- Email: [email protected]
anti-CD16 bispecific antibody retargeting NK cells against human breast cancer cells
BBRC Biochemical and Biophysical Research Communications 311 (2003) 307–312 www.elsevier.com/locate/ybbrc
A trivalent anti-erbB2/anti-CD16 bispecific antibody retargeting NK cells against human breast cancer cells Zhigang Xie, Ming Shi, Jiannan Feng, Ming Yu, Yingxun Sun, Beifen Shen, and Ning Guo* Department of Molecular Immunology, Institute of Basic Medical Sciences, Taiping Road 27, Beijing 100850, PR China Received 29 September 2003
Abstract Bispecific antibody (BsAb) can physically cross-link immune cells to tumor cells, circumventing the proper structures for tumor cell–immune cell interactions and activating the cellular cytotoxic mechanisms. The optimal BsAb should target tumor cells with high affinity, but activate trigger molecules on cytotoxic cells by monovalent binding of Fab fragments. In the present study, a trivalent anti-erbB2/anti-CD16 BsAb was produced. This BsAb possesses bivalent arms specifically binding to the extracellular domain of erbB2 and monovalent Fab fragment redirecting NK cells. The recombinant protein could be expressed and purified from Escherichia coli as native proteins without refolding. It was fully functional in bispecific binding to SKBR3 and NK cells. The molecular size of this trivalent BsAb protein is larger than diabody and smaller than whole antibody and expected to have advantages for both high penetration of small antibody fragments and the slow circulation clearance of whole antibody. This novel protein may be an attractive target for further improvement and evaluation. Ó 2003 Elsevier Inc. All rights reserved. Keywords: Bispecific antibody; Fc receptor; Immunotherapy; CD16; ErbB2; Tumor targeting
The potential for using monoclonal antibodies (mAb) on tumor immunotherapy has received much attention in cancer research. A number of antibodies show considerable efficacy and are now FDA-approved therapeutics. Although mAbs are able to achieve antitumor effects by inducing antibody-dependent cellular cytotoxicity (ADCC) or complement-mediated cytotoxicity (CDC), clinical data show that there is urgent need to enhance the efficacy of the current generation of anticancer antibodies. IgG Fc receptors (FccR) play a critical role in linking IgG antibody-mediated immune responses with cellular effector functions [1,2]. In order to induce cell-mediated killing mechanisms against tumor cells, mAb must interact with Fc receptors on effector cells to mediate ADCC, phagocytosis, endocytosis, degranulation, and release of inflammatory mediators. However, therapeutic antibodies have to compete with high levels of serum IgG for binding to FccR, especially to FccRI (CD64), * Corresponding author. Fax: +86-10-6821-3039. E-mail address: [email protected] (N. Guo).
0006-291X/$ - see front matter Ó 2003 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2003.09.211
which binds monomeric IgG with high affinity and is usually blocked by endogenous circulating IgG. In addition, the cell surface expression of complement deactivating molecules is an escape mechanism used by tumor cells [3]. Bispecific antibodies (BsAb) have been shown to be able to contribute to an immunological approach in cancer therapy and used clinically for the treatment of refractory Hodgkin’s disease, breast, ovarian, and renal cell cancers [4–7]. In most instances, BsAb are given intravenously. Most possibly they will bind to effector cells first. Therefore, the difference of affinity between trigger and target arms of the BsAb may influence the targeting of BsAb, for example, directly going to the tumor or being carried there by effector cells. It was assumed that the optimal BsAb target tumor cells with high affinity, but activate trigger molecules on cytotoxic cells by monovalent binding of Fab fragments. In the present study, a trivalent anti-erbB2/anti-CD16 BsAb was produced. This BsAb possesses bivalent arms specifically binding to the extracellular domain of erbB2 and monovalent Fab fragment redirecting NK cells.
308
Z. Xie et al. / Biochemical and Biophysical Research Communications 311 (2003) 307–312
Materials and methods Plasmid and gene assembly. All standard cloning procedures were carried out as described by Sambrook et al. Escherichia coli strain BL21(DE3) was used for propagation of plasmids and expression of the antibody. Primers were synthesized from BioAsia company (Table 1). DNA amplification was performed with Vent-DNA polymerase (New England Biolabs). A B88-9 hybridoma cell line producing mouse IgG1 mAb directed to CD16 antigen was used as the source of V region genes. Total RNA was isolated from B88-9 cells and first strand cDNA was prepared using a first strand cDNA synthesis kit (Life Sciences). This cDNA was used as the template for amplification of the VH and VL genes of anti-CD16 mAb. Primers used in the PCRs for the light chain were VL5 and VL3. A synthetic RBS and pelB leader sequence were introduced to the upstream of VH gene by the primers RBS/PelB1, PelB2, and PelB3/VH5. Human IgG1 CH1 and j chain CL genes (kindly provided by Prof. Y.G. Tong, Institute of Biological Engineering) were fused to the carboxy terminus of VH and VL, respectively, to generate chimeric heavy and light chains by overlap extension PCR by primers CL5, CL3, CH15, and CH13. Two anti-erbB2 scFvs (kindly provided by Prof. L. Yu, University of Utah) were amplified either by primers ScFv/EcoRI and ScFv/HindIII or by primers ScFv/NotI and ScFv/XhoI and ligated to both carboxy termini of chimeric heavy and light chain genes. All the fragments obtained with PCR steps were confirmed by sequencing and cloned into plasmid pET-22b(+) (Novagen) by the corresponding restriction sites. The final vector was designated pET22b/BsAb. Expression and purification of antibody. pET22b/BsAb was transformed into E. coli BL 21. Single colonies were grown in LB medium supplemented with 100 mg/L ampicillin. Cells were induced at an OD600 of 0.5 by the addition of 0.25 or 0.5 mM isopropyl-1-thio-b-D galactopyranoside (IPTG) and incubated at 30 °C for 4 h. Then the cells were harvested by centrifugation at 4000g for 10 min at 4 °C. The cell pellets were lysed by freezing/thawing, ultrasonicated three times, and centrifuged. After centrifugation, BsAb in the supernatants was purified by affinity chromatography on Sepharose–protein G column (Pharmacia). SDS–PAGE and immunoblot analysis. Proteins were analyzed on 10% SDS–PAGE under non-reducing or reducing conditions and either stained with Coomassie brilliant blue or transferred onto nitrocellulose membranes. The membranes were treated with blocking buffer consisting of PBS, 0.05% Tween 20, and 5% skim milk at 4 °C overnight, then incubated with horseradish peroxidase (HRP)-conjugated goat-anti-human IgG at 37 °C for 1 h. Binding of HRP labeled antibodies was detected with a substrate for peroxidase.
ELISA. Goat-anti-human IgG at 2 lg/ml in PBS, pH 9.0, was coated onto ELISA plates overnight at 4 °C. Plates were blocked with Tris-buffered saline, 2% bovine serum albumin at 37 °C for 1 h. The culture supernatants, purified proteins, and serial dilution of human IgG were added to the plates and incubated at 37 °C for 1 h. After washing plates, bound antibodies were detected with HRP-conjugated goat-anti-human IgG. The substrate used was o-phenylenediamine dihydrochloride (Sigma). Absorbance at 492 nm was read on a plate reader (Anthos Labtec Instruments). Flow cytometry analysis. SKBR3 cells were incubated with BsAb (100 ng/ml). After washing with PBS plus 0.1% NaN3 , the cells were exposed to FITC-conjugated goat-anti-human IgG. To detect BsAb binding to CD16 on NK cells, human peripheral blood mononuclear cells were incubated with BsAb (100 ng/ml). After washing, cells were incubated with FITC-conjugated goat-anti-human IgG and PE-conjugated goat-anti-human CD56. Stained cells were analyzed by flow cytometry (FACS Calibur, Becton–Dickinson).
Results Construction of a cloning cassette for dicistronic expression A chimeric light chain gene of anti-CD16 was PCRassembled with a 50 primer for light chain variable region (VL) gene including a NcoI site and 30 primer for light chain constant region (CL) gene including a EcoRI site. A chimeric heavy chain gene of anti-CD16 was likewise generated with a 50 primer for heavy chain variable region (VH) gene that contained a HindIII site followed by a synthetic ribosome binding site and a pelB leader sequence and 30 primer for heavy chain constant region (CH1) with a NotI site. VH and VL genes were subsequently cloned into plasmid pET-22b(+) by corresponding restriction sites. Two anti-erbB2 scFvs were amplified with 50 primers containing a EcoRI or NotI site and 30 primers containing stop codons followed by a HindIII or XhoI site, respectively. They were ligated at 30 -ends of both chimeric heavy and light chain genes.
Table 1 Oligonucleotide primers used for amplification and construction of BsAb PCR primers
Sequence
VL5/NcoI VL3 CL5 CL3/EcoRI ScFv5/EcoRI ScFv3/HindIII RBS/PelB1/HindIII PelB2 PelB3/ VH5 VH3 CH15 CH13/NotI ScFv5/NotI ScFv3/XhoI
50 -CATGCCATGGACACCGTGCTGACCCA 50 -TCCGTTTTATTTCCAGC 50 -TGGAAATAAAACGGACTGTGGCTGCACCA 50 -GGAATTCAGAACCACCGCCGCCGCACTCTCCCCTGTTGA 50 -GGAATTCCAGGTACAACTGCAGCA 50 -CCCAAGCTTATTTGATTTCCAATTTTG 50 -CCCAAGCTTAAGGAGGTAAAAAATGAAATATCTGTTGCCGA 50 -AATATCTGTTGCCGACTGCTGCCGCTGGCCTGCTGCTGCTGGCTGCCCAA 50 -CTGCTGGCTGCCCAACCGGCGATGGCTCAAGTTACGCTAAAA 50 -TGGAGGCTGCAGAGACAGTGACCA 50 -TCTCTGCAGCCTCCACCAAGGGCCCA 50 -ATAGTTTAGCGGCCGCTTTGTCACAGGATTTCGGTTCAACTTTCTTGTCCA 50 -ATAAGAATGCGGCCGCTCAGGTACAACTGCAGCA 50 -CCGCTCGAGTTATTATTTGATTTCCAATTT
The restriction sites are underlined.
Z. Xie et al. / Biochemical and Biophysical Research Communications 311 (2003) 307–312
309
of total cell lysates of induced and non-induced culture samples on 10% polyacrylamide–SDS gels followed by immunoblotting using HRP-conjugated goat-anti-human IgG for immunodetection. After induction, the expected bands (calculated molecular mass 50 kDa) were observed under reducing conditions (Fig. 3A).
Fig. 1. (A) Structure of trivalent BsAb construct. P/O, IPTG inducible lac/T7 promoter; RBS, ribosome binding site; pelB, signal peptide sequence of bacterial pectate lyase; VH and VL, heavy and light chain variable region coding sequence of anti-CD16 mAb; CH1 and CL, the first domain of human IgG1 heavy chain constant region and light chain constant region genes; scFv, anti-erbB2 scFv coding sequence. (B) Schematic representation of the dicistronic expression vector pET22b/BsAb. Amp, the ampicillin resistance gene; ori, origin of DNA replication; T7lac, IPTG inducible lac/T7 promoter; VL-CL, a sequence encoding the chimeric light chain of anti-CD16; VH-CH1, a sequence encoding the chimeric heavy chain of anti-CD16.
Fig. 2. Model of the trivalent BsAb protein structure.
Each of the chimeric genes was cloned in-frame between a signal peptide sequence of bacterial pectate lyase, pelB, for secretion of antibodies into the bacterial periplasm and a stop codon. Thus by utilizing single domain of human IgG j chain CL and its natural partner CH1 forming heterodimers, ligating anti-CD16 VH and VL to amino terminals of CH1 and CL, respectively, and fusing anti-erbB2 scFv moieties to both carboxy terminals of CH1 and CL, a final dicistronic expression cassette pET22b/BsAb was constructed (Figs. 1A and B). The ecombinant protein was expressed in E. coli. The structure of BsAb protein is shown schematically in Fig. 2.
Fig. 3. SDS–PAGE analysis of total bacterial cell lysates (A) and periplasmic extracts (B) after 4 h of shaking with and without induction with IPTG. All samples were subjected to thiol reduction with dithiothreitol and boiled before loading. Proteins were visualized by staining with Coomassie blue. (A) Lane 1, marker protein; lanes 2–4, cells transformed with pET22b empty vector; lanes 5–7, cells transformed with pET22b/VLCL-scFv; and lanes 8–10, cells transformed with pET22b/BsAb. (B) Lanes 1–3, cells transformed with pET22b empty vector; lanes 4–6, cells transformed with pET22b/VLCL-scFv; lanes 7–9, cells transformed with pET22b/BsAb; and lane 10, marker protein.
Expression and purification of BsAb The production of BsAb after induction with 0.2 or 0.5 mM IPTG for 4 h was confirmed by electrophoresis
Fig. 4. Immunoblot stained with HRP-conjugated goat-anti-human IgG. Lanes 1 and 3 total bacterial cell lysates and lanes 2 and 4, periplasmic extracts.
310
Z. Xie et al. / Biochemical and Biophysical Research Communications 311 (2003) 307–312
Fig. 5. SDS–PAGE analysis of purified BsAb. Periplasmic extracts were purified by affinity chromatography on Sepharose–protein G column. Proteins were visualized by staining with Coomassie blue.
acrylamide gels. Although the recombinant proteins were mostly associated with the insoluble membrane fraction despite the presence of the pelB leader, a small amount of proteins could be clearly detected as shown in Fig. 3B, demonstrating the expression of the BsAb as soluble proteins in the periplasmic space. Immunoblot experiments with HRP-conjugated goat-anti-human IgG confirmed the identity of the recombinant proteins (Fig. 4). BsAb was purified from the periplasm after induction with optimized IPTG concentrations. After affinity purification using protein G chromatography, the yield of BsAb was approximately 1 mg/L culture (Fig. 5). Then BsAbwas analyzed by flow cytometry for binding activity. Bispecificity analysis of the BsAb protein To confirm the bispecific nature of the BsAb protein, flow cytometry was performed. BsAb was allowed to bind to SKBR3 cells expressing erbB2 molecules and NK cells. The results shown in Fig. 6 clearly demonstrated that it exhibited binding activity to SKBR3 cells. Using PE-labeled mouse anti-human CD56 gating in two-color flow cytometric immunophenotyping the binding activity of BsAb to NK cells was analyzed. Dual positive cells were clearly resolved, indicating that the trivalent BsAb was correctly assembled and the recombinant BsAb protein was able to bind to NK cells with its unique binding site (Fig. 7).
Fig. 6. Flow cytometry analysis of BsAb reactivity with erbB2 on SKBR3 cells. SKBR3 cells were incubated with BsAb (100 ng/ml). After washing with PBS plus 0.1% NaN3 , the cells were exposed to FITCconjugated goat-anti-human IgG. Dotted line, negative control (stained with FITC-labeled secondary antibody alone); solid line, BsAb.
To confirm the production of soluble BsAb in the correct cell compartment, periplasmic extracts of induced and non-induced bacteria were analyzed on 10% poly-
Discussion BsAb comprises two specificities and can bind to a tumor-associated antigen and a trigger molecule on an immune effector cell, thereby physically cross-linking immune cells to tumor cells, thus circumventing the proper structures for tumor cell–immune cell interactions and activating the cellular cytotoxic mechanisms.
Fig. 7. Dual-color flow cytometry analysis of binding activity of BsAb. Human peripheral blood mononuclear cells were incubated with BsAb (100 ng/ml). After washing, cells were incubated with FITC-conjugated goat-anti-human IgG and PE-conjugated goat-anti-human CD56. The x-axis represents the mean intensity of CD16-FITC fluorescence, whereas the y-axis represents CD56-PE. (A) negative control and (B) BsAb.
Z. Xie et al. / Biochemical and Biophysical Research Communications 311 (2003) 307–312
By using select antibodies, which bind to FccRs via their variable regions outside of the immnoglobulin binding sites, BsAb-mediated cytotoxicity would not be inhibited by endogenous circulating levels of serum IgG, even when FccRs are occupied by IgG [8]. FccRs on NK and myeloid cells are widely investigated cytotoxic trigger molecules for BsAb [9,10]. Increasing evidence points to the importance of FccRIII for the clinical efficacy of therapeutic antibodies [11]. The feasibility of enhancing anti-tumor effects by BsAb and NK cells was demonstrated in clinical trials. The common clinical problem associated with BsAb is that the systemic activation of effector cells results in widespread cytokine release, leading to serious side effects. Therefore, the effector cells should be activated at the tumor site. The prototypic BsAb, a F(ab0 )2 heterodimer, is produced via chemical cross-linking of respective F(ab0 ) fragments of target and trigger molecule antibodies. This type of construct is expensive to produce in large amounts and proved immunogenic in clinical trials when it was generated from murine antibodies. Genetic engineering allows the development of various BsAb formats, aimed at optimizing their structures, minimizing toxicity, and bypassing tedious purification, and so on. Small BsAb fragments can be assembled as diabodies and produced by direct genetic fusion of two specific scFvs [12–14]. It has been reported that diabody (60 kDa) and F(ab0 )2 (120 kDa) gave optimal tumor:blood ratios. However, the major disadvantage of diabody design is that the domain interfaces of the two Fv fragments are not covalently cross-linked and show the dissociation-related aggregation. Bispecific scFv heterodimers can be constructed by a polypeptide linker or helical heterodimerization domains [15–17]. The stability of these constructs under physiological conditions has not been reported and the constructs may give rise to an immune reaction against the heterologous domains. In this paper, heterotypic CL–CH1 domain was utilized as a heterodimerization scaffold for construction of an anti-erbB2/anti-CD16 recombinant trivalent BsAb possessing three antigen binding sites, with two antigen binding sites in the form of scFvs targeting the tumor cells over-expressing erbB2 antigens and only one binding site in the form of Fab triggering immune cells expressing CD16. By decreasing the binding to effector cells, this trivalent BsAb may selectively and directly target tumor cells in vivo. Thus, the side effect caused by induction of ‘cytokine storm’ may be avoided. The novel molecules were secreted from E. coli in correctly folded heterodimers formed by covalently linking of CL and CH1 domains. Folding and correct dimerization of the protein are not hindered by fusing scFvs to the carboxyl terminals of Fab chains. The domain assembly led to a trivalent BsAb, which is fully
311
functional in bispecific binding and in cross-linking of effector cells with tumor cells. The molecular size of this trivalent BsAb protein (100 kDa), larger than diabody and smaller than F(ab0 )2 , is expected to have advantage for both high penetration and slow circulation clearance and thus result in high tumor uptake and reasonable half-lives, which makes it an attractive target for further improvement and evaluation.
Acknowledgments We are very grateful to Prof. Lei Yu for help, advices and providing anti-erbB2 scFv. We thank Prof. Yigang Tong for gift of human IgG1 CH1 and j chain CL genes. This work was supported by 863 Program (2001AA215081).
References [1] Y.M. Deo, R.F. Graziano, R. Repp, J.G. van de Winkel, Clinical significance of IgG Fc receptors and FccR-directed immunotherapies, Immunol. Today 18 (1997) 127–135. [2] J.V. Ravetch, S. Bolland, IgG Fc receptors, Annu. Rev. Immunol. 19 (2001) 275–290. [3] A. Gorter, V.T. Blok, W.H. Hassnoot, N.G. Ensink, M.R. Daha, G.J. Fleuren, Expression of CD46, CD55, and CD59 on renal tumor cell lines and their role in preventing complement-mediated tumor cell lysis, Lab. Invest. 74 (1996) 1039–1049. [4] F. Hartmann, C. Renner, W. Jung, C. Deisting, M. Juwana, B. Eichentopf, M. Kloft, M. Pfreundschuh, Treatment of refractory Hodgkin’s disease with an anti-CD16/CD30 bispecific antibody, Blood 89 (1997) 2042–2047. [5] F.H. Valone, P.A. Kaufman, P.M. Guyre, L.D. Lewis, V. Memoli, M.S. Ernstoff, W. Wells, R. Barth, Y. Deo, J. Fisher, et al., Clinical trials of bispecific antibody MDX-210 in women with advanced breast or ovarian cancer that overexpresses HER2/neu, J. Hematother. 4 (1995) 471–475. [6] H.H. van Ojik, R. Repp, G. Groenewegen, T. Valerius, J.G. van de Winkel, Clinical evaluation of the bispecific antibody MDXH210 (anti-FcgammaRI anti-HER-2/neu) in combination with granulocyte-colony-stimulating factor (Filgrastim) for treatment of advanced breast cancer, Cancer Immunol. Immunother. 45 (1997) 207–209. [7] B.J. Kroesen, J. Buter, D.T. Sleijifer, R.A. Janssen, W.T. van der Graaf, T.H. The, L. de Leij, N.H. Mulder, Phase I study of intravenously applied bispecific antibody in renal cell cancer patients receiving subcutaneous interleukin 2, Br. J. Cancer 70 (1994) 652–661. [8] P.M. Guyre, R.F. Graziano, B.A. Vance, P.M. Morganelli, M.W. Fanger, Monoclonal antibodies that bind to distinct epitopes on FccRI are able to trigger receptor function, J. Immunol. 143 (1989) 1650–1655. [9] J.A. Titus, P. Perez, A. Kaubisch, M.A. Garrudi, D.M. Segal, Human K/natural killer cells targeted with hetero-cross-linked antibodies specifically lyse tumor cells in vitro and prevent tumor growth in vivo, J. Immunol. 139 (1987) 3153–3158. [10] B. Karpovsky, J.A. Titus, D.A. Stephany, D.M. Segal, Production of target-specific effector cells using hetero-cross-linked aggregates containing anti-target and anti-Fc gamma receptor antibodies, J. Exp. Med. 160 (1987) 1686–1701. [11] R.L. Shields, A.K. Namenuk, K. Hong, Y.G. Meng, J. Rae, J. Briggs, D. Xie, J. Lai, A. Stadlen, B. Li, J.A. Fox, L.G. Presta, High resolution mapping of the binding site on human IgG1 for
312
Z. Xie et al. / Biochemical and Biophysical Research Communications 311 (2003) 307–312
FccRI, FccRII, FccRIII, and FcRn and design of IgG1 variants with improved binding to the FccR, J. Biol. Chem. 276 (2001) 6591–6604. [12] P. Holliger, T. Prospero, G. Winter, “Diabodies”: small bivalent and bispecific antibody fragments, Proc. Natl. Acad. Sci. USA 90 (1993) 6444–6448. [13] O. Perisic, P.A. Webb, P. Holliger, G. Winter, R.L. Williams, Crystal structure of a diabody, a bivalent antibody fragment, Structure 2 (1994) 1217–1226. [14] R.J. Poljak, Production and structure of diabodies, Structure 2 (1994) 1121–1123.
[15] M. Gruber, B.A. Schodin, E.R. Wilson, D.M. Kranz, Efficient tumor cell lysis mediated by a bispecific single chain antibody expressed in Escherichia coli, J. Immunol. 142 (1994) 5368– 5374. [16] W. Mallender, E.W. Voss Jr., Construction, expression and activity of a bivalent bispecific single-chain antibody, J. Biol. Chem. 269 (1994) 199–206. [17] J.D. Jonge, J. Brissinck, C. Heirman, C. Demanet, O. Leo, M. Moser, K. Thielemans, Production and characterization of bispecific single-chain antibody fragments, Mol. Immunol. 32 (1995) 1405–1412.
A trivalent anti-erbB2/anti-CD16 bispecific antibody retargeting NK cells against human breast cancer cells Zhigang Xie, Ming Shi, Jiannan Feng, Ming Yu, Yingxun Sun, Beifen Shen, and Ning Guo* Department of Molecular Immunology, Institute of Basic Medical Sciences, Taiping Road 27, Beijing 100850, PR China Received 29 September 2003
Abstract Bispecific antibody (BsAb) can physically cross-link immune cells to tumor cells, circumventing the proper structures for tumor cell–immune cell interactions and activating the cellular cytotoxic mechanisms. The optimal BsAb should target tumor cells with high affinity, but activate trigger molecules on cytotoxic cells by monovalent binding of Fab fragments. In the present study, a trivalent anti-erbB2/anti-CD16 BsAb was produced. This BsAb possesses bivalent arms specifically binding to the extracellular domain of erbB2 and monovalent Fab fragment redirecting NK cells. The recombinant protein could be expressed and purified from Escherichia coli as native proteins without refolding. It was fully functional in bispecific binding to SKBR3 and NK cells. The molecular size of this trivalent BsAb protein is larger than diabody and smaller than whole antibody and expected to have advantages for both high penetration of small antibody fragments and the slow circulation clearance of whole antibody. This novel protein may be an attractive target for further improvement and evaluation. Ó 2003 Elsevier Inc. All rights reserved. Keywords: Bispecific antibody; Fc receptor; Immunotherapy; CD16; ErbB2; Tumor targeting
The potential for using monoclonal antibodies (mAb) on tumor immunotherapy has received much attention in cancer research. A number of antibodies show considerable efficacy and are now FDA-approved therapeutics. Although mAbs are able to achieve antitumor effects by inducing antibody-dependent cellular cytotoxicity (ADCC) or complement-mediated cytotoxicity (CDC), clinical data show that there is urgent need to enhance the efficacy of the current generation of anticancer antibodies. IgG Fc receptors (FccR) play a critical role in linking IgG antibody-mediated immune responses with cellular effector functions [1,2]. In order to induce cell-mediated killing mechanisms against tumor cells, mAb must interact with Fc receptors on effector cells to mediate ADCC, phagocytosis, endocytosis, degranulation, and release of inflammatory mediators. However, therapeutic antibodies have to compete with high levels of serum IgG for binding to FccR, especially to FccRI (CD64), * Corresponding author. Fax: +86-10-6821-3039. E-mail address: [email protected] (N. Guo).
0006-291X/$ - see front matter Ó 2003 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2003.09.211
which binds monomeric IgG with high affinity and is usually blocked by endogenous circulating IgG. In addition, the cell surface expression of complement deactivating molecules is an escape mechanism used by tumor cells [3]. Bispecific antibodies (BsAb) have been shown to be able to contribute to an immunological approach in cancer therapy and used clinically for the treatment of refractory Hodgkin’s disease, breast, ovarian, and renal cell cancers [4–7]. In most instances, BsAb are given intravenously. Most possibly they will bind to effector cells first. Therefore, the difference of affinity between trigger and target arms of the BsAb may influence the targeting of BsAb, for example, directly going to the tumor or being carried there by effector cells. It was assumed that the optimal BsAb target tumor cells with high affinity, but activate trigger molecules on cytotoxic cells by monovalent binding of Fab fragments. In the present study, a trivalent anti-erbB2/anti-CD16 BsAb was produced. This BsAb possesses bivalent arms specifically binding to the extracellular domain of erbB2 and monovalent Fab fragment redirecting NK cells.
308
Z. Xie et al. / Biochemical and Biophysical Research Communications 311 (2003) 307–312
Materials and methods Plasmid and gene assembly. All standard cloning procedures were carried out as described by Sambrook et al. Escherichia coli strain BL21(DE3) was used for propagation of plasmids and expression of the antibody. Primers were synthesized from BioAsia company (Table 1). DNA amplification was performed with Vent-DNA polymerase (New England Biolabs). A B88-9 hybridoma cell line producing mouse IgG1 mAb directed to CD16 antigen was used as the source of V region genes. Total RNA was isolated from B88-9 cells and first strand cDNA was prepared using a first strand cDNA synthesis kit (Life Sciences). This cDNA was used as the template for amplification of the VH and VL genes of anti-CD16 mAb. Primers used in the PCRs for the light chain were VL5 and VL3. A synthetic RBS and pelB leader sequence were introduced to the upstream of VH gene by the primers RBS/PelB1, PelB2, and PelB3/VH5. Human IgG1 CH1 and j chain CL genes (kindly provided by Prof. Y.G. Tong, Institute of Biological Engineering) were fused to the carboxy terminus of VH and VL, respectively, to generate chimeric heavy and light chains by overlap extension PCR by primers CL5, CL3, CH15, and CH13. Two anti-erbB2 scFvs (kindly provided by Prof. L. Yu, University of Utah) were amplified either by primers ScFv/EcoRI and ScFv/HindIII or by primers ScFv/NotI and ScFv/XhoI and ligated to both carboxy termini of chimeric heavy and light chain genes. All the fragments obtained with PCR steps were confirmed by sequencing and cloned into plasmid pET-22b(+) (Novagen) by the corresponding restriction sites. The final vector was designated pET22b/BsAb. Expression and purification of antibody. pET22b/BsAb was transformed into E. coli BL 21. Single colonies were grown in LB medium supplemented with 100 mg/L ampicillin. Cells were induced at an OD600 of 0.5 by the addition of 0.25 or 0.5 mM isopropyl-1-thio-b-D galactopyranoside (IPTG) and incubated at 30 °C for 4 h. Then the cells were harvested by centrifugation at 4000g for 10 min at 4 °C. The cell pellets were lysed by freezing/thawing, ultrasonicated three times, and centrifuged. After centrifugation, BsAb in the supernatants was purified by affinity chromatography on Sepharose–protein G column (Pharmacia). SDS–PAGE and immunoblot analysis. Proteins were analyzed on 10% SDS–PAGE under non-reducing or reducing conditions and either stained with Coomassie brilliant blue or transferred onto nitrocellulose membranes. The membranes were treated with blocking buffer consisting of PBS, 0.05% Tween 20, and 5% skim milk at 4 °C overnight, then incubated with horseradish peroxidase (HRP)-conjugated goat-anti-human IgG at 37 °C for 1 h. Binding of HRP labeled antibodies was detected with a substrate for peroxidase.
ELISA. Goat-anti-human IgG at 2 lg/ml in PBS, pH 9.0, was coated onto ELISA plates overnight at 4 °C. Plates were blocked with Tris-buffered saline, 2% bovine serum albumin at 37 °C for 1 h. The culture supernatants, purified proteins, and serial dilution of human IgG were added to the plates and incubated at 37 °C for 1 h. After washing plates, bound antibodies were detected with HRP-conjugated goat-anti-human IgG. The substrate used was o-phenylenediamine dihydrochloride (Sigma). Absorbance at 492 nm was read on a plate reader (Anthos Labtec Instruments). Flow cytometry analysis. SKBR3 cells were incubated with BsAb (100 ng/ml). After washing with PBS plus 0.1% NaN3 , the cells were exposed to FITC-conjugated goat-anti-human IgG. To detect BsAb binding to CD16 on NK cells, human peripheral blood mononuclear cells were incubated with BsAb (100 ng/ml). After washing, cells were incubated with FITC-conjugated goat-anti-human IgG and PE-conjugated goat-anti-human CD56. Stained cells were analyzed by flow cytometry (FACS Calibur, Becton–Dickinson).
Results Construction of a cloning cassette for dicistronic expression A chimeric light chain gene of anti-CD16 was PCRassembled with a 50 primer for light chain variable region (VL) gene including a NcoI site and 30 primer for light chain constant region (CL) gene including a EcoRI site. A chimeric heavy chain gene of anti-CD16 was likewise generated with a 50 primer for heavy chain variable region (VH) gene that contained a HindIII site followed by a synthetic ribosome binding site and a pelB leader sequence and 30 primer for heavy chain constant region (CH1) with a NotI site. VH and VL genes were subsequently cloned into plasmid pET-22b(+) by corresponding restriction sites. Two anti-erbB2 scFvs were amplified with 50 primers containing a EcoRI or NotI site and 30 primers containing stop codons followed by a HindIII or XhoI site, respectively. They were ligated at 30 -ends of both chimeric heavy and light chain genes.
Table 1 Oligonucleotide primers used for amplification and construction of BsAb PCR primers
Sequence
VL5/NcoI VL3 CL5 CL3/EcoRI ScFv5/EcoRI ScFv3/HindIII RBS/PelB1/HindIII PelB2 PelB3/ VH5 VH3 CH15 CH13/NotI ScFv5/NotI ScFv3/XhoI
50 -CATGCCATGGACACCGTGCTGACCCA 50 -TCCGTTTTATTTCCAGC 50 -TGGAAATAAAACGGACTGTGGCTGCACCA 50 -GGAATTCAGAACCACCGCCGCCGCACTCTCCCCTGTTGA 50 -GGAATTCCAGGTACAACTGCAGCA 50 -CCCAAGCTTATTTGATTTCCAATTTTG 50 -CCCAAGCTTAAGGAGGTAAAAAATGAAATATCTGTTGCCGA 50 -AATATCTGTTGCCGACTGCTGCCGCTGGCCTGCTGCTGCTGGCTGCCCAA 50 -CTGCTGGCTGCCCAACCGGCGATGGCTCAAGTTACGCTAAAA 50 -TGGAGGCTGCAGAGACAGTGACCA 50 -TCTCTGCAGCCTCCACCAAGGGCCCA 50 -ATAGTTTAGCGGCCGCTTTGTCACAGGATTTCGGTTCAACTTTCTTGTCCA 50 -ATAAGAATGCGGCCGCTCAGGTACAACTGCAGCA 50 -CCGCTCGAGTTATTATTTGATTTCCAATTT
The restriction sites are underlined.
Z. Xie et al. / Biochemical and Biophysical Research Communications 311 (2003) 307–312
309
of total cell lysates of induced and non-induced culture samples on 10% polyacrylamide–SDS gels followed by immunoblotting using HRP-conjugated goat-anti-human IgG for immunodetection. After induction, the expected bands (calculated molecular mass 50 kDa) were observed under reducing conditions (Fig. 3A).
Fig. 1. (A) Structure of trivalent BsAb construct. P/O, IPTG inducible lac/T7 promoter; RBS, ribosome binding site; pelB, signal peptide sequence of bacterial pectate lyase; VH and VL, heavy and light chain variable region coding sequence of anti-CD16 mAb; CH1 and CL, the first domain of human IgG1 heavy chain constant region and light chain constant region genes; scFv, anti-erbB2 scFv coding sequence. (B) Schematic representation of the dicistronic expression vector pET22b/BsAb. Amp, the ampicillin resistance gene; ori, origin of DNA replication; T7lac, IPTG inducible lac/T7 promoter; VL-CL, a sequence encoding the chimeric light chain of anti-CD16; VH-CH1, a sequence encoding the chimeric heavy chain of anti-CD16.
Fig. 2. Model of the trivalent BsAb protein structure.
Each of the chimeric genes was cloned in-frame between a signal peptide sequence of bacterial pectate lyase, pelB, for secretion of antibodies into the bacterial periplasm and a stop codon. Thus by utilizing single domain of human IgG j chain CL and its natural partner CH1 forming heterodimers, ligating anti-CD16 VH and VL to amino terminals of CH1 and CL, respectively, and fusing anti-erbB2 scFv moieties to both carboxy terminals of CH1 and CL, a final dicistronic expression cassette pET22b/BsAb was constructed (Figs. 1A and B). The ecombinant protein was expressed in E. coli. The structure of BsAb protein is shown schematically in Fig. 2.
Fig. 3. SDS–PAGE analysis of total bacterial cell lysates (A) and periplasmic extracts (B) after 4 h of shaking with and without induction with IPTG. All samples were subjected to thiol reduction with dithiothreitol and boiled before loading. Proteins were visualized by staining with Coomassie blue. (A) Lane 1, marker protein; lanes 2–4, cells transformed with pET22b empty vector; lanes 5–7, cells transformed with pET22b/VLCL-scFv; and lanes 8–10, cells transformed with pET22b/BsAb. (B) Lanes 1–3, cells transformed with pET22b empty vector; lanes 4–6, cells transformed with pET22b/VLCL-scFv; lanes 7–9, cells transformed with pET22b/BsAb; and lane 10, marker protein.
Expression and purification of BsAb The production of BsAb after induction with 0.2 or 0.5 mM IPTG for 4 h was confirmed by electrophoresis
Fig. 4. Immunoblot stained with HRP-conjugated goat-anti-human IgG. Lanes 1 and 3 total bacterial cell lysates and lanes 2 and 4, periplasmic extracts.
310
Z. Xie et al. / Biochemical and Biophysical Research Communications 311 (2003) 307–312
Fig. 5. SDS–PAGE analysis of purified BsAb. Periplasmic extracts were purified by affinity chromatography on Sepharose–protein G column. Proteins were visualized by staining with Coomassie blue.
acrylamide gels. Although the recombinant proteins were mostly associated with the insoluble membrane fraction despite the presence of the pelB leader, a small amount of proteins could be clearly detected as shown in Fig. 3B, demonstrating the expression of the BsAb as soluble proteins in the periplasmic space. Immunoblot experiments with HRP-conjugated goat-anti-human IgG confirmed the identity of the recombinant proteins (Fig. 4). BsAb was purified from the periplasm after induction with optimized IPTG concentrations. After affinity purification using protein G chromatography, the yield of BsAb was approximately 1 mg/L culture (Fig. 5). Then BsAbwas analyzed by flow cytometry for binding activity. Bispecificity analysis of the BsAb protein To confirm the bispecific nature of the BsAb protein, flow cytometry was performed. BsAb was allowed to bind to SKBR3 cells expressing erbB2 molecules and NK cells. The results shown in Fig. 6 clearly demonstrated that it exhibited binding activity to SKBR3 cells. Using PE-labeled mouse anti-human CD56 gating in two-color flow cytometric immunophenotyping the binding activity of BsAb to NK cells was analyzed. Dual positive cells were clearly resolved, indicating that the trivalent BsAb was correctly assembled and the recombinant BsAb protein was able to bind to NK cells with its unique binding site (Fig. 7).
Fig. 6. Flow cytometry analysis of BsAb reactivity with erbB2 on SKBR3 cells. SKBR3 cells were incubated with BsAb (100 ng/ml). After washing with PBS plus 0.1% NaN3 , the cells were exposed to FITCconjugated goat-anti-human IgG. Dotted line, negative control (stained with FITC-labeled secondary antibody alone); solid line, BsAb.
To confirm the production of soluble BsAb in the correct cell compartment, periplasmic extracts of induced and non-induced bacteria were analyzed on 10% poly-
Discussion BsAb comprises two specificities and can bind to a tumor-associated antigen and a trigger molecule on an immune effector cell, thereby physically cross-linking immune cells to tumor cells, thus circumventing the proper structures for tumor cell–immune cell interactions and activating the cellular cytotoxic mechanisms.
Fig. 7. Dual-color flow cytometry analysis of binding activity of BsAb. Human peripheral blood mononuclear cells were incubated with BsAb (100 ng/ml). After washing, cells were incubated with FITC-conjugated goat-anti-human IgG and PE-conjugated goat-anti-human CD56. The x-axis represents the mean intensity of CD16-FITC fluorescence, whereas the y-axis represents CD56-PE. (A) negative control and (B) BsAb.
Z. Xie et al. / Biochemical and Biophysical Research Communications 311 (2003) 307–312
By using select antibodies, which bind to FccRs via their variable regions outside of the immnoglobulin binding sites, BsAb-mediated cytotoxicity would not be inhibited by endogenous circulating levels of serum IgG, even when FccRs are occupied by IgG [8]. FccRs on NK and myeloid cells are widely investigated cytotoxic trigger molecules for BsAb [9,10]. Increasing evidence points to the importance of FccRIII for the clinical efficacy of therapeutic antibodies [11]. The feasibility of enhancing anti-tumor effects by BsAb and NK cells was demonstrated in clinical trials. The common clinical problem associated with BsAb is that the systemic activation of effector cells results in widespread cytokine release, leading to serious side effects. Therefore, the effector cells should be activated at the tumor site. The prototypic BsAb, a F(ab0 )2 heterodimer, is produced via chemical cross-linking of respective F(ab0 ) fragments of target and trigger molecule antibodies. This type of construct is expensive to produce in large amounts and proved immunogenic in clinical trials when it was generated from murine antibodies. Genetic engineering allows the development of various BsAb formats, aimed at optimizing their structures, minimizing toxicity, and bypassing tedious purification, and so on. Small BsAb fragments can be assembled as diabodies and produced by direct genetic fusion of two specific scFvs [12–14]. It has been reported that diabody (60 kDa) and F(ab0 )2 (120 kDa) gave optimal tumor:blood ratios. However, the major disadvantage of diabody design is that the domain interfaces of the two Fv fragments are not covalently cross-linked and show the dissociation-related aggregation. Bispecific scFv heterodimers can be constructed by a polypeptide linker or helical heterodimerization domains [15–17]. The stability of these constructs under physiological conditions has not been reported and the constructs may give rise to an immune reaction against the heterologous domains. In this paper, heterotypic CL–CH1 domain was utilized as a heterodimerization scaffold for construction of an anti-erbB2/anti-CD16 recombinant trivalent BsAb possessing three antigen binding sites, with two antigen binding sites in the form of scFvs targeting the tumor cells over-expressing erbB2 antigens and only one binding site in the form of Fab triggering immune cells expressing CD16. By decreasing the binding to effector cells, this trivalent BsAb may selectively and directly target tumor cells in vivo. Thus, the side effect caused by induction of ‘cytokine storm’ may be avoided. The novel molecules were secreted from E. coli in correctly folded heterodimers formed by covalently linking of CL and CH1 domains. Folding and correct dimerization of the protein are not hindered by fusing scFvs to the carboxyl terminals of Fab chains. The domain assembly led to a trivalent BsAb, which is fully
311
functional in bispecific binding and in cross-linking of effector cells with tumor cells. The molecular size of this trivalent BsAb protein (100 kDa), larger than diabody and smaller than F(ab0 )2 , is expected to have advantage for both high penetration and slow circulation clearance and thus result in high tumor uptake and reasonable half-lives, which makes it an attractive target for further improvement and evaluation.
Acknowledgments We are very grateful to Prof. Lei Yu for help, advices and providing anti-erbB2 scFv. We thank Prof. Yigang Tong for gift of human IgG1 CH1 and j chain CL genes. This work was supported by 863 Program (2001AA215081).
References [1] Y.M. Deo, R.F. Graziano, R. Repp, J.G. van de Winkel, Clinical significance of IgG Fc receptors and FccR-directed immunotherapies, Immunol. Today 18 (1997) 127–135. [2] J.V. Ravetch, S. Bolland, IgG Fc receptors, Annu. Rev. Immunol. 19 (2001) 275–290. [3] A. Gorter, V.T. Blok, W.H. Hassnoot, N.G. Ensink, M.R. Daha, G.J. Fleuren, Expression of CD46, CD55, and CD59 on renal tumor cell lines and their role in preventing complement-mediated tumor cell lysis, Lab. Invest. 74 (1996) 1039–1049. [4] F. Hartmann, C. Renner, W. Jung, C. Deisting, M. Juwana, B. Eichentopf, M. Kloft, M. Pfreundschuh, Treatment of refractory Hodgkin’s disease with an anti-CD16/CD30 bispecific antibody, Blood 89 (1997) 2042–2047. [5] F.H. Valone, P.A. Kaufman, P.M. Guyre, L.D. Lewis, V. Memoli, M.S. Ernstoff, W. Wells, R. Barth, Y. Deo, J. Fisher, et al., Clinical trials of bispecific antibody MDX-210 in women with advanced breast or ovarian cancer that overexpresses HER2/neu, J. Hematother. 4 (1995) 471–475. [6] H.H. van Ojik, R. Repp, G. Groenewegen, T. Valerius, J.G. van de Winkel, Clinical evaluation of the bispecific antibody MDXH210 (anti-FcgammaRI anti-HER-2/neu) in combination with granulocyte-colony-stimulating factor (Filgrastim) for treatment of advanced breast cancer, Cancer Immunol. Immunother. 45 (1997) 207–209. [7] B.J. Kroesen, J. Buter, D.T. Sleijifer, R.A. Janssen, W.T. van der Graaf, T.H. The, L. de Leij, N.H. Mulder, Phase I study of intravenously applied bispecific antibody in renal cell cancer patients receiving subcutaneous interleukin 2, Br. J. Cancer 70 (1994) 652–661. [8] P.M. Guyre, R.F. Graziano, B.A. Vance, P.M. Morganelli, M.W. Fanger, Monoclonal antibodies that bind to distinct epitopes on FccRI are able to trigger receptor function, J. Immunol. 143 (1989) 1650–1655. [9] J.A. Titus, P. Perez, A. Kaubisch, M.A. Garrudi, D.M. Segal, Human K/natural killer cells targeted with hetero-cross-linked antibodies specifically lyse tumor cells in vitro and prevent tumor growth in vivo, J. Immunol. 139 (1987) 3153–3158. [10] B. Karpovsky, J.A. Titus, D.A. Stephany, D.M. Segal, Production of target-specific effector cells using hetero-cross-linked aggregates containing anti-target and anti-Fc gamma receptor antibodies, J. Exp. Med. 160 (1987) 1686–1701. [11] R.L. Shields, A.K. Namenuk, K. Hong, Y.G. Meng, J. Rae, J. Briggs, D. Xie, J. Lai, A. Stadlen, B. Li, J.A. Fox, L.G. Presta, High resolution mapping of the binding site on human IgG1 for
312
Z. Xie et al. / Biochemical and Biophysical Research Communications 311 (2003) 307–312
FccRI, FccRII, FccRIII, and FcRn and design of IgG1 variants with improved binding to the FccR, J. Biol. Chem. 276 (2001) 6591–6604. [12] P. Holliger, T. Prospero, G. Winter, “Diabodies”: small bivalent and bispecific antibody fragments, Proc. Natl. Acad. Sci. USA 90 (1993) 6444–6448. [13] O. Perisic, P.A. Webb, P. Holliger, G. Winter, R.L. Williams, Crystal structure of a diabody, a bivalent antibody fragment, Structure 2 (1994) 1217–1226. [14] R.J. Poljak, Production and structure of diabodies, Structure 2 (1994) 1121–1123.
[15] M. Gruber, B.A. Schodin, E.R. Wilson, D.M. Kranz, Efficient tumor cell lysis mediated by a bispecific single chain antibody expressed in Escherichia coli, J. Immunol. 142 (1994) 5368– 5374. [16] W. Mallender, E.W. Voss Jr., Construction, expression and activity of a bivalent bispecific single-chain antibody, J. Biol. Chem. 269 (1994) 199–206. [17] J.D. Jonge, J. Brissinck, C. Heirman, C. Demanet, O. Leo, M. Moser, K. Thielemans, Production and characterization of bispecific single-chain antibody fragments, Mol. Immunol. 32 (1995) 1405–1412.