Letters 219 (2003) 75^79
for its role in protein interactions [8,9]. Proteins of TPR family could be involved in variable biological processes, such as organelle targeting [10], protein complex formation [11] and signal transduction [12]. In human, the TPR protein 1, Tpr1, and the protein serine/threonine phosphatase 5 that contains the TPR motif speci¢cally interact with a blue-light photoreceptor hCRY2 [13].
2. Materials and methods 2.1. Culture conditions for the cyanobacterium Synechocystis 6803 was from J. Zhao of Peking University. The cyanobacterium was grown in BG11 medium in 50-ml £asks in the light (V50 Wmol m32 s31 ) at 28V30‡C without shaking. To the media for culture of C.K2-containing strains, kanamycin was added to 10 Wg ml31 . Tests of autotrophic growth of the mutants were done under light of V20 Wmol m32 s31 . For photoheterotrophic growth, the strains were cultured in BG11 with 5 mM glucose and 5 WM DCMU (Sigma) under continuous illumination of 8 Wmol m32 s31 or as described in the text. For LAHG, the culture was exposed to light of 5 Wmol m32 s31 for 5 min per day and kept otherwise in darkness. 2.2. DNA manipulations Genes to be interrupted were ampli¢ed by polymerase chain reactions using the primers listed in Table 1. The PCR products were puri¢ed with a glass milk kit (MBI Fermentas, Canada), restricted with EcoRI and cloned into pRL500 [14]. Polymerase chain reactions consisted of initial denaturation at 94‡C for 5 min and 30 cycles of: 94‡C for 1 min, 60‡C for 1 min, 72‡C for 1 min and a ¢nal extension at 72‡C for 4 min. The kanamycin-resistance cassette C.K2 was excised from pRL446 [14] with PvuII. Before insertion of C.K2 into ClaI, HindIII sites of sll0888 and sll0178 respectively, the cohesive-ends were ¢rst blunted with T4 DNA polymerase (Promega). Because there are two ClaI sites on the PCR fragment containing sll0888, insertion of sll0888 was facilitated by partial digestion of the plasmid. 2.3. Generation of cyanobacterial mutants Synechocystis 6803 was transformed with plasmids carrying certain genes interrupted by C.K2 or a mixture of plasmids of a random-insertion library following the procedure for transformation described by William JGK [15]. Transformants or preliminarily identi¢ed mutants were repeatedly streaked on plates and cultured in liquid medium with kanamycin under photoheterotrophic conditions. Targeted gene disruptions were con¢rmed by PCR using the primers listed in Table 1. Locations of C.K2 in the genomes of randomly generated mutants were determined
by cloning EcoRI fragments containing the interrupted regions, sequencing from the ends of C.K2 using oligos 5P-TTGAGACACAACGTGGCT-3P and 5P-ACTGGCAGAGCATTACGCTG-3P and searching the CyanoBase (www.kazusa.or.jp/cyano/cyano.html). 2.4. Bioinformatics Transmembrane regions were detected using software packages SOSUI (sosui.proteome.bio.tuat.ac.jp/sosuiframe0.html), and Tmpred (http://www.ch.embnet.org/software/TMPRED_form.html). Similarity searches and identi¢cation of conserved domains were performed using NCBI (www.ncbi.nlm.nih.gov) BLAST programs.
3. Results and discussion 3.1. Selection of LAHG mutants by a random insertion method A gene library of Synechocystis 6803 was constructed by cloning 2 to 9-kb Sau3AI-cut chromosomal DNA fragments at the BamHI site of pUC19. The library consists of ca. 22 000 colonies and 70% of them contain inserts. Total plasmid DNA of the library was partially restricted with Sau3AI until the majority of the empty vector was cut once. On an electrophoretogram of total plasmid DNA, the empty vector band can be easily recognized and used as an indicator for controlling the partial digestion. The total plasmids linearized as so were ligated with C.K2, a kanamycin-resistance cassette, excised from pRL446 with BamHI and electroporated into Escherichia coli DH10B to construct a secondary random-insertion library for mutagenesis of Synechocystis 6803. Random insertion mutants of Synechocystis 6803 were generated by transformation with total plasmid DNA of the secondary library. Kanamycin-resistant transformants were tested on plates under mixotrophic and LAHG conditions respectively. Eight mutants defective in LAHG were selected. One of them was slow in autotrophic growth and defective in both LAHG and photoheterotrophic growth (type I), two of them showed normal autotrophic growth and slower photoheterotrophic growth (type II), while the rest were similar to wild-type in both autotrophic and
Table 1 A list of the PCR primers (5P s 3P) sll0886 sll0887 sll0888 sll0178
FEMSLE 10824 6-2-03
1. 2. 1. 2. 1. 2. 1. 2.
ttgaattcggaagaaccgtagatgtca cagaattcggtcggaagtcaagttcac acgaattcccactgccatgcactttag ttgaattcgtagatagccgttaccaaga ttgaattcgataatgaccctctaaccag acgaattcaacggtttgacggcgaag cagaattcgtgtcctcgctcaggtaaca acgaattctcacttcttctgagtccaac
R. Kong et al. / FEMS Microbiology Letters 219 (2003) 75^79
77
Fig. 1. Growth of mutants under di¡erent conditions. (I) targeted gene disruptions with C.K2 cassette ; (II) growth under autotrophic conditions ; (III) growth under photoheterotrophic conditions ; (IV) growth under LAHG conditions. All data presented are the means of three independent culture measurements.
photoheterotrophic growth (type III). By DNA sequencing and search of the Cyanobase, two mutants of type III were found to be identical and disrupted in sll0886. The choromosomal DNA of the two mutants was extracted and used to transform the wild-type PCC6803. After repeated streaking on plates and transfer in liquid medium, the transformants showed the same phenotype as the original mutants. 3.2. Targeted gene disruptions Downstream of sll0886 are three open reading frames whose expression may be a¡ected in the sll0886 mutants. To make sure that the phenotype of LAHG minus was not due to a polar e¡ect, targeted interruptions were generated for each of the ORFs. C.K2, a kanamycin-resistance cassette was inserted at the SmaI site of sll0886, SmaI site of sll0887, ClaI site of sll0888, and HindIII site of sll0178 respectively in cloned PCR fragments and transformed into the cyanobacterium by homologous recombinations (Fig. 1). PCR detections showed that all the mutants were completely segregated after repeated streaking (Fig. 2).
sll0887 : :C.K2, sll0888 : :C.K2 and sll0178: : C.K2 grew as the wild-type. These results indicate that sll0886 but not any of its downstream genes is required for LAHG. In the CyanoBase, M. Babykin reported that interruption of sll0886 at BamHI site with a kanamycin-resistance marker led to loss of viability of Synechocystis 6803, but did not describe how the mutant was grown. Because the heterotrophic growth of Synechocystis 6803 can also be undergone under weak but continuous light, we further tested the photoheterotrophic growth at lower light intensity. In the light of 2.5 Wmol m32 s31 , starting from 0.015 T 0.010
1
2
3
4
5
6
7
8
23.13 9.42 6.56 4.36 2.32 2.03
3.3. Growth characters of the mutants The mutants were tested for growth under di¡erent conditions. Because kanamycin was supplemented to the media, a pKW1188-transformed strain of Synechocystis 6803 was used as the wild-type control. This strain is similar to the original Synechocystis 6803 in growth characters. As shown in Fig. 1, all the strains showed normal autotrophic and photoheterotrophic growth. The mutant sll0886 : : C.K2 was unable to grow under LAHG conditions, while
0.56 ( kb ) Fig. 2. PCR detections of targeted gene disruptions. The primers used are listed in Table 1. Lane 1, sll0886: :C.K2 ; lane 2, sll0886; lane 3, sll0887: :C.K2 ; lane 4, sll0887; lane 5, sll0888: :C.K2 ; lane 6, sll0888; lane 7, sll0178: :C.K2 ; lane 8, sll0178.
FEMSLE 10824 6-2-03
78
R. Kong et al. / FEMS Microbiology Letters 219 (2003) 75^79
Table 2 Homologs of sll0886 in cyanobacterial strains Strains
PCC7120
ATCC29133
WH8102
MIT9313
IMS101
ORFs E-value
all2893 6e-98
Npun-p-1721 4e-97
Synwh-p-130 2e-54
Pmit-p-258 2e-53
Tery-p-3547 8e-84
In each of the strains, only one with the highest similarity is shown.
(OD730 , turbidity of the culture), wild-type and sll0886: :CK2 grew up to 0.990 T 0.092 and 1.103 T 0.067 respectively in 10 days; at 0.5 Wmol m32 s31 , wild-type grew up to 0.694 T 0.060, while sll0886: :CK2 showed virtually no growth (OD730 0.053 T 0.036 on the 10th day). Apparently, the growth of sll0886 mutant on glucose is strictly dependent on the availability of certain amount of light. Because sll0886 mutants showed growth similar to wild-type on glucose in presence of DCMU, this gene is not directly required for import or metabolism of the sugar or cell division, but is for connection of the light stimulation with growth on glucose. 3.4. sll0886 and homologs encode membrane proteins with TPR motif structure The LAHG gene sll0886 is predicted to encode a membrane protein with three copies of TPR motifs. According to the Cyano2Dbase (proteome project of Synechocystis 6803 in CyanoBase), Sll0886 appears in the thylakoid membrane fraction. It would be interesting to know whether this protein also appears in the cytoplasmic membrane fraction and which protein(s) it interacts with. In our knowledge, the only example that a TPR family protein may be involved in signal transduction for blue light photoreceptor is in human [13]. Although we need more evidence to show that Sll0886 is directly involved as a component in the signal transduction pathway for LAHG, its e¡ect on the regulation of heterotrophic growth of Synechocystis 6803 is unambiguous. Homologs of sll0886 were found in three ¢lamentous cyanobacteria, Anabaena (or Nostoc) sp. PCC7120, Nostoc punctiforme ATCC29133, Trichodesmium erythraeum IMS101, and two unicellular cyanobacteria, Synechococcus sp. WH8102 and Prochlorococcus marinus MIT9313, but not in a thermophilic species Thermosynechococcus elongatus BP-1 (Table 2). Unlike Synechocystis 6803, the other species are either not known of heterotrophic growth or heterotrophic without requirement of light stimulation. It is possible that the homologs in these species play a role in connecting light stimulation to processes other than heterotrophic growth. Even in Synechocystis 6803, it is not known whether heterotrophic growth is the only process that requires stimulation of dim blue light. The e¡ects of light of low £uence (very weak but continuous light or complete darkness with daily short pulse of light) on other cyanobacterial species and the possible role of homologs
of sll0886 in the relevant processes merit further investigations.
Acknowledgements This work was supported by the One-Hundred-Talents Project of the Chinese Academy of Sciences.
References [1] Choi, J.S., Chung, Y.H., Moon, Y.J., Kim, C., Watanabe, M., Song, P.S., Joe, C.O., Bogorad, L. and Park, Y.M. (1999) Photomovement of the gliding cyanobacterium Synechocystis sp. PCC 6803. Photochem. Photobiol. 70, 95^102. [2] Yoshihara, S., Suzuki, F., Fujita, H., Geng, X.X. and Ikeuchi, M. (2000) Novel putative photoreceptor and regulatory genes required for the positive phototactic movement of the unicellular motile cyanobacterium Synechocystis sp. PCC 6803. Plant Cell Physiol. 41, 1299^1304. [3] Bhaya, D., Takahashi, A. and Grossman, A.R. (2001) Light regulation of type IV pilus-dependent motility by chemosensor-like elements in Synechocystis PCC6803. Proc. Natl. Acad. Sci. USA 98, 7540^7545. [4] Rippka, R. (1972) Photoheterotrophy and chemoheterotrophy among unicellular blue-green algae. Arch. Microbiol. 87, 93^98. [5] Anderson, S.L. and McIntosh, L. (1991) Light-activated heterotrophic growth of the cyanobacterim Synechocystis sp. strain PCC 6803 a blue-light-requiring process. J. Bacteriol. 173, 2761^2767. [6] Wilde, A., Churin, Y., Schubert, H. and Borner, T. (1997) Disruption of a Synechocystis sp. PCC 6803 gene with partial similarity to phytochrome genes alters growth under changing light qualities. FEBS Lett. 406, 89^92. [7] Hitomi, K., Okamoto, K., Daiyasu, H., Miyashita, H., Iwai, S., Toh, H., Ishiura, M. and Todo, T. (2000) Bacterial cryptochrome and photolyase: characterization of two photolyase-like genes of Synechocystis sp. PCC. Nucleic Acids Res. 28, 2353^2362. [8] Goebl, M. and Yanagida, M. (1991) The TPR snap helix: a novel protein repeat motif from mitosis to transcription. Trends Biochem. Sci. 16, 173^177. [9] Das, A.K., Cohen, P.W. and Barford, D. (1998) The structure of the tetratricopeptide repeats of protein phosphatase 5: implications for TPR-mediated protein-protein interactions. EMBO J. 17, 1192^1199. [10] Wimmer, C., Schmid, M., Veenhuis, M. and Gietl, C. (1998) The plant PTS1 receptor : similarities and di¡erences to its human and yeast counterparts. Plant J. 16, 453^464. [11] Lapouge, K., Smith, S.J., Walker, P.A., Gamblin, S.J., Smerdon, S.J. and Rittinger, K. (2000) Structure of the TPR domain of p67phox in complex with Rac. GTP. Mol. Cell 6, 899^907. [12] Ma, Q. and Whitlock, J.P.Jr. (1997) A novel cytoplasmic protein that interacts with the Ah receptor, contains tetratricopeptide repeat motifs, and augments the transcriptional response to 2,3,7,8-tetrachlorodibenzo-p-dioxin. J. Biol. Chem. 272, 8878^8884.
FEMSLE 10824 6-2-03
R. Kong et al. / FEMS Microbiology Letters 219 (2003) 75^79 [13] Zhao, S. and Sancar, A. (1997) Human blue-light photoreceptor hCRY2 speci¢cally interacts with protein serine/threonine phosphatase 5 and modulates its activity. Photochem. Photobiol. 66, 727^ 731. [14] Elhai, J. and Wolk, C.P. (1988) A versatile class of positive-selection
79
vectors based on the nonviability of palindrome-containing plasmids that allows the cloning into long polylinkers. Gene 68, 119^138. [15] Williams, J.G.K. (1988) Construction of speci¢c mutations in photosystem II photosynthetic reaction center by genetic engineering methods in Synechocystis 6803. Methods Enzymol. 167, 766^778.
FEMSLE 10824 6-2-03