- Email: [email protected]
A trans-spliced leader RNA sequence in plant parasitic nematodes
MOLECULAR AND
ELSEVIER
Molecular and BiochemicalParasitology 67 (1994) 147-155
BIOCHEMICAL PARASITOLOGY
A trans-spliced leader RNA sequence in plant parasitic nematodes Rebecca Stratford *, Robert Shields Plant Breeding International, Maris Lane, Trumpington, Cambridge, CB2 2LQ, UK Received 9 March 1994; accepted 15 June 1994
Abstract
A trans-spliced leader gene has been identified in the genomes of the potato cyst nematodes Globodera rostochiensis and G. pallida. The gene contains a 22-nt sequence identical to that of the leader sequence of Caenorhabditis elegans, a consensus splice donor site and a putative Sm antigen binding site. In common with other nematodes the spliced leader gene is present in tandem repeating units together with the 5S ribosomal RNA gene. Variation in the length of the intergenic spacer region has permitted the design of polymerase chain reaction primers which can be used to reveal repeat length variants diagnostic for G. rostochiensis and G. pallida and the Pal pathotype of G. pallida.
Keywords: Tandem repeat; 5S rRNA; Globodera spp.; Diagnostics; Polymerase chain reaction
1. Introduction
In nematodes, a subset of the mRNAs contain an identical 22-nt spliced leader (SL) sequence at the 5' end. This SL is donated from the 5' end of a small (approximately 100 nt) nonpolyadenylated transcript (SL RNA) through a trans-splicing reaction (for review see [1]). The organisation of genes encoding SL RNAs has been characterised in some detail in a number of nematodes. In Caenorhabditis elegans, the SL R N A gene together with the 5S rRNA gene is located in a 1-kilobase (kb) sequence that is tandemly repeated 100 times to form a large array on chromosome V
Note: Nucleotide sequence data reported in this paper have been submitted to the GenBank data base with the accession numbers L28954 (G. rostochiensis) and L28955 (G. pallida). Tel.: (0223) 840411; Fax: (0223) 844425. Elsevier Science B.V. SSDI 0165-0327(94)00123-5
[2]. SL R N A sequences are also reiterated in tandem within the 5S rRNA gene clusters of the filarial parasitic nematodes Brugia malayi, Onchocerca volvulus and Dirofilaria immitis and in the intestinal parasite Ascaris lumbricoides (3-5)i Unlike C. elegans the SL R N A sequence of these organisms is transcribed from the same strand as the 5S rRNA. Some of these nematodes also have perfect copies of the SL sequence that are unlinked to the 5S gene cluster, while in other nematodes such as Haemonchus contortus and Angiostrongylus cantonensis all the SL sequences appear unlinked to the 5S gene [6,7]. In C. elegans a second version (SL2) of the Spliced leader sequence has been shown to participate in trans-splicing of some genes. The 22-nt trans-spliced segment of SL2 differs from the canonical SL sequence in 6 of the 22 bases and the four copies of the SL2 R N A genes are not part of the 5S rRNA gene cluster. SL 2 R N A appears to participate in trans-splicing in the related nematode C. briggsae
148
R. Stratford,R. Shields/Molecular and BiochemicalParasitology67 (1994) 147-155
but not in the nematodes Panagrellus redivivus and H. contortus [8]. It appears therefore that trans-splicing is a common feature of nematodes and that SL rRNA is frequently (although not invariably) transcribed from within the reiterated 5S rRNA gene cluster. The plant parasitic nematodes Globodera rostochiensis and G. pallida are important pathogens of the potato crop. A number of pathotypes within each of the species has been distinguished on their ability to multiply on different accessions of wild potato. Some genes from these accessions that give resistance to particular pathotypes have been incorporated into commercial potato varieties. However, effective use of resistant cultivars and programmes of nematode control are dependent on reliable nematode identification. Identification of potato cyst nematode species is difficult and, moreover, identification of individual pathotypes within species is impossible using morphological characteristics alone. We have shown previously that a number of repetitive DNA sequences are present in long tandem arrays in the genomes of potato cyst nematodes. The different levels of amplification of such sequences can be used to differentiate between the two species and furthermore can distinguish the Pal pathotype of G. pallida from the P a 2 / 3 pathotype [9]. Here we show that both G. rostochiensis and G. pallida contain SL RNA genes in long tandem arrays within the 5S gene cluster, with a 22-nt SL mini-exon identical to that in all free living and animal parasitic nematodes analysed to date. Variation in the length of the intergenic sequence between the 5S and SL genes can be used to distinguish G. rostochiensis from G. pallida, and also the Pal pathotype of G. pallida.
buffer (100 mM Tris-HC1 pH 8 . 5 / 5 0 mM EDTA/200 mM NaCI) and 5 mg proteinase K was added. The mixture was incubated for 1 h at 50°C with occasional inversion after which it was centrifuged at 13000 × g for 5 min in a microfuge. CsCI 2 (1 g m1-1) was dissolved in the supernatant by gentle shaking at room temperature, followed by 50 /zl of ethidium bromide stock solution (10 mg m1-1) and the resulting solution centrifuged as before. The floating material was removed and the supernatant centrifuged overnight (223000 X g, 16 h, Sorvall TV865 vertical rotor). The banded DNA was recovered and the ethidium bromide removed by extraction with butanol saturated with 20 × SSC (1 X SSC is 150 mM NaC1, 15 mM trisodium citrate). Two volumes of water were added and the DNA precipitated with ethanol. At this stage the DNA was light tan in colour and difficult to cut with restriction enzymes. This problem was overcome by purification over a spin column of Sepharose CL-6B.
2. Materials and methods
DNA manipulation and isolation of SL RNA genes. The manipulation of DNA and the construction of plasmid genomic libraries from EcoRI digested DNA of G. pallida P a 2 / 3 and G. rostochiensis Rol have been described previously [9]. Colony lifts were hybridized overnight at room temperature in 6 X SSC, 1 × Denhardt's (0.02% Ficoll/0.02% B S A / 0.02% PVP 360) with a labelled oligonucleotide complementary to the SL mini-exon of animal parasitic and free living nematodes (SL primer: 5' CTCAAACITGGGTAATrAAACC 3'). The filters were washed at a final stringency of 6 x SSC at 36°C. One positive clone from each library was identified (G. rostochiensis; A3SL, G. paUida B5SL). For Southern blots each lane contained 250 ng of nematode DNA digested with various restriction enzymes. Southern blots were prepared essentially as described [9].
Cyst material and DNA extraction. Cysts of different populations of G. rostochiensis and G. pallida were from collections described previously [9]. DNA was extracted from dried cysts by a modification of a published method [10]. Approximately 300 mg of cysts and a pinch of sand were ground with a pestle and mortar under liquid nitrogen. The powder was transferred to a container to which 6 ml of extraction
Polymerase chain reaction. Oligonucleotide primers were designed to be complementary to the 5S rRNA sequence (5S primer) 5'CGCGGATCCTrACGACCATACCACG 3' (an introduced BamHI site is underlined) and the SL RNA sequence (SL primer). Polymerase chain reaction (PCR) mixes (25 /xl final volume) contained either 5-10 ng of DNA or 1 /~1 or 2 /xl of cyst homogenate (see below), 200 /xM of
R. Stratford, R. Shields / Moiecular and Biochemical Parasitology 67 (1994) 147-155
149
A3SL.
EcoRI g a a t t c g a c a a a t t a g a g a a s t t tt t t a c a t a c a t t c a a t t t t t g a g a a a a t t a t a c t t a g a g t t a t tcttgacaaattt tgtccaatatctgtttgatt ************* *** * * * * * * * * * * * * * * * * * * * * * * **** ********** ***************** **********
BSSL.
aaattcgacaaattggagcasttttttacatacattcaattattgataaaattatacagagagttattottgacaa
A3SL.
t g .a.g. .c. g. .t. g. .a. .c.c. .a. a. .t. g. .a. .g.a. .c. a. .a. a. .a. a. .g. .t.c. .a. c. .a. c. .a. .t.t. .t. g. .g t t g g c t t c c c t c a c t c c~t g c a t c~~ ~
B5SL.
--agcttg
100
........... t a t c t g t t t g - - -
5S RNA
A3SL.
G
BSSL.
@
.....
a ~
~ ~
~
!
~
200
agggacaaaaagtcacacatttggttggcttccctcactccagcatc~~~~ Q
~
~
~
~
~
a
t
. t . t . t. t. t. tt . . a.a .a t . t . t . t. t. aa .
~
~oo
~mcatttttt a-aaattttt aa
A3SL. BSSL.
..... tttctgaataggtatttatttttttgtttgttcaaaaaagatttgcactcgtttgat ................................... tat SLB-5
~
PLSL.
SwaI
taatttaaatttcgttatgagcgcgtgaatttctcttat BB-1
A3SL. BSSL.
======================= .........
PLSL.
ga~tcagcaat~tg~ttt~caaaa-tttcctcaaatctacacaattttgatatttttc~at~aa-taacatt~actccctc~ctttta~a~cattaaaa
::::::::::::::::::::::::::::::::::::::::
.......
:::::::::::::::::::::
A3SL.
aacaaatttcaataagtttgaacaaaaga *****************************
.........
gttocctgccgccccatta--ttgtttttggccaaa-tttgatggactgtaactttgcttag ***** * *********** ************** ******** ************* *
B5SL.
aacaaatttcaatssgtttgaacaaaaga ********* , ****************
.........
gttccttccogccccatta--ttgtttttggccaac-tttgatgggctgtaactttgctcaa
PLSL.
aacaaattttatt•agtttgaacaaaaggggttggttggtt•••tcccgccccatttttttgtttttgggcaaattttgaaagcctgtaactttgctc••
A3SL.
aatggcgagcgg•gcccgatttttgcatattcgta•tcag¢tcgacgaggggaat•gattgatataaaatttaggcgaatttgaga•agttg•aaaa•ac
*****
************
,*********
***
*****
575
, ****************
Clal
BSSL.
aatggtgag•gg•gc•cattttttg•atatt•gtact•agctcgatgaggggaat•gattgatataaaatttaggcgaatttgcgtatgtcgaaaa•aac
PLSL.
***************** *******4 eatggtgagcggcgcocgatttttgc
A3SL.
atgttttttCatttatat•gt-tatttttaatttattttaataaaaatttttgtatttttttatcCttcgaatttgcgtgttagtt•aaaatgcccttgt
BSSL.
atgttottcaatttatattggatatttttaatttattttattaataaagttttgttttcttttocctt-gaattcgc
A3SL.
tttt•attgt•agaactaaa•taaa•g•aaatct•aaaataaag¢cat•aaattg-t••at=attgaaaatgtga-aata•ga•gagaatgatgatgctc **** *** **** *************************** *** *************** *** ******** *********
BSSL.
tttt ........ gas ....... eeaatcaaatcccaaaataaagooatcaaatttttocgtcattgasaatgtgaaaattggaagagaaa-atgatgctc
A3SL.
aatg•gaatgaaaattgtgcggacagtgaagagag••g••gt•g••gagtggaagaaaagagagtgggctgagtgaa•aa•tattg•atagg•ggtg•tg
BSSL.
aatgcgga•ga•aaatgtgcgggcagtgaag•gagcagcagtcg•cgagtgga•ga•a••agagtgcattgagtgaag••ct•ttg•atagcaggtgctg
A3SL.
gaat~aga~caaaaatg~acgcacagc~t~caacatttg~ttt~accaaa~att~att~t¢~agcg~tt~ttt~tt~
*****
**
********
*
SLB-4
******************
***
675
Clal
**
***
***
***
****
*****
**
***
*******
774
** * * *
.... t a g a a a a a a a t g t c c a t g t
EcoRI 872
972
SL RNA 1072
**********************************************************************************__
B5SL.
gaatcag•ccca•aaatgca•gcacagcatccaacatttg•tttgaccaaaacatt•attctcccca•agcgcttctttctt
ELSL. SL 4 A3SL.
~v~gtacttggtgtatcctgCccaaaatatctgtggcatgga--ataaattttggaactgcgctgccctcaa~tgggcggcgcttaaatttgtcttaa ~ ..................................................................................... * ....
B5SL.
~tacttggtgtat~ctgcccaaaatat~tgtggcatgga--at~aattttggaactgcgctgc~ctcaactggg~ggtgcttaaatttgtcttga
ELSL.
~aaacattgaaactgacccaaagaaatt-tggcgttagctataaatttt(~uaacgtctcctctcggggagacaaaaata
A3SL
aaggatgtgtgt--ttacgagttagctttaaaaaagttg--gaattttg-caggagtttcggtgasttc
Splice
donor
Sm antigen
1170
nlte EcoRI
• * *********
B5SL.
*************
***
******
********
****
1234
********
aaagatgt gtgt gttt acgagtt agct ct aac-aagttgt ggaattttggcaggggtttcggtttgaaaggat
t gttt cggcc
Fig. 1. Alignment of genomic clones containing 5S rRNA and SL RNA genes from G. rostochiensis (A3SL) and the low molecular weight variant from G. pallida Pa2/3 (B5SL). Also shown is a region from the intergenic spacer region of the high molecular weight variant present in G. pallida Pa2/3 (PLSL) and the complete sequence of a C. elegans SL gene (ELSL). The 5S rRNA sequence and the region complementary to the 22nt SL sequence from C elegans are shaded and shown in capitals. The positions of the splice donor and Sm antigen binding site of the SL sequence are shown. Positions of restriction sites for the enzymes EcoRI, ClaI and SwaI and of oligonucleotides used in the polymerase chain reaction (5S, SL, SLB-5 and SLB-4) are indicated as is the oligonucleotide BB-1 used as a hybridization probe.
150
R. Stratford, R. Shields/Molecular and BiochemicalParasitology67 (1994) 147-155
each dNTP, 125 ng of each primer, 0.3 units of Thermalase (IBI) in Thermalase buffer (IBI) (50 mM KC1/10 mM Tris-HCL (pH 8.3)/1.5 mM MgCI2/ 0.01% Tween 20/0.01% gelatin ( w / v ) / 0 . 0 1 % NP40). The mixture was overlaid with paraffin oil and subjected to 30 cycles of amplification (30 s at 94°C, 1 min at 40°C, 2 min at 72°C), before an aliquot of the PCR reaction was loaded onto 1.4% agarose gels for analysis. Primers were also designed from the sequence of the G. pallida clone B5SL to amplify overlapping subfragments of the intergenic spacer region from Pa2/3. Either a single amplification product was produced or two products which differed by about 60 bp. In this manner two primers SLB-4 (5' G C G G G A T C C G A G C T G A G T A C G A A T A T 3 ' ) and SLB-5 (5'GCGGGATCCGATrrGCACTCGTTFG3') (introduced BamHI sites underlined) were identified which delimited the region of major size difference between the two bands amplified from P a 2 / 3 DNA with the 5S and SL primer. The PCR products were cloned and the larger one sequenced (PLSL). 2.1. BB-1 oligonucleotide A 35-bp oligonucleotide BB-1 (5' AATI~AAATITCGTrATGAGCGCGTGAATI'-FCTCT3' ) corresponding to a region from PLSL that was present only in the large version of the 5S-SL G. pallida P a 2 / 3 repeat was synthesised, labelled and used to probe Southern blots. Blots were prehybridised overnight at 50°C in 5 X SSC/0.5% S D S / 2 X Denhardt's III (10 x Denhardt's III: 0.2% gelatin/ 0.2% Ficoll 4 0 0 / 0 . 2 % PVP360/2.5% sodium pyrophosphate 4% SDS). Blots were hybridised for 2.5-3 h at 50°C and washed at a final stringency of 5 x SSC at 54°C.
3. Results
Isolation of SL RNA genes from potato cyst nematode. To see if SL RNA related sequences existed in the potato cyst nematode genome, a 22-nt oligonucleotide complementary to the SL sequence of C. elegans and other nematodes was used to screen
small plasmid libraries constructed from EcoRI digested nematode DNA. One positive clone (A3SL) of 1.2 kb. was isolated from G. rostochiensis pathotype Rol and one (B5SL) of 1.1 kb. from G. pallida pathotype 2 / 3 . Each clone was fully sequenced on both strands (Fig. 1). A 22-nt SL sequence identical to that described in other nematodes was present 786 (A3SL) or 715 (B5SL) nt downstream of the 3' end of a sequence with high homology (86-88%) to nematode 5S rRNA genes [4,11-15]. Additionally, the 22-nt SL was immediately flanked on the 3' side by the dinucleotide GT, characteristic of the potential splice donor site of SL RNA, and a consensus sequence A A T I T r G G corresponding to the Sm antigen binding site of nematode SL RNAs was found 57 nucleotides downstream of the SL sequence. The strong conservation of these features suggests that potato cyst nematodes contain SL RNA genes. The direction of transcription of the SL sequence and the 5S rRNA sequences in potato cyst nematode is predicted to be the same as in Ascaris spp. and B. malayi and contrasts with the organisation of these sequences in C. elegans in which the SL is transcribed in the opposite orientation to 5S rRNA [12]. The sequence of the putative 5S gene of the G. rostochiensis clone (A3SL) differs in one position from that of the G. pallida clone (B5SL) and the sequences of the SL RNA genes differ at one, or possibly two positions depending on where the 3' terminus of the SL transcript maps (Fig. 1). The intergenic regions although highly homologous show a number of differences, most notably this G. pallida clone has small deletions relative to the G. rostochiensis clone. This is discussed in more detail later. • Genomic organisation of 5S and SL RNA genes in potato cyst nematodes. Southern blots probed with labelled A3SL were used to examine the genomic organisation of SL RNA and 5S rRNA genes in G. rostochiensis and G. pallida (Fig. 2). The strongly hybridising band at 1.2 kb in G. rostochiensis in the ClaI digests corresponds to the full length of clone A3SL; in G. pallida the two repeat sizes (1.1 kb and 1.2 kb see below) are not resolved on this gel. The majority of the signal in lanes with DNA digested with HindIII,
151
R. Stratford, R. Shields/Molecular and Biochemical Parasitology 67 (1994) 147-155 A. Mr
1 2 3 4 5
B.
1
2345
23-1 9.46"64"4-
2"32"0-
06~-
Fig. 2. Failure to release the 5S-SL units with commonrestriction enzymes. Panel A G. rostochiensis Rol, panel B G. pallida Pa2/3. DNA was undigested (lane 1), or digested with ClaI (lane 2), HindlII (lane 3), EcoRV (lane 4), BamHI (lane 5), electrophoresised and probed with labelled A3SL.
In ClaI digests of G. pallida, A3SL hybridises to bands at 1.1 kb. (corresponding in size to the B5SL clone), 1.2 kb and to multimers of these subunits suggesting that two length variants of the repeat unit are present (Fig. 3B). This was confirmed by PCR (see below). Bands other than the dimers and trimers and bands smaller than the basic repeat unit are revealed both by the full length (see for instance Fig. 3A) and 5S or SL probes on long exposures (not shown) which suggests versions of the basic unit may differ through presence or absence of restriction sites or alternatively through insertion and deletion events. Evidence from PCR studies (not shown) also suggests that a small fraction of the repeats may be less than the unit size. Partial sequencing (see below) of the larger 5S-SL repeat unit from G. pallida identified a region of 35 nucleotides (containing a recognition site ATT-
A . Mr
1
2
3 4
B. 1
2
3 4
23.19"4-
E c o R V and B a m H I (enzymes which do not cut in A3SL or B5SL) migrated with undigested DNA at greater than 23 kb. This indicated that these sequences did not excise with these enzymes and are, therefore, probably organised in tandem arrays of at least 20 units. This was confirmed by partial digestions of DNA from both G. rostochiensis and G. pallida with the enzyme ClaI where a ladder of higher molecular weight bands corresponding to dimers and higher multiples of the basic units are seen (Fig. 3). A similar pattern of ladders of a basic unit is revealed using subclones containing either the 5S or SL sequences to probe E c o R I digests of G. rostochiensis and G. paUida genomic DNA (not shown). This indicates that in potato cyst nematode the 5S and SL genes exist in tandem arrays and that if independent versions of the SL gene exist (i.e. where the gene is unlinked to the 5S) they only represent a minority of the sequences. Similarly most of the copies of the 5S gene are present in units together with the SL sequence.
6"6-
4"4-
2.320-
il
O.S6-
Fig. 3. Partial digestion of potato cyst nematode DNA to show tandem arrays of 5S-SLrepeat. Panel A, G. rostochiensis, panel B G. paUida Pa2/3. DNA (250 ng per lane) was digested with serial five fold dilution of the enzyme ClaI (maximumconcentration 10 units).
R, Stratford, R. Shields/Molecular and Biochemical Parasitology 67 (1994) 147-155
152
TAAAT for the enzyme SwaI) which was absent from the smaller version. An oligonucliotide (BB-1 Fig. 1) was synthesised corresponding to this region and used to probe a Southern blot of G. pallida Pa2/3 DNA (Fig. 4B). The blot was stripped and re-probed with A3SL (Fig. 4A), The results (Fig. 4) show that digestion of G. pallida DNA with EcoRI releases only the small repeat (Fig. 4A lane 2), SwaI releases only the larger (Fig. 4A lane 3) and ClaI releases both. We infer from these results and those of Fig. 3 that both the small and large version of the 5S-SL in G. pallida Pa 2 / 3 unit are in tandem arrays. The fact that the majority of BB-1 hybridising DNA in EcoRI digested DNA co-migrates with undigested DNA (Fig. 4B lane 2) shows that the larger repeat lacks an EcoRI site and also implies that small and large units are not interspersed. The genomic organisation inferred from this data is shown in Fig. 5.
Amplification of 5S-SL repeat by polymerase chain reaction (PCR). The near perfect conservation of the 5S and SL RNA sequences in these two nematode species allowed the design of PCR primers to amplify the region between these genes. The results from amplification of DNA from G. rostochiensis and G. paUida isolates is shown in Fig. 6 together with results from Ascaris lumbricoides and C. elegans. The SL sequence in C. elegans is in the opposite orientation to that in the other nematodes [12]. Consequently amplification was only observed
R G__~.
rostoch~ens~s
(A3SL)
23.19-46.6-
4"4-
2"3
0"56-
Fig. 4. Arrangement of small and large 5S-SL repeats in G. pallida Pa2/3. Genomic DNA of G. pallida was either undigested (lane 1) or digested with EcoRI (lane 2), SwaI (lane 3), EcoRI plus SwaI (lane 4) or ClaI lane 5. The blot was probed with labelled A3SL (panel A) or oligonucleotide BB-1 (panel B).
R , ....
I
5S
Small
G_...~.p a l l i d a
(BSSL)
I
. . . . . . . . .
SS
L a r g e G_..:..~
(PLSI.,)
....
~--A 5S
SLBI
$ s.essa,
~
R
L--.I
SLB4
SL
C" . . . . . . . . . . . . ~s~
C • ...........
.........
SL
.....
R
SL
C
R
I
I.
. . . . . . .
5S
~U"
~ _ . ,
5S
SL
C . . . .
--
2.0-
C
I
B. 1 2 3 4 5
1 2 3 4 5
A.Mr
I
. . . . . .
SL
m m m . _ JS. . . . . . . .
C. . . . . . . . . . . . ...,
mem__SL
t,---.-I
lOObp
Fig. 5. Genomic organisation of 5S to SL repeat units in G. rostochiensis, and the small and large version of the repeat from G. pal~ida Pa2/3. The positions of the 5S and SL genes are indicated by filled boxes, the position of the 5S, SL, SLB-4 and SLB5 PCR primers are also indicated. Also shown is the position of the oligonucleotide BB1. Solid lines indicate the extent of the cloned regions, dotted lines the infered arrangements of tandemly associated regions. Restriction sites are indicated by capital letters R = EcoRI, C = ClaI, S = SwaI.
R. Stratford, R. Shields~Molecular and Biochemical Parasitology 67 (1994) 147-155 Mr
1
2
3
4
5
6
Mr
1"2~.
1-1~
040"3-
Fig. 6. PCR amplification of nematode 5S to SL region. Amplification of 5S to SL region from potato cyst nematode, C. elegans and Ascaris lumbricoides. Lane 1: G. rostochiensis Rol (PBI), Lane 2: G. pallida Pa2/3 (PBI), Lane 3: G. pallida Pal (population B1), Lane 4: Ascaris lumbricoides (expected product size 455 bp [5], Lane 5: C. elegans, Lane 6: C. elegans using 5S and complement to SL primer (expected product size 800 bp [12]). Molecular weight markers (kb) are shown (Mr).
153
pairs of PCR primers (see Materials and methods). This region (PLSL) was cloned and sequenced; it was 61 bp longer than the smaller accounting for the entire size difference between the two G. pallida P a 2 / 3 amplification products (Fig. 1 and Fig. 6). Amplification from DNA of an isolate of G. pallida Pal in contrast to P a 2 / 3 reveals only a single, lower molecular weight amplification product which co-migrated with the lower molecular weight product from P a 2 / 3 (Fig. 6). Pairs of oligonucleotide PCR primers based on regions of the sequence of B5SL from G. pallida Pa2//3 were used to amplify portions of the Pal DNA. With every primer pair the products amplified from Pal DNA were of a similar size to products expected from the amplification of the small 5S-SL repeat of Pa2/3. In addition Southern blotting of SwaI-digested Pal DNA failed to reveal a SwaI site in Pal DNA (data not shown). We conclude that the major Pal DNA repeat unit is broadly similar in sequence to the small P a 2 / 3 repeat.
4. Discussion
with the complementary version of the SL primer. As can be seen for G. rostochiensis the single major band corresponds to the expected size of 914 bp (calculated from the sequence of the A3SL clone) and for G. pallida two bands are visible, the larger one being very similar in size to the major band in G. rostochiensis. The smaller band corresponds to the 853-bp size expected from the sequence of B5SL. Examination of DNA from numerous G. rostochiensis and G. pallida isolates from Europe and South America have shown identical results i.e. a single major band in all G. rostochiensis pathotypes and two in G. pallida P a 2 / 3 (unpublished observations with C. Fleming). Faint bands corresponding to smaller amplification products are sometimes seen with G. rostochiensis and G. pallida, which may correspond to the shorter version of the basic repeat unit also revealed by Southern blotting (Fig. 3). The presence of two PCR products from G. pallida P a 2 / 3 isolates confirms the existence of the two major size variants identified in the Southern blots. The major region of length difference between the two G. pallida P a 2 / 3 bands was identified using
In this paper, we show that sequences with the characteristics of SL genes exist in plant parasitic nematodes. Nematode trans-spliced leader (SL) RNAs are composed of two domains: a mini-exon (the 22-nt-spliced leader) and a small nuclear RNA (snRNA)-like sequence. The 22-nt sequence is highly conserved amongst nematodes (including potato cyst nematodes). Comparisons of the remainder of the sequence of the SL RNA from a number of different nematodes show a lower degree of homology [3-7]; however, the predicted secondary structure of SL RNAs from a number of nematodes (including the potato cyst nematodes) are very similar (not shown). In vitro experiments in A. lumbricoides demonstrate that the 22-nt sequence is part of a transcribed promoter for the SL RNA gene [16] and plays no part in the splicing reaction itself as it can be replaced by artificial exons [17]. This observation suggests that the extreme conservation of nematode SL sequences has more to do with constraints imposed by transcription than by post transcriptional functions such as trans-splicing. Mutagenic studies of the SL RNA molecule have
154
R. Stratford, R. Shields~Molecular and Biochemical Parasitology 67 (1994) 147-155
pointed out regions of importance for trans-splicing [18]. The splice donor site (GU) immediately following the 22-nt mini-exon and the Sm binding region (AAUUUUGG) are conserved in SL RNAs of all nematodes and are required for splicing. The sequences AUA 5' and AAC 3' of the Sm binding site are conserved in a number of nematodes including potato cyst nematodes. The sequence GUGGC is found nine nucleotides upstream of the first adenosine of the Sm binding site in potato cyst nematode (Fig. 1) as well as a number of other nematodes where SL RNAs are linked to 5S genes [18]. Interestingly the sequence in the independent SL2s of C. elegans and A. cantonensis (where the SL gene is also unlinked to the 5S gene) both have GUCAAA at the equivalent position. In this paper we show that in potato cyst nematode (as in a number of other nematodes) the 5S rRNA and SL RNA genes are associated in tandemly repeated units. This arrangement is not confined to nematodes but present in some species of trypanosomes [19] and Euglena [20] where the sequence of the SL RNA is quite different from that of nematodes. The functional significance of this arrangement (if any) is obscure; it has nothing to do with co-transcription as the 5S gene is transcribed by RNA polymerase III whereas the SL RNA gene is transcribed by RNA-polymerase II [20]. The 5S rRNA genes we have sequenced from G. rostochiensis and G. pallida differ in a single nucleotide and show extensive homology (86-89%) to 5S genes from other nematode species. The length of spacer DNA between the 5S rRNA and SL RNA genes varies in different nematodes. In potato cyst nematodes it is more than 700 bp; the corresponding distance in C. elegans is approximately 500 bp [12, see Fig. 6] in A. lumbricoides it is 380 nucleotides [5, and see Fig. 6] and in D. immitis and O. volvulus it is 104 nucleotides [4]. Despite the observation that sequences in this region contribute to the promoter of the SL RNA gene [16] there is little sequence homology between nematode species in this region. These results show that the length of the basic repeat varies in different nematode species and our results (Fig. 3) suggest that length variation may exist within a single species of nematode and between different pathotypes of the same species of potato cyst nematode (Fig. 6). It is likely that this variation could be
used to form the basis of a potato cyst nematode specific diagnostic test.
Acknowledgements We thank Colin Fleming for supplying many of the potato cyst nematode populations used in this study, Barry Kingston for Ascaris DNA and Trevor Hawkins for C. elegans DNA.
References [1[ Nilsen, T.W. (1989) Trans-splicing in Nematodes. Exp. Parasitol. 69, 413-416. [2] Nelson, D.W. and Honda B.M. (1985) Genes coding for 5S ribosomal RNA of the nematode Caenorhabditis elegans. Gene 38, 245-251. [3] Takacs, A.M., Denker, J.A., Perrine, K.G., Maroney, P.A. and Nilsen, T.W. (1988) A 22-nucleotide spliced leader sequence in the human parasitic nematode Brugia malayi is identical to the trans-spliced leader exon in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 85, 7932-7936. [4] Zeng, W., Alarcon, C.M. and Donelson, J.E. (1990) Many transcribed regions of the Onchocerca volvulus genome contain the spliced leader sequence of Caenorhabditis elegans. Mol. Cell. Biol. 10, 2765-2773. [5] Nilsen, T.W., Shambaugh, J., Denker, J., Chubb, G., Faser, C., Putnam, L. and Bennett, K. (1989) Characterization and expression of a spliced leader RNA in the parasitic nematode Ascaris lumbricoides var. suum. Mol. Cell. Biol. 9, 35433547. [6] Bektesh, S., van Doren, K. and Hirsh, D. (1988) Presence of the Caenorhabditis elegans spliced leader on different mRNAs and in different genera of nematodes. Genes Dev. 2, 1277-1283. [7] Joshua, G.W.P., Chuang, R.Y., Gheng, S.C., Lin, S.F., Tuan, R.S. and Wang, C.C. (1991). The spliced leader of Angiostrongylus cantonensis Mol. Biochem. Parasitol. 46, 209218. [8] Huang, X-Y. and Hirsh, D. (1989). A second trans-spliced RNA leader sequence in the nematode Caenorhabditis elegans Proc. Natl. Acad. Sci. USA 86, 8640-8644. [9] Stratford, R., Shields, R., Goldsbrough, A.P. and Fleming, C. (1992) Analysis of repetitive DNA sequences from potato cyst nematodes and their use as diagnostic probes. Phytopathology 82, 881-886. [10] Schnick, D., Rumpenhorst, H.J. and Burgermeister, W. (1990) Differentiation of closely related Globodera pallida (Stone) populations by means of DNA restriction fragment polymorphisms (RFLPs). J. Phytopathol. 130, 127-136. [11] Ransohoff, R.M., Denker, J.A., Takacs, A.M., Hannon, G.J. and Nilsen, T.W. (1989) Organization and expression of 5S
R. Stratford, R. Shields/Molecular and Biochemical Parasitology 67 (1994) 147-155
[12]
[13]
[14]
[15]
rRNA genes in the parasitic nematode, Brugia malayi Nucleic Acids Res. 17, 3773-3782. Nelson, D.W. and Honda B.M. (1989) Two highly conserved transcribed regions in the 5S DNA repeats of the nematodes Caenorhabditis elegans and Caenorhabditis briggsae Nucleic Acids Res. 17, 8657-8667. Vahidi, H., Purac, A., LeBlanc, J.M. and Honda B.M. (1992) Characterization of a potentially functional 5S rRNA encoding genes within ribosomal DNA repeats of the nematode Meloidogyne arenana. Gene 108, 281-284. Nilsen, T.W., Shambaugh, J., Denker, J., Chubb, G., Faser, C., Putnam, L. and Bennett, K. (1989) Characterization and expression of a spliced leader RNA in the parasitic nematode Ascaris lumbricoides var. suum. Mol. Cell Biol. 9, 35433547. Kumazaki, T., Hod, H., Osawa, S., Ishii, N. and Suzuki, K. (1982). The nucleotide sequences of the 5S rRNAs from a rotifer, Brachionus plicatillis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans. Nucleic Acids Res. 10, 7001-7004.
155
[16] Hannon, G.J., Maroney, P.A., Ayers, D.G., Shambaugh, J.D. and Nilsen, T.W. (1990) Transcription of a nematode transspliced leader RNA requires internal elements for both initiation and 3' end formation. EMBO.J. 9, 1915-1921. [17] Maroney, P.A., Hannon, G.J., Shambaugh, J.D. and Nilsen, T.W. (1991). Intramolecular base pairing between the nematode spliced leader and in 5' splice site is not essential for trans-splicing in vitro. EMBO.J. 10 3869-3875. [18] Hannon, G.J., Maroney, P.A., Yu, Y-T., Hannon, G.E. and Nilsen, T.W. (1992) Interaction of U6 snRNA with a sequence required for function of the nematode SL RNA in Trans-splicing. Science 258, 1775-1780. [19] Aksoy, S., Shay, G.L., Villanueva, M.S., Beard, C.B. and Richards, F.F. (1992) Spliced leader RNA sequences of Trypanosoma rangeli are organised within the 5S rRNA-encoding genes. Gene 113, 239-243. [20] Keller M., Tessier, L.H., Chan, R.L., Weil, J.H. and Imbault, P. (1992) In Euglena, spliced-leader RNA (SL-RNA) and 5S rRNA genes are tandemly repeated. Nucleic Acids Res. 20, 1711-1715.
ELSEVIER
Molecular and BiochemicalParasitology 67 (1994) 147-155
BIOCHEMICAL PARASITOLOGY
A trans-spliced leader RNA sequence in plant parasitic nematodes Rebecca Stratford *, Robert Shields Plant Breeding International, Maris Lane, Trumpington, Cambridge, CB2 2LQ, UK Received 9 March 1994; accepted 15 June 1994
Abstract
A trans-spliced leader gene has been identified in the genomes of the potato cyst nematodes Globodera rostochiensis and G. pallida. The gene contains a 22-nt sequence identical to that of the leader sequence of Caenorhabditis elegans, a consensus splice donor site and a putative Sm antigen binding site. In common with other nematodes the spliced leader gene is present in tandem repeating units together with the 5S ribosomal RNA gene. Variation in the length of the intergenic spacer region has permitted the design of polymerase chain reaction primers which can be used to reveal repeat length variants diagnostic for G. rostochiensis and G. pallida and the Pal pathotype of G. pallida.
Keywords: Tandem repeat; 5S rRNA; Globodera spp.; Diagnostics; Polymerase chain reaction
1. Introduction
In nematodes, a subset of the mRNAs contain an identical 22-nt spliced leader (SL) sequence at the 5' end. This SL is donated from the 5' end of a small (approximately 100 nt) nonpolyadenylated transcript (SL RNA) through a trans-splicing reaction (for review see [1]). The organisation of genes encoding SL RNAs has been characterised in some detail in a number of nematodes. In Caenorhabditis elegans, the SL R N A gene together with the 5S rRNA gene is located in a 1-kilobase (kb) sequence that is tandemly repeated 100 times to form a large array on chromosome V
Note: Nucleotide sequence data reported in this paper have been submitted to the GenBank data base with the accession numbers L28954 (G. rostochiensis) and L28955 (G. pallida). Tel.: (0223) 840411; Fax: (0223) 844425. Elsevier Science B.V. SSDI 0165-0327(94)00123-5
[2]. SL R N A sequences are also reiterated in tandem within the 5S rRNA gene clusters of the filarial parasitic nematodes Brugia malayi, Onchocerca volvulus and Dirofilaria immitis and in the intestinal parasite Ascaris lumbricoides (3-5)i Unlike C. elegans the SL R N A sequence of these organisms is transcribed from the same strand as the 5S rRNA. Some of these nematodes also have perfect copies of the SL sequence that are unlinked to the 5S gene cluster, while in other nematodes such as Haemonchus contortus and Angiostrongylus cantonensis all the SL sequences appear unlinked to the 5S gene [6,7]. In C. elegans a second version (SL2) of the Spliced leader sequence has been shown to participate in trans-splicing of some genes. The 22-nt trans-spliced segment of SL2 differs from the canonical SL sequence in 6 of the 22 bases and the four copies of the SL2 R N A genes are not part of the 5S rRNA gene cluster. SL 2 R N A appears to participate in trans-splicing in the related nematode C. briggsae
148
R. Stratford,R. Shields/Molecular and BiochemicalParasitology67 (1994) 147-155
but not in the nematodes Panagrellus redivivus and H. contortus [8]. It appears therefore that trans-splicing is a common feature of nematodes and that SL rRNA is frequently (although not invariably) transcribed from within the reiterated 5S rRNA gene cluster. The plant parasitic nematodes Globodera rostochiensis and G. pallida are important pathogens of the potato crop. A number of pathotypes within each of the species has been distinguished on their ability to multiply on different accessions of wild potato. Some genes from these accessions that give resistance to particular pathotypes have been incorporated into commercial potato varieties. However, effective use of resistant cultivars and programmes of nematode control are dependent on reliable nematode identification. Identification of potato cyst nematode species is difficult and, moreover, identification of individual pathotypes within species is impossible using morphological characteristics alone. We have shown previously that a number of repetitive DNA sequences are present in long tandem arrays in the genomes of potato cyst nematodes. The different levels of amplification of such sequences can be used to differentiate between the two species and furthermore can distinguish the Pal pathotype of G. pallida from the P a 2 / 3 pathotype [9]. Here we show that both G. rostochiensis and G. pallida contain SL RNA genes in long tandem arrays within the 5S gene cluster, with a 22-nt SL mini-exon identical to that in all free living and animal parasitic nematodes analysed to date. Variation in the length of the intergenic sequence between the 5S and SL genes can be used to distinguish G. rostochiensis from G. pallida, and also the Pal pathotype of G. pallida.
buffer (100 mM Tris-HC1 pH 8 . 5 / 5 0 mM EDTA/200 mM NaCI) and 5 mg proteinase K was added. The mixture was incubated for 1 h at 50°C with occasional inversion after which it was centrifuged at 13000 × g for 5 min in a microfuge. CsCI 2 (1 g m1-1) was dissolved in the supernatant by gentle shaking at room temperature, followed by 50 /zl of ethidium bromide stock solution (10 mg m1-1) and the resulting solution centrifuged as before. The floating material was removed and the supernatant centrifuged overnight (223000 X g, 16 h, Sorvall TV865 vertical rotor). The banded DNA was recovered and the ethidium bromide removed by extraction with butanol saturated with 20 × SSC (1 X SSC is 150 mM NaC1, 15 mM trisodium citrate). Two volumes of water were added and the DNA precipitated with ethanol. At this stage the DNA was light tan in colour and difficult to cut with restriction enzymes. This problem was overcome by purification over a spin column of Sepharose CL-6B.
2. Materials and methods
DNA manipulation and isolation of SL RNA genes. The manipulation of DNA and the construction of plasmid genomic libraries from EcoRI digested DNA of G. pallida P a 2 / 3 and G. rostochiensis Rol have been described previously [9]. Colony lifts were hybridized overnight at room temperature in 6 X SSC, 1 × Denhardt's (0.02% Ficoll/0.02% B S A / 0.02% PVP 360) with a labelled oligonucleotide complementary to the SL mini-exon of animal parasitic and free living nematodes (SL primer: 5' CTCAAACITGGGTAATrAAACC 3'). The filters were washed at a final stringency of 6 x SSC at 36°C. One positive clone from each library was identified (G. rostochiensis; A3SL, G. paUida B5SL). For Southern blots each lane contained 250 ng of nematode DNA digested with various restriction enzymes. Southern blots were prepared essentially as described [9].
Cyst material and DNA extraction. Cysts of different populations of G. rostochiensis and G. pallida were from collections described previously [9]. DNA was extracted from dried cysts by a modification of a published method [10]. Approximately 300 mg of cysts and a pinch of sand were ground with a pestle and mortar under liquid nitrogen. The powder was transferred to a container to which 6 ml of extraction
Polymerase chain reaction. Oligonucleotide primers were designed to be complementary to the 5S rRNA sequence (5S primer) 5'CGCGGATCCTrACGACCATACCACG 3' (an introduced BamHI site is underlined) and the SL RNA sequence (SL primer). Polymerase chain reaction (PCR) mixes (25 /xl final volume) contained either 5-10 ng of DNA or 1 /~1 or 2 /xl of cyst homogenate (see below), 200 /xM of
R. Stratford, R. Shields / Moiecular and Biochemical Parasitology 67 (1994) 147-155
149
A3SL.
EcoRI g a a t t c g a c a a a t t a g a g a a s t t tt t t a c a t a c a t t c a a t t t t t g a g a a a a t t a t a c t t a g a g t t a t tcttgacaaattt tgtccaatatctgtttgatt ************* *** * * * * * * * * * * * * * * * * * * * * * * **** ********** ***************** **********
BSSL.
aaattcgacaaattggagcasttttttacatacattcaattattgataaaattatacagagagttattottgacaa
A3SL.
t g .a.g. .c. g. .t. g. .a. .c.c. .a. a. .t. g. .a. .g.a. .c. a. .a. a. .a. a. .g. .t.c. .a. c. .a. c. .a. .t.t. .t. g. .g t t g g c t t c c c t c a c t c c~t g c a t c~~ ~
B5SL.
--agcttg
100
........... t a t c t g t t t g - - -
5S RNA
A3SL.
G
BSSL.
@
.....
a ~
~ ~
~
!
~
200
agggacaaaaagtcacacatttggttggcttccctcactccagcatc~~~~ Q
~
~
~
~
~
a
t
. t . t . t. t. t. tt . . a.a .a t . t . t . t. t. aa .
~
~oo
~mcatttttt a-aaattttt aa
A3SL. BSSL.
..... tttctgaataggtatttatttttttgtttgttcaaaaaagatttgcactcgtttgat ................................... tat SLB-5
~
PLSL.
SwaI
taatttaaatttcgttatgagcgcgtgaatttctcttat BB-1
A3SL. BSSL.
======================= .........
PLSL.
ga~tcagcaat~tg~ttt~caaaa-tttcctcaaatctacacaattttgatatttttc~at~aa-taacatt~actccctc~ctttta~a~cattaaaa
::::::::::::::::::::::::::::::::::::::::
.......
:::::::::::::::::::::
A3SL.
aacaaatttcaataagtttgaacaaaaga *****************************
.........
gttocctgccgccccatta--ttgtttttggccaaa-tttgatggactgtaactttgcttag ***** * *********** ************** ******** ************* *
B5SL.
aacaaatttcaatssgtttgaacaaaaga ********* , ****************
.........
gttccttccogccccatta--ttgtttttggccaac-tttgatgggctgtaactttgctcaa
PLSL.
aacaaattttatt•agtttgaacaaaaggggttggttggtt•••tcccgccccatttttttgtttttgggcaaattttgaaagcctgtaactttgctc••
A3SL.
aatggcgagcgg•gcccgatttttgcatattcgta•tcag¢tcgacgaggggaat•gattgatataaaatttaggcgaatttgaga•agttg•aaaa•ac
*****
************
,*********
***
*****
575
, ****************
Clal
BSSL.
aatggtgag•gg•gc•cattttttg•atatt•gtact•agctcgatgaggggaat•gattgatataaaatttaggcgaatttgcgtatgtcgaaaa•aac
PLSL.
***************** *******4 eatggtgagcggcgcocgatttttgc
A3SL.
atgttttttCatttatat•gt-tatttttaatttattttaataaaaatttttgtatttttttatcCttcgaatttgcgtgttagtt•aaaatgcccttgt
BSSL.
atgttottcaatttatattggatatttttaatttattttattaataaagttttgttttcttttocctt-gaattcgc
A3SL.
tttt•attgt•agaactaaa•taaa•g•aaatct•aaaataaag¢cat•aaattg-t••at=attgaaaatgtga-aata•ga•gagaatgatgatgctc **** *** **** *************************** *** *************** *** ******** *********
BSSL.
tttt ........ gas ....... eeaatcaaatcccaaaataaagooatcaaatttttocgtcattgasaatgtgaaaattggaagagaaa-atgatgctc
A3SL.
aatg•gaatgaaaattgtgcggacagtgaagagag••g••gt•g••gagtggaagaaaagagagtgggctgagtgaa•aa•tattg•atagg•ggtg•tg
BSSL.
aatgcgga•ga•aaatgtgcgggcagtgaag•gagcagcagtcg•cgagtgga•ga•a••agagtgcattgagtgaag••ct•ttg•atagcaggtgctg
A3SL.
gaat~aga~caaaaatg~acgcacagc~t~caacatttg~ttt~accaaa~att~att~t¢~agcg~tt~ttt~tt~
*****
**
********
*
SLB-4
******************
***
675
Clal
**
***
***
***
****
*****
**
***
*******
774
** * * *
.... t a g a a a a a a a t g t c c a t g t
EcoRI 872
972
SL RNA 1072
**********************************************************************************__
B5SL.
gaatcag•ccca•aaatgca•gcacagcatccaacatttg•tttgaccaaaacatt•attctcccca•agcgcttctttctt
ELSL. SL 4 A3SL.
~v~gtacttggtgtatcctgCccaaaatatctgtggcatgga--ataaattttggaactgcgctgccctcaa~tgggcggcgcttaaatttgtcttaa ~ ..................................................................................... * ....
B5SL.
~tacttggtgtat~ctgcccaaaatat~tgtggcatgga--at~aattttggaactgcgctgc~ctcaactggg~ggtgcttaaatttgtcttga
ELSL.
~aaacattgaaactgacccaaagaaatt-tggcgttagctataaatttt(~uaacgtctcctctcggggagacaaaaata
A3SL
aaggatgtgtgt--ttacgagttagctttaaaaaagttg--gaattttg-caggagtttcggtgasttc
Splice
donor
Sm antigen
1170
nlte EcoRI
• * *********
B5SL.
*************
***
******
********
****
1234
********
aaagatgt gtgt gttt acgagtt agct ct aac-aagttgt ggaattttggcaggggtttcggtttgaaaggat
t gttt cggcc
Fig. 1. Alignment of genomic clones containing 5S rRNA and SL RNA genes from G. rostochiensis (A3SL) and the low molecular weight variant from G. pallida Pa2/3 (B5SL). Also shown is a region from the intergenic spacer region of the high molecular weight variant present in G. pallida Pa2/3 (PLSL) and the complete sequence of a C. elegans SL gene (ELSL). The 5S rRNA sequence and the region complementary to the 22nt SL sequence from C elegans are shaded and shown in capitals. The positions of the splice donor and Sm antigen binding site of the SL sequence are shown. Positions of restriction sites for the enzymes EcoRI, ClaI and SwaI and of oligonucleotides used in the polymerase chain reaction (5S, SL, SLB-5 and SLB-4) are indicated as is the oligonucleotide BB-1 used as a hybridization probe.
150
R. Stratford, R. Shields/Molecular and BiochemicalParasitology67 (1994) 147-155
each dNTP, 125 ng of each primer, 0.3 units of Thermalase (IBI) in Thermalase buffer (IBI) (50 mM KC1/10 mM Tris-HCL (pH 8.3)/1.5 mM MgCI2/ 0.01% Tween 20/0.01% gelatin ( w / v ) / 0 . 0 1 % NP40). The mixture was overlaid with paraffin oil and subjected to 30 cycles of amplification (30 s at 94°C, 1 min at 40°C, 2 min at 72°C), before an aliquot of the PCR reaction was loaded onto 1.4% agarose gels for analysis. Primers were also designed from the sequence of the G. pallida clone B5SL to amplify overlapping subfragments of the intergenic spacer region from Pa2/3. Either a single amplification product was produced or two products which differed by about 60 bp. In this manner two primers SLB-4 (5' G C G G G A T C C G A G C T G A G T A C G A A T A T 3 ' ) and SLB-5 (5'GCGGGATCCGATrrGCACTCGTTFG3') (introduced BamHI sites underlined) were identified which delimited the region of major size difference between the two bands amplified from P a 2 / 3 DNA with the 5S and SL primer. The PCR products were cloned and the larger one sequenced (PLSL). 2.1. BB-1 oligonucleotide A 35-bp oligonucleotide BB-1 (5' AATI~AAATITCGTrATGAGCGCGTGAATI'-FCTCT3' ) corresponding to a region from PLSL that was present only in the large version of the 5S-SL G. pallida P a 2 / 3 repeat was synthesised, labelled and used to probe Southern blots. Blots were prehybridised overnight at 50°C in 5 X SSC/0.5% S D S / 2 X Denhardt's III (10 x Denhardt's III: 0.2% gelatin/ 0.2% Ficoll 4 0 0 / 0 . 2 % PVP360/2.5% sodium pyrophosphate 4% SDS). Blots were hybridised for 2.5-3 h at 50°C and washed at a final stringency of 5 x SSC at 54°C.
3. Results
Isolation of SL RNA genes from potato cyst nematode. To see if SL RNA related sequences existed in the potato cyst nematode genome, a 22-nt oligonucleotide complementary to the SL sequence of C. elegans and other nematodes was used to screen
small plasmid libraries constructed from EcoRI digested nematode DNA. One positive clone (A3SL) of 1.2 kb. was isolated from G. rostochiensis pathotype Rol and one (B5SL) of 1.1 kb. from G. pallida pathotype 2 / 3 . Each clone was fully sequenced on both strands (Fig. 1). A 22-nt SL sequence identical to that described in other nematodes was present 786 (A3SL) or 715 (B5SL) nt downstream of the 3' end of a sequence with high homology (86-88%) to nematode 5S rRNA genes [4,11-15]. Additionally, the 22-nt SL was immediately flanked on the 3' side by the dinucleotide GT, characteristic of the potential splice donor site of SL RNA, and a consensus sequence A A T I T r G G corresponding to the Sm antigen binding site of nematode SL RNAs was found 57 nucleotides downstream of the SL sequence. The strong conservation of these features suggests that potato cyst nematodes contain SL RNA genes. The direction of transcription of the SL sequence and the 5S rRNA sequences in potato cyst nematode is predicted to be the same as in Ascaris spp. and B. malayi and contrasts with the organisation of these sequences in C. elegans in which the SL is transcribed in the opposite orientation to 5S rRNA [12]. The sequence of the putative 5S gene of the G. rostochiensis clone (A3SL) differs in one position from that of the G. pallida clone (B5SL) and the sequences of the SL RNA genes differ at one, or possibly two positions depending on where the 3' terminus of the SL transcript maps (Fig. 1). The intergenic regions although highly homologous show a number of differences, most notably this G. pallida clone has small deletions relative to the G. rostochiensis clone. This is discussed in more detail later. • Genomic organisation of 5S and SL RNA genes in potato cyst nematodes. Southern blots probed with labelled A3SL were used to examine the genomic organisation of SL RNA and 5S rRNA genes in G. rostochiensis and G. pallida (Fig. 2). The strongly hybridising band at 1.2 kb in G. rostochiensis in the ClaI digests corresponds to the full length of clone A3SL; in G. pallida the two repeat sizes (1.1 kb and 1.2 kb see below) are not resolved on this gel. The majority of the signal in lanes with DNA digested with HindIII,
151
R. Stratford, R. Shields/Molecular and Biochemical Parasitology 67 (1994) 147-155 A. Mr
1 2 3 4 5
B.
1
2345
23-1 9.46"64"4-
2"32"0-
06~-
Fig. 2. Failure to release the 5S-SL units with commonrestriction enzymes. Panel A G. rostochiensis Rol, panel B G. pallida Pa2/3. DNA was undigested (lane 1), or digested with ClaI (lane 2), HindlII (lane 3), EcoRV (lane 4), BamHI (lane 5), electrophoresised and probed with labelled A3SL.
In ClaI digests of G. pallida, A3SL hybridises to bands at 1.1 kb. (corresponding in size to the B5SL clone), 1.2 kb and to multimers of these subunits suggesting that two length variants of the repeat unit are present (Fig. 3B). This was confirmed by PCR (see below). Bands other than the dimers and trimers and bands smaller than the basic repeat unit are revealed both by the full length (see for instance Fig. 3A) and 5S or SL probes on long exposures (not shown) which suggests versions of the basic unit may differ through presence or absence of restriction sites or alternatively through insertion and deletion events. Evidence from PCR studies (not shown) also suggests that a small fraction of the repeats may be less than the unit size. Partial sequencing (see below) of the larger 5S-SL repeat unit from G. pallida identified a region of 35 nucleotides (containing a recognition site ATT-
A . Mr
1
2
3 4
B. 1
2
3 4
23.19"4-
E c o R V and B a m H I (enzymes which do not cut in A3SL or B5SL) migrated with undigested DNA at greater than 23 kb. This indicated that these sequences did not excise with these enzymes and are, therefore, probably organised in tandem arrays of at least 20 units. This was confirmed by partial digestions of DNA from both G. rostochiensis and G. pallida with the enzyme ClaI where a ladder of higher molecular weight bands corresponding to dimers and higher multiples of the basic units are seen (Fig. 3). A similar pattern of ladders of a basic unit is revealed using subclones containing either the 5S or SL sequences to probe E c o R I digests of G. rostochiensis and G. paUida genomic DNA (not shown). This indicates that in potato cyst nematode the 5S and SL genes exist in tandem arrays and that if independent versions of the SL gene exist (i.e. where the gene is unlinked to the 5S) they only represent a minority of the sequences. Similarly most of the copies of the 5S gene are present in units together with the SL sequence.
6"6-
4"4-
2.320-
il
O.S6-
Fig. 3. Partial digestion of potato cyst nematode DNA to show tandem arrays of 5S-SLrepeat. Panel A, G. rostochiensis, panel B G. paUida Pa2/3. DNA (250 ng per lane) was digested with serial five fold dilution of the enzyme ClaI (maximumconcentration 10 units).
R, Stratford, R. Shields/Molecular and Biochemical Parasitology 67 (1994) 147-155
152
TAAAT for the enzyme SwaI) which was absent from the smaller version. An oligonucliotide (BB-1 Fig. 1) was synthesised corresponding to this region and used to probe a Southern blot of G. pallida Pa2/3 DNA (Fig. 4B). The blot was stripped and re-probed with A3SL (Fig. 4A), The results (Fig. 4) show that digestion of G. pallida DNA with EcoRI releases only the small repeat (Fig. 4A lane 2), SwaI releases only the larger (Fig. 4A lane 3) and ClaI releases both. We infer from these results and those of Fig. 3 that both the small and large version of the 5S-SL in G. pallida Pa 2 / 3 unit are in tandem arrays. The fact that the majority of BB-1 hybridising DNA in EcoRI digested DNA co-migrates with undigested DNA (Fig. 4B lane 2) shows that the larger repeat lacks an EcoRI site and also implies that small and large units are not interspersed. The genomic organisation inferred from this data is shown in Fig. 5.
Amplification of 5S-SL repeat by polymerase chain reaction (PCR). The near perfect conservation of the 5S and SL RNA sequences in these two nematode species allowed the design of PCR primers to amplify the region between these genes. The results from amplification of DNA from G. rostochiensis and G. paUida isolates is shown in Fig. 6 together with results from Ascaris lumbricoides and C. elegans. The SL sequence in C. elegans is in the opposite orientation to that in the other nematodes [12]. Consequently amplification was only observed
R G__~.
rostoch~ens~s
(A3SL)
23.19-46.6-
4"4-
2"3
0"56-
Fig. 4. Arrangement of small and large 5S-SL repeats in G. pallida Pa2/3. Genomic DNA of G. pallida was either undigested (lane 1) or digested with EcoRI (lane 2), SwaI (lane 3), EcoRI plus SwaI (lane 4) or ClaI lane 5. The blot was probed with labelled A3SL (panel A) or oligonucleotide BB-1 (panel B).
R , ....
I
5S
Small
G_...~.p a l l i d a
(BSSL)
I
. . . . . . . . .
SS
L a r g e G_..:..~
(PLSI.,)
....
~--A 5S
SLBI
$ s.essa,
~
R
L--.I
SLB4
SL
C" . . . . . . . . . . . . ~s~
C • ...........
.........
SL
.....
R
SL
C
R
I
I.
. . . . . . .
5S
~U"
~ _ . ,
5S
SL
C . . . .
--
2.0-
C
I
B. 1 2 3 4 5
1 2 3 4 5
A.Mr
I
. . . . . .
SL
m m m . _ JS. . . . . . . .
C. . . . . . . . . . . . ...,
mem__SL
t,---.-I
lOObp
Fig. 5. Genomic organisation of 5S to SL repeat units in G. rostochiensis, and the small and large version of the repeat from G. pal~ida Pa2/3. The positions of the 5S and SL genes are indicated by filled boxes, the position of the 5S, SL, SLB-4 and SLB5 PCR primers are also indicated. Also shown is the position of the oligonucleotide BB1. Solid lines indicate the extent of the cloned regions, dotted lines the infered arrangements of tandemly associated regions. Restriction sites are indicated by capital letters R = EcoRI, C = ClaI, S = SwaI.
R. Stratford, R. Shields~Molecular and Biochemical Parasitology 67 (1994) 147-155 Mr
1
2
3
4
5
6
Mr
1"2~.
1-1~
040"3-
Fig. 6. PCR amplification of nematode 5S to SL region. Amplification of 5S to SL region from potato cyst nematode, C. elegans and Ascaris lumbricoides. Lane 1: G. rostochiensis Rol (PBI), Lane 2: G. pallida Pa2/3 (PBI), Lane 3: G. pallida Pal (population B1), Lane 4: Ascaris lumbricoides (expected product size 455 bp [5], Lane 5: C. elegans, Lane 6: C. elegans using 5S and complement to SL primer (expected product size 800 bp [12]). Molecular weight markers (kb) are shown (Mr).
153
pairs of PCR primers (see Materials and methods). This region (PLSL) was cloned and sequenced; it was 61 bp longer than the smaller accounting for the entire size difference between the two G. pallida P a 2 / 3 amplification products (Fig. 1 and Fig. 6). Amplification from DNA of an isolate of G. pallida Pal in contrast to P a 2 / 3 reveals only a single, lower molecular weight amplification product which co-migrated with the lower molecular weight product from P a 2 / 3 (Fig. 6). Pairs of oligonucleotide PCR primers based on regions of the sequence of B5SL from G. pallida Pa2//3 were used to amplify portions of the Pal DNA. With every primer pair the products amplified from Pal DNA were of a similar size to products expected from the amplification of the small 5S-SL repeat of Pa2/3. In addition Southern blotting of SwaI-digested Pal DNA failed to reveal a SwaI site in Pal DNA (data not shown). We conclude that the major Pal DNA repeat unit is broadly similar in sequence to the small P a 2 / 3 repeat.
4. Discussion
with the complementary version of the SL primer. As can be seen for G. rostochiensis the single major band corresponds to the expected size of 914 bp (calculated from the sequence of the A3SL clone) and for G. pallida two bands are visible, the larger one being very similar in size to the major band in G. rostochiensis. The smaller band corresponds to the 853-bp size expected from the sequence of B5SL. Examination of DNA from numerous G. rostochiensis and G. pallida isolates from Europe and South America have shown identical results i.e. a single major band in all G. rostochiensis pathotypes and two in G. pallida P a 2 / 3 (unpublished observations with C. Fleming). Faint bands corresponding to smaller amplification products are sometimes seen with G. rostochiensis and G. pallida, which may correspond to the shorter version of the basic repeat unit also revealed by Southern blotting (Fig. 3). The presence of two PCR products from G. pallida P a 2 / 3 isolates confirms the existence of the two major size variants identified in the Southern blots. The major region of length difference between the two G. pallida P a 2 / 3 bands was identified using
In this paper, we show that sequences with the characteristics of SL genes exist in plant parasitic nematodes. Nematode trans-spliced leader (SL) RNAs are composed of two domains: a mini-exon (the 22-nt-spliced leader) and a small nuclear RNA (snRNA)-like sequence. The 22-nt sequence is highly conserved amongst nematodes (including potato cyst nematodes). Comparisons of the remainder of the sequence of the SL RNA from a number of different nematodes show a lower degree of homology [3-7]; however, the predicted secondary structure of SL RNAs from a number of nematodes (including the potato cyst nematodes) are very similar (not shown). In vitro experiments in A. lumbricoides demonstrate that the 22-nt sequence is part of a transcribed promoter for the SL RNA gene [16] and plays no part in the splicing reaction itself as it can be replaced by artificial exons [17]. This observation suggests that the extreme conservation of nematode SL sequences has more to do with constraints imposed by transcription than by post transcriptional functions such as trans-splicing. Mutagenic studies of the SL RNA molecule have
154
R. Stratford, R. Shields~Molecular and Biochemical Parasitology 67 (1994) 147-155
pointed out regions of importance for trans-splicing [18]. The splice donor site (GU) immediately following the 22-nt mini-exon and the Sm binding region (AAUUUUGG) are conserved in SL RNAs of all nematodes and are required for splicing. The sequences AUA 5' and AAC 3' of the Sm binding site are conserved in a number of nematodes including potato cyst nematodes. The sequence GUGGC is found nine nucleotides upstream of the first adenosine of the Sm binding site in potato cyst nematode (Fig. 1) as well as a number of other nematodes where SL RNAs are linked to 5S genes [18]. Interestingly the sequence in the independent SL2s of C. elegans and A. cantonensis (where the SL gene is also unlinked to the 5S gene) both have GUCAAA at the equivalent position. In this paper we show that in potato cyst nematode (as in a number of other nematodes) the 5S rRNA and SL RNA genes are associated in tandemly repeated units. This arrangement is not confined to nematodes but present in some species of trypanosomes [19] and Euglena [20] where the sequence of the SL RNA is quite different from that of nematodes. The functional significance of this arrangement (if any) is obscure; it has nothing to do with co-transcription as the 5S gene is transcribed by RNA polymerase III whereas the SL RNA gene is transcribed by RNA-polymerase II [20]. The 5S rRNA genes we have sequenced from G. rostochiensis and G. pallida differ in a single nucleotide and show extensive homology (86-89%) to 5S genes from other nematode species. The length of spacer DNA between the 5S rRNA and SL RNA genes varies in different nematodes. In potato cyst nematodes it is more than 700 bp; the corresponding distance in C. elegans is approximately 500 bp [12, see Fig. 6] in A. lumbricoides it is 380 nucleotides [5, and see Fig. 6] and in D. immitis and O. volvulus it is 104 nucleotides [4]. Despite the observation that sequences in this region contribute to the promoter of the SL RNA gene [16] there is little sequence homology between nematode species in this region. These results show that the length of the basic repeat varies in different nematode species and our results (Fig. 3) suggest that length variation may exist within a single species of nematode and between different pathotypes of the same species of potato cyst nematode (Fig. 6). It is likely that this variation could be
used to form the basis of a potato cyst nematode specific diagnostic test.
Acknowledgements We thank Colin Fleming for supplying many of the potato cyst nematode populations used in this study, Barry Kingston for Ascaris DNA and Trevor Hawkins for C. elegans DNA.
References [1[ Nilsen, T.W. (1989) Trans-splicing in Nematodes. Exp. Parasitol. 69, 413-416. [2] Nelson, D.W. and Honda B.M. (1985) Genes coding for 5S ribosomal RNA of the nematode Caenorhabditis elegans. Gene 38, 245-251. [3] Takacs, A.M., Denker, J.A., Perrine, K.G., Maroney, P.A. and Nilsen, T.W. (1988) A 22-nucleotide spliced leader sequence in the human parasitic nematode Brugia malayi is identical to the trans-spliced leader exon in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 85, 7932-7936. [4] Zeng, W., Alarcon, C.M. and Donelson, J.E. (1990) Many transcribed regions of the Onchocerca volvulus genome contain the spliced leader sequence of Caenorhabditis elegans. Mol. Cell. Biol. 10, 2765-2773. [5] Nilsen, T.W., Shambaugh, J., Denker, J., Chubb, G., Faser, C., Putnam, L. and Bennett, K. (1989) Characterization and expression of a spliced leader RNA in the parasitic nematode Ascaris lumbricoides var. suum. Mol. Cell. Biol. 9, 35433547. [6] Bektesh, S., van Doren, K. and Hirsh, D. (1988) Presence of the Caenorhabditis elegans spliced leader on different mRNAs and in different genera of nematodes. Genes Dev. 2, 1277-1283. [7] Joshua, G.W.P., Chuang, R.Y., Gheng, S.C., Lin, S.F., Tuan, R.S. and Wang, C.C. (1991). The spliced leader of Angiostrongylus cantonensis Mol. Biochem. Parasitol. 46, 209218. [8] Huang, X-Y. and Hirsh, D. (1989). A second trans-spliced RNA leader sequence in the nematode Caenorhabditis elegans Proc. Natl. Acad. Sci. USA 86, 8640-8644. [9] Stratford, R., Shields, R., Goldsbrough, A.P. and Fleming, C. (1992) Analysis of repetitive DNA sequences from potato cyst nematodes and their use as diagnostic probes. Phytopathology 82, 881-886. [10] Schnick, D., Rumpenhorst, H.J. and Burgermeister, W. (1990) Differentiation of closely related Globodera pallida (Stone) populations by means of DNA restriction fragment polymorphisms (RFLPs). J. Phytopathol. 130, 127-136. [11] Ransohoff, R.M., Denker, J.A., Takacs, A.M., Hannon, G.J. and Nilsen, T.W. (1989) Organization and expression of 5S
R. Stratford, R. Shields/Molecular and Biochemical Parasitology 67 (1994) 147-155
[12]
[13]
[14]
[15]
rRNA genes in the parasitic nematode, Brugia malayi Nucleic Acids Res. 17, 3773-3782. Nelson, D.W. and Honda B.M. (1989) Two highly conserved transcribed regions in the 5S DNA repeats of the nematodes Caenorhabditis elegans and Caenorhabditis briggsae Nucleic Acids Res. 17, 8657-8667. Vahidi, H., Purac, A., LeBlanc, J.M. and Honda B.M. (1992) Characterization of a potentially functional 5S rRNA encoding genes within ribosomal DNA repeats of the nematode Meloidogyne arenana. Gene 108, 281-284. Nilsen, T.W., Shambaugh, J., Denker, J., Chubb, G., Faser, C., Putnam, L. and Bennett, K. (1989) Characterization and expression of a spliced leader RNA in the parasitic nematode Ascaris lumbricoides var. suum. Mol. Cell Biol. 9, 35433547. Kumazaki, T., Hod, H., Osawa, S., Ishii, N. and Suzuki, K. (1982). The nucleotide sequences of the 5S rRNAs from a rotifer, Brachionus plicatillis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans. Nucleic Acids Res. 10, 7001-7004.
155
[16] Hannon, G.J., Maroney, P.A., Ayers, D.G., Shambaugh, J.D. and Nilsen, T.W. (1990) Transcription of a nematode transspliced leader RNA requires internal elements for both initiation and 3' end formation. EMBO.J. 9, 1915-1921. [17] Maroney, P.A., Hannon, G.J., Shambaugh, J.D. and Nilsen, T.W. (1991). Intramolecular base pairing between the nematode spliced leader and in 5' splice site is not essential for trans-splicing in vitro. EMBO.J. 10 3869-3875. [18] Hannon, G.J., Maroney, P.A., Yu, Y-T., Hannon, G.E. and Nilsen, T.W. (1992) Interaction of U6 snRNA with a sequence required for function of the nematode SL RNA in Trans-splicing. Science 258, 1775-1780. [19] Aksoy, S., Shay, G.L., Villanueva, M.S., Beard, C.B. and Richards, F.F. (1992) Spliced leader RNA sequences of Trypanosoma rangeli are organised within the 5S rRNA-encoding genes. Gene 113, 239-243. [20] Keller M., Tessier, L.H., Chan, R.L., Weil, J.H. and Imbault, P. (1992) In Euglena, spliced-leader RNA (SL-RNA) and 5S rRNA genes are tandemly repeated. Nucleic Acids Res. 20, 1711-1715.