A transcriptionally regulated expression vector for the fission yeast Schizosaccharomyces pombe

413

Gene, 84 (1989) 473-479

Elsevier GENE 03264

A transcriptionally

regulated expression vector for the fission yeast Schizosaccharomycespombe

DNA; regulated transcription; scriptional fusions)

(Recombinant

fructose bisphosphatase gene; glucose repression; IucZ tran-

Charles S. Hoffman and Fred Winston Department of Genetics, Harvard Medical School, Boston, MA 02115 (U.S.A.) Received by G.R. Fink: 19 June 1989 Accepted: 25 July 1989

SUMMARY

An expression vector for the fission yeast Schizosaccharomyces pombe is described. The vector is designed to facilitate the construction of transcriptional fusions to the promoter of the S. pombe fructose bisphosphatase gene. Transcription from this promoter is regulated by glucose repression over a range of greater than lOO-fold. The tight regulation by this promoter should allow for the maintenance of genes whose products are lethal to S. pombe and for the high level production of their protein or RNA products. Intermediate levels of expression can also be achieved by growth on different carbon sources.

INTRODUCTION

Expression vectors that direct the transcription of heterologous sequences are a common tool in molecular biology. Generally, the promoters used in Correspondenceto: Dr. F. Winston, Department of Genetics, Harvard Medical School, 25 Shattuck St., Boston, MA 02115 (U.S.A.) Tel. (617)732-7556; Fax (617)732-7663. Abbreviations: aa, amino acid(s); Ap, ampicillin; ARS, autonomously replicating sequence; /IGal, &+lactosidase; bp, base pair(s); FBPase, fructose bisphosphatase; jbp, gene encoding FBPase; kb, kilobase or 1000 bp; nt, nucleotide(s); ORF, open reading frame; on’, origin of DNA replication; PCR, polymerase chain reaction; PolIk, Klenow (large) fragment of E. coli DNA polymerase I; S., Schizosaccharomyces; SC-URA, see Table I; SDS, sodium dodecyl sulfate; TCA, trichloroacetic acid; TE, 10 mM Tris pH 8.0/l mM EDTA; tip, transcriptional start point(s); Ty, Saccharomyces cerevirine transposable element; wt, wild type; YEL; 0.5% yeast extract liquid medium; [ 1, denotes plasmid-carrying state; ::, novel joint (fusion). 0378-1119/89/$03.50

such vectors are both strong and subject to some form of regulation, so that one can determine the effect of varying the amount of the product under investigation. For example, the Saccharomyces cerevisiae GAL1 and GAL10 promoters, which are subject to induction by galactose and repression by glucose (for a review, see Johnston, 1987), are commonly used in Succh. cerevisiae expression vectors. In the fission yeast Spombe, the two reported expression vectors use high-level constitutive promoters. One vector uses the S. pombe alcohol dehydrogenase promoter (Russell and Nurse, 1986) while the other uses an unidentified S. pombe promoter (Kudla et al., 1988). We describe a new vector that contains the strong promoter from the S. pombe fbp gene. This gene is subject to tight glucose repression: expression is virtually off in media that contain 8 y0 glucose and is on at a very high level in non-repressing carbon sources. This regulation has been shown to occur at

D 1989 Elsevier Science Publishers B.V. (Biomedical Division)

414

the transcriptional level (Vassarotti and Friesen, 1985). Levels of expression from the j&p expression vector described in this report can be altered over greater than a loo-fold range by varying the carbon source in the medium. This vector also allows intermediate levels of expression to be achieved on particular carbon sources.

EXPERIMENTAL

AND DISCUSSION

(a) Analysis of the Jbp promoter The initial step in construction of an expression vector using the jbp promoter was to further characterize the putative clone of the jbp gene. Mutant alleles fbp-6 and fbp-16 define the fbp gene of S. pombe (Vassarotti et al., 1982). Clones carried on plasmids pAV04 and pAV06 restore FBPase activity

A

ti:

CTAG

c

strains carrying either of these mutations (Vassarotti and Friesen, 1985) and were presumed to contain the fbp structural gene. We have shown that the insert in pAV06 directs plasmid integration to the jbp locus (C.S.H. and F.W., in preparation). Sequence analysis of 1569 bp of the insert DNA carried in pAV06 revealed part of a large ORF encoding a protein homologous to pig FBPase (Marcus et al., 1982). Our sequence data, which include from -857 to + 702 relative to the start codon, agree with those of Rogers et al. (1988) who determined the sequence of the entire S. pombe jbp gene from pAV06. To better define the fbp promoter, we have determined the tsp of the jbp gene by both primer extension and Sl analysis. Based on both of those methods, the primary tsp is 272 bp upstream from the start codon (Fig. 1). The primer extension analysis suggests that there may be a second tsp at + 8 (with + 1 indicating the position of the primary tsp), while to

D

R

RDCTAG

-26

TTTTTGTAAATATATAAATAGTGGCGGGCAGCAGTCAAGGTGAAACG Fig. 1. Analysis of the tspfor the fbp gene. (Panel A) Primer extension analysis (Hahn et al., 1985) of the jbp tspwas performed using the primer CSH3,5’-d(GTGTGACAATGTCAGTGTCG)-3’, which hybridizes to a region 30 bp downstream from thejbp start codon. CSH3 was labeled with [y-‘aP]ATP (Du Pont, NEN Research Products, Wilmington, DE) by T4 polynucleotide kinase (New England Biolabs Inc., Beverly, MA; Maniatis et al., 1982). Approx. 5 ng of puritied primer was hybridized to 6/rg total RNA (Carlson and Botstein, 1982) isolated from strain FWP6 (h- [eul-32) grown in either repressing (R; YEL with 3% glucose; Gutz et al., 1974) or derepressing (D; YEL with 3% glycerol) conditions. Primer extension products were analyzed on 6% polyacrylamide/8 M urea gels adjacent to sequencing ladders obtained by sequencing an M 13 clone of the jbp gene using the same primer and the Sequenase DNA Sequencing Kit (United States Biochemical Corp., Cleveland, OH). An arrow marks the position of tsp(+ 1). (Panel B) Sl analysis of tspwas performed using a probe created by extending kinase-labeled primer CSH3 hybridized to an Ml3 clone of the fip gene and digesting the product with HpuI, which cleaves the DNA 1 kb upstream from the start codon. The purified probe was hybridized to total RNA from cells grown under repressing and derepressing conditions (described in panel A) and subjected to S 1 digestion (Nasmyth, 1983). S l-protected products were analyzed as described in panel A. An arrow indicates the position of tsp( + 1). (Panel C) The sequence of the fbp promoter region is shown. A putative TATA box (underlined) is present beginning at position -26 relative to tsp( + 1).

415

the S 1 analysis indicates that tsp may also be found at positions + 2 through + 7. However, potential artifacts associated with both of these analytical techniques make it difficult to determine if these additional sites are functional. As expected, the first ATG present in the transcript is at the start of thefbp open ORF. A consensus TATA box, TATAAA, is present beginning at position -26 relative to the tsp.

/’

‘.

-\

GGGATATC AGATCT AAGCTT

Fig. 2. Construction of pCHY21. Plasmid pCHY21 was constructed as follows. Plasmid pFL20zlXhoI (see section b) was subjected to PvaII + MeI digestion, and the DNA fragment, containing the S. pombe ARS, the Sacch. ceretiiae UR.43 gene (conferring uracil prototrophy to Ural - S. pombe strains), the bla gene (conferring Ap resistance to E. cob strains) and the pBR322 ori, was isolated. This DNA was combined by ligation with DNA created by subjecting plasmid pAV06 (Vassarotti and Friesen, 1985) to a PCR reaction using primers CSH13 5’-d(CGCGCCCGGGATATCAGATCTAAGCTTTACCTTTACCTTTAAGAATTGAC)-3’ and CSHl5 5’-d(GCGCGCTAGCCAGCTGGGATCCCTCGAGGATGGAGTAAACGAAACCTG) -3’ using the GeneAmp DNA Amplification Reagent Kit (as described by the manufacturer; Perkin Elmer Cetus, Norwalk, CT). Primers CSH13 and CSH15, indicated by thick arrows, hybridize to sequences in the 5’noncoding region of thefbp gene (the coding region is the shaded portion of the jbp insert in pAV06). The PCR-generated DNA was subjected to SmaI + NheI endonuclease digestion to create the appropriate ends for ligation.

(b) Construction of the expression vector pCHY21

The expression vector pCHY21 was constructed by inserting sequences from the Jbp promoter into a derivative of the S.pombe vector pFL20 (Losson and Lacroute, 1983). pFL20 possesses an S. pombe ARS and the pBR322 on’ which allow it to replicate autonomously in either S. pombe or Escherichia coli. Prior to insertion of the jbp promoter, pFL20 was linearized at a unique XhoI site near the ARS. The ends were filled in by PolIk, and the DNA was recircularized by T4 DNA ligase, creating plasmid pFL20dXhoI. This procedure removed theXho1 site, created a new PVUI site, and has no apparent effect on ARS function as judged by transformation frequency. This step was taken to have a unique XhoI site in the polylinker adjacent to the jbp promoter in pCHY2 1. A 1.8-kb fragment possessing the fbp promoter flanked by restriction sites was created by PCR on a pAV06 template and inserted into pFL20dXhoI by ligation (Fig. 2). A polylinker including the unique restriction sites XhoI, BarnHI, PvuII, and ZVheIis present immediately downstream from the region encoding the 272-nt leader sequence. Five independently isolated plasmid candidates were analyzed by Northern analysis in strains grown under repressing (8% glucose) and derepressing (0.1 y0 glucose + 3 y0 glycerol) conditions. The same pattern of transcription under these two conditions was seen for all five candidates. Therefore, if any of these plasmids carried PCR-induced mutations, we do not believe that such mutations affect the regulation of the _fbptranscript. One of the plasmids was designated pCHY21 and used for all subsequent studies. (c) Regulated expression of fiGal in pCHY21 derivatives

Two transcriptional fusions of the E. coli 1acZ gene, encoding /IGal, were constructed by inserting this gene at either the XhoI site or the BamHI site of plasmid pCHY21, generating plasmids pCHY23 and pCHY24, respectively. The 1acZ sequences were obtained from plasmid pCHY22, which encodes the entire ZacZ ORF preceded by an EcoRI-SmaIBarnHI-XhoI-Hind111 polylinker. The /IGal encoded by pCHY22 differs from wt /IGal by a Leu --) Asp change at aa 8 and an Ala + Pro change at aa 9 as a result of the plasmid construction.

476

To determine the extent of regulation conferred by the& promoter, /IGal activity was assayed in strain FWPl (h - 1~~4-294) carrying either pCHY23 or pCHY24 under repressing (8% glucose) or derepressing (0.1 y0 glucose + 3 % glycerol) growth conditions (Table I). As expected, the level of /IGal activity is subject to glucose repression and is regulated over a greater than lOO-fold range. Although a medium containing 3% glycerol as the sole carbon source may give rise to an even higher level of expression, we do not recommend such a medium considering the extremely poor growth of S. pombe under such conditions. We have also observed that, while transcription from the jbp promoter is strongly repressed in exponential-phase cells growing in the presence of 8% glucose, there is an increase in expression as cells enter late-exponential phase and stationary phase. In one set of experiments, cells grown to 8 x 10’ cells/ml in 8% glucose possessed 807 + 141 units of BGal activity (three transformants, assayed four to six times). While this feature may provide a straightforward method for producing large quantities of a gene product in S. pombe, it could present problems in the case of products that are lethal to the cell. Also, since derepression will take place in the stationary phase cells in the center of a colony growing on solid medium, it may be necessary to study cells growing in liquid culture to avoid potential artifacts. One should not assume that TABLE I Expression offbp: :lucZ fusions under repressing and derepressing conditions Plasmid”

Intermediate expression from the fbp promoter Carbon sourcea

/IGal activity b

3.0% 0.2% 0.5 % 1.O%

523 f 289 + 88 f 55k

maltose glucose glucose glucose

78 37 12 6

* Strain FWPl[pCHY24] was grown to 10’ cells/ml in SC-URA containing the described carbon sources. b Three transformants were assayed two to six times (see Table I). The values given represent means k standard errors.

expression from the jbp promoter, in cells grown on plates containing 8% glucose, is repressed past a single day of growth. We have also examined fiGal activity in FWPl[pCHY24] grown in media containing various concentrations of glucose or maltose (Table II), and observed intermediate levels of expression. This ability to adjust the amount of transcription from the jbp promoter to any of several levels makes this vector extremely useful for studying the effect of producing a range of amounts of a particular gene product in S. pombe. However, we again caution that further derepression will occur as cells leave midexponential phase. A time course of induction of BGal activity in FWPl[pCHY23] and FWPl[pCHY24] was carried out to determine the level of expression from the fbp

TABLE III Time course of fbp: : 1acZ induction

BGal activity b Repressed

TABLE II

Derepressed

Time after shift”

BGal activity b

(h) pCHY23 pCHY24

31 * 4 23 f 2

4705 f 403 4105 + 430 0.0

a Strains FWPl [pCHY23] and FWPl [pCHY24] were grown to approx. IO’ cells/ml in SC-URA, a synthetic complete medium lacking uracil (Sherman et al., 1978), with either 8% glucose (repressing conditions) or 0.1% glucose + 3 % glycerol (derepressing conditions). b /?Gal activity was assayed in four transformants three to eleven times for both conditions (Rose and Botstein, 1983), and the specitic activity per mg of protein was determined. Protein concentrations were determined by the assays of Bradford (1976) using bovine serum albumin as a standard. The values given represent means + standard errors.

2.5 5.0 7.5 25.0

FWP 1[pCHY23]

FWPl[pCHY24]

58 910 1706 4001 6640

48 748 1636 2926 6113

a Cells were grown to approx. 10’ cells/ml in SC-URA with 8 % glucose at 30°C. After washing twice in sterile water, cells were transferred to SC-URA 0.1% glucose + 3% glycerol at 30°C. b An average of two assays (see Table I) using different volumes of protein extract is given. The standard errors were less than 9 % . The numbers indicate /IGal-specific activity.

411

promoter at various times after a shift from a repressing to a derepressing medium (Table III). Two representative experiments are shown. In a total of eight experiments, variation within a range of about twofold was seen. This may be due to a gradual depletion of glucose in the medium by growing cells, which would alter the level of induction of transcription from the fbp promoter. In general, we observed a 16-fold increase in expression after 2.5 h, a 30-fold increase after 5 h, and a greater than 60-fold increase after 7.5 h. By 25 h, the cells had entered stationary phase and possessed extremely high levels of fiGal. At greater than 6000 units/mg of protein, this represents approx. 2% of the total protein in the cell. Northern hybridization analysis of RNA from strains FWPl[pCHY23] and FWPl[pCHY24] grown under repressing or derepressing conditions has performed to determine whether the difference in /IGal activity was accompanied by a similar change in RNA levels (Fig. 3). In cells grown under repressing conditions, no lad transcript could be detected. Cells grown under derepressing conditions possess an abundant 6800-nt transcript that hybridizes to a IacZ probe. Therefore, the difference in RNA levels between repressed and derepressed conditions is consistent with the /IGal activity levels. The size of this transcript suggests that termination occurs in the S. pombe ARS sequence. While the lack of a transcription termination sigx# immediately downstream from the insert does not prevent highlevel expression of the 1acZ gene, it is possible that the level of expression could be elevated by the inclu-

pCHY23 pCHY24 R

D

R

D

fbp-/a2

ied Fig. 3. Northern-blot analysis offbp::lucZ transcription in cells grown under repressing and derepressing conditions. Total RNA was isolated from strains FWPl [pCHY23] and FWPl [pCHY24] grown as described in Table I. This RNA was subjected to Northern-hybridization analysis using the dextran sulfate method with GeneScreen (Du Pont, NEN Research Products, Wilmington, DE; used as described by the manufacturer). A PstI fragment carrying IacZ from pMC1871 (Casadaban et al., 1983) was used to probe the fbp::lacZ transcript. RNA levels were standardized by probing with pYK311 which carries the S. pombe led gene in pBR322 (Kikuchi et al., 1988).

sion of such a signal. This may be a consideration for those wishing to achieve maximal levels of expression using this vector. Finally, we examined /IGal levels by Western-blot analysis in strain FWPl[pCHY24] grown under repressed and derepressed conditions (Fig. 4). Simi-

B 205~

+

D

R

MRD .

‘YI r,

i1697-

45/’

J

29-

Fig. 4. Western-blot analysis of /IGal produced in FWPl[pCHY24] grown under repressing and derepressing conditions. Protein was isolated from FWPl[pCHY24] grown as described in Table I by TCA precipitation of proteins onto glass beads (Ohasi et al., 1982) and subjected to 9% polyactylamide gel electrophoresis. (Panel A) Lanes loaded with 5 pl of protein extract from cells grown under repressed (R) and derepressed (D) conditions were analyzed by Coomassie blue staining to standardize the amount of protein loaded. Protein size standards (lane M), composed of rabbit muscle myosin (205 kDa), fiGal (116 kDa), rabbit muscle phosphorylase B (97 kDa), bovine plasma albumin (66 kDa), ovalbumin (45 kDa), and bovine erythrocyte carbonic anhydrase (29 kDa), were loaded in the adjacent lane as a size marker. (Panel B) A second set of lanes were loaded with 20 nl of protein extracts from FWPl [pCHY24]. These proteins were transferred to nitrocellulose by electrophoresis (Towbin et al., 1979) and probed with a mouse monoclonal antibody which recognizes BGal (Promega Biotec, Madison, WI). This was visualized using a secondary antibody conjugated to alkaline phosphatase (Promega Biotec, Madison, WI).

478

lar to the results obtained by Northern hybridization analysis of the ZacZ-specific RNA (Fig. 3), /IGal is not detected in cells grown under repressed conditions and is present in large quantities in cells grown under derepressed conditions. Therefore, the changes in /3Gal activity observed under the different growth conditions are due to production of the protein and not due to some post-translational event in the cell. A similar analysis was performed on cells carrying an jbp: : SPT3 fusion. SPT3 encodes a &XC/Z.cerevisiue protein required for Ty transcription (Winston et al., 1984). While we were able to detect SPT3 protein only in cells grown under derepressing conditions (not shown), due to the low titer of the a-SPT3 antibodies, we could not determine whether the SPT3 protein was expressed to as high a level as was seen for the 6Ga.l protein. The ability to regulate the expression of the SPT3 gene demonstrates the general usefulness of this system. (d) Conclusions We have demonstrated that the expression vector pCHY21 can be used in S. pombe to direct the regulated expression of heterologous sequences. This vector will be useful for studies on the effect of the production of proteins from S. pombe or from other organisms on cellular processes in S. pombe. The fbp promoter is advantageous for such studies since it cannot only be turned off and on, but also set to various levels of expression on different carbon sources. Furthermore, cloning into this vector is facilitated by the presence of a polylinker containing four unique restriction sites. The one possible complication to this system is the fact that derepression occurs upon entry into stationary phase. However, this need not be a problem as long as appropriate steps are taken to address this characteristic, as described in section c. The availability of a regulated expression vector should allow for new approaches to the analyses of various cellular processes in S. pombe.

ACKNOWLEDGEMENTS

We thank John Armstrong and Jef Boeke for valuable discussions and suggestions during the

course of this work. We also thank James Friesen for his generous gift of plasmid pAV06. We thank Michele Swanson and Elizabeth Malone for critical reading of the manuscript. This work was supported by American Cancer Society postdoctoral grant PF-2853 to C.S.H., National Science Foundation grant DCB8451649 and a grant from the Stroh Brewery Company to F.W., and in part by a grant from the Lucille P. Markey Charitable Trust.

REFERENCES Bradford, M.M.: A rapid and sensitive method for the quantitation of microgram quantities of protein utiliiing the principle of protein-dye binding. Anal Biochem. 72 (1976) 248-254.

Carlson, M. and Botstein, D.: Two differentially regulated mRNAs with different 5’ ends encode secreted and intracellular forms of yeast invertase. Cell 28 (1982) 145-154. Casadaban, M., Martinez-Arias, A., Shapiro, S. and Chou, J.: /l-Galactosidase gene fusions for analyzing gene expression in E. cob and yeast. Methods Enzymol. 100 (1983) 293-308. Gutz, H., Heslot, H., Leupold, U. and Loprieno, N.: Schizosaccharomycespombe. In King, R.C. (Ed.), Handbook of Genetics 1, Plenum, New York, 1974, pp. 395-446. Hahn, S., Hoar, E.T. and Guarente, L.: Each of three ‘TATA elements’ specifies a subset of the transcription initiation sites at the CYC-1 promoter of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 82 (1985) 8562-8566. Johnston, M.: A model fungal gene regulatory mechanism: the GAL genes of Saccharomyces cerevisiae. Microbial. Rev. 51 (1987) 458-476. Kikuchi, Y., Kitazawa, Y., Shimatake, H. and Yamamoto, M.: The primary structure of the led + gene of Schizosaccharomyces pombe. CUT. Genet. 14 (1988) 315-379. Kudla, B., Persuy, M.-A., Gaillardin, C. and Heslot, H.: Construction of an expression vector for the fission yeast Schizosaccharomyces pombe. Nucleic Acids Res. 16 (1988) 8603-8617. Losson, R. and Lacroute, F.: Plasmids carrying the yeast OMP decarboxylase structural and regulatory genes: transcription regulation in a foreign environment. Cell 32 (1983) 371-377. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Marcus, F., Edelstein, I., Reardon, I. and Heinrikson, R.L.: Complete amino acid sequence of pig kidney fructose1,6-bisphosphatase EC 3.1.3.11. Proc. Natl. Acad. Sci. USA 79 (1982) 7161-7165. Nasmyth, K.: Molecular analysis of a cell lineage. Nature 302 (1983) 670-676. Ohasi, A., Gibson, J., Gregor, I. and Schatz, G.: Import of proteins into mitochondria: the precursor of cytochrome c, is processed in two steps, one of them heme-dependent. J. Biol. Chem. 257 (1982) 13042-13047.

479 Rogers, D.T., Hiller, E., Mitsock, L. and Orr, E.: Characterization of the gene for fructose-Ldbisphosphatase from Stzcch~romyces cereviriae and Schizosa~romy~es pombe. J. Biol. Chem. 263 (1988) 6051-605’7. Rose, M. and Botstein, D.: Construction and use ofgene fbsions to ZacZ (&galactosidase) that are expressed in yeast. Methods Enzymol. 101 (1983) 167-180. Russell, P. and Nurse, P.: c&25 + functions as an inducer in the mitotic control of fission yeast. Cell 45 (1986) 145-153. Sherman, F., Fink, G.R. and Lawrence, C.W.: Cold Spring Harbor Laboratory Manual for a Course, Methods in Yeast Genetics, Revised edition. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1978.

Towbin, H., Staehelin, T. and Gordon, J.: Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 79 (1979) 4350-4354. Vassarotti, A. and Friesen, J.D.: Isolation of the fructose1,6-bisphosphatase gene of the yeast Schizasaccharomyces pombe. J. Biol. Chem. 260 (1985) 6348-6353. Vassarotti, A., Boutry, M. and Colson, A.M.: Fructose-bisphosphatase-deficient mutants of the yeast Schizosaccharomyces pombe. Arch. Microbial. 133 (1982) 131-136. Winston, F., Durbin, K.J. and Fink, G.R.: The SPT3 gene is required for normal transcription of Ty elements in S. cerevisiae. Cell 39 (1984) 675-682.