- Email: [email protected]
MMPs signaling
International Journal of Biological Macromolecules 145 (2020) 154–164
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules journal homepage: http://www.elsevier.com/locate/ijbiomac
A tropomyosin-like Meretrix meretrix Linnaeus polypeptide inhibits the proliferation and metastasis of glioma cells via microtubule polymerization and FAK/Akt/MMPs signaling Zhongjun Fan a,c,1, Qi Xu a,d,1, Changhui Wang e, Xiukun Lin f, Quanbin Zhang a, Ning Wu a,b,⁎ a
Key Laboratory of Experimental Marine Biology, Center of Ocean Mega-Science, Institute of Oceanology, Chinese Academy of Sciences, Qingdao, China Laboratory for Marine Drugs and Bioproducts, Pilot National Laboratory for Marine Science and Technology, Qingdao, China c School of Marine and Biological Engineering, Yancheng Teachers University, Yancheng, China d Laboratory of Immunology for Environment and Health, Shandong Analysis and Test Center, Qilu University of Technology (Shandong Academy of sciences), Jinan, China e Shanghai Neuromedical Center, Qingdao University, Shanghai, China f Department of Pharmacology, School of Pharmacy, Southwest Medical University, Luzhou, China b
a r t i c l e
i n f o
Article history: Received 17 October 2019 Received in revised form 18 December 2019 Accepted 18 December 2019 Available online 20 December 2019 Keywords: Polypeptide Glioblastoma Proliferation Metastasis
a b s t r a c t Glioblastoma (GBM) represents the most common, aggressive and deadliest primary tumors with poor prognosis as available therapeutic approaches fail to control its aberrant proliferation and high invasiveness. Thus, the therapeutic agents targeting these two characteristics will be more effective. In present study, a novel polypeptide (MM15), which was originally purified from Meretrix meretrix Linnaeus and has been proven to possess potent antitumor activity by our laboratory, was recombinant expressed and identified as a tropomyosin homologous protein. The recombinant polypeptide (re-MM15) could induce the U87 cell cycle arrest in G2/M phase and cell apoptosis by inducing tubulin polymerization. Additionally, re-MM15 displayed the significant inhibition to the migration and invasion of U87 cells through downregulating FAK/Akt/MMPs signaling. Furthermore, the in vivo analysis suggested that re-MM15 significantly blocked tumor growth in U87 xenograft model. Collectively, our results indicated that re-MM15, with anti-GBM properties in vitro and in vivo, has promising potential as a new anticancer candidate for GBM. © 2018 Elsevier B.V. All rights reserved.
1. Introduction Glioblastoma (GBM) is a highly aggressive primary brain tumor [1]. Even with the current standard therapies, such as surgery resection of the tumor and followed by radio-therapy and chemotherapy, the survival of GBM patients remains poor, with a 5-year survival rate of only 3% [2]. Therefore, GBM has been the third leading cause of cancer related death for 15–34 aged people [3]. To date, chemotherapy is expected to provide more and better opportunities for effective treatment of GBM. However, chemotherapies for GBM, including TMZ, carmustine (BCNU) and lomustine (CCNU), platinum agents, etoposide, irinotecan and PCV combination, have not been able to battle effectively GBM [4]. Thus, more novel and effective therapeutic agents for treating GBM should be developed.
⁎ Corresponding author at: Key Laboratory of Experimental Marine Biology, Center of Ocean Mega-Science, Institute of Oceanology, Chinese Academy of Sciences, Qingdao, China. E-mail address: [email protected] (N. Wu). 1 The two authors are equal contribute to this work.
https://doi.org/10.1016/j.ijbiomac.2019.12.158 0141-8130/© 2018 Elsevier B.V. All rights reserved.
In proliferating cells, microtubules are the essential components of mitotic spindle formation in division process. Disrupting the dynamic equilibrium of microtubule could arrest cell-cycle progression at mitosis, leading to cell proliferation inhibition [5]. Based on this function, small molecules that target microtubules (MTs) like paclitaxel and vinca alkaloids provide the promising therapeutics to treat many subtypes of cancers [6,7], particularly GBM [8]. Because there are accumulating evidence suggested that GBM is especially sensitive to microtubule-targeting agents (MTAs) [8]. Furthermore, human clinical trials that MTA treatment could receive the positive results in GBM patients further indicated the sensitivity of GBM to disruption of MT function [9,10]. As we all know, marine sources are a promising source for developing MTAs, for example, invertebrate animals, algae and fungi [11,12]. In our previous study, we had isolated a novel ~15 kDa polypeptide we call MM15 from Meretrix meretrix Linnaeus, which not only blocked the proliferation of K652 leukemia cells through inducing microtubule disassembly [13] but also inhibited the metastasis of human lung cancer cell via downregulating matrix metalloproteinases (MMPs) [14,15]. According to the above findings, we guessed that MM15, a microtubule-targeting agent, may also exhibit the anti-tumor activity in GBM.
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
155
Hence, in order to verify the above-mentioned guess, the anticancer activity of MM15 against GBM in vitro and in vivo was comprehensively detected in present study. We first got the recombinant MM15 (re-MM15) and confirmed it as a novel tropomyosin-like polypeptide by sequence analysis. There are studies have reported that tropomyosin such as tropomyosin-1 (TPM1) acted as tumor suppressor in some type cancers [16,17]. Additionally, we demonstrated that re-MM15 exerted its cytotoxic effect on U87 cells by promoting myotubule polymerization and G2/M arrest, which was followed by cell apoptosis induction eventually. We also found that re-MM15 suppressed the migration and invasion ability of U87 cells through inhibiting FAK/Akt/MMPs signaling. Moreover, the anti-proliferation activity and edible safety of re-MM15 in vivo were further clarified.
F-actin (#205) and Bcl-2 (#32124) were purchased from Abcam (Cambridge, MA, USA). GAPDH, β-actin antibody and all secondary antibodies were obtained from Proteintech Group (Wuhan, China).
2. Materials and methods
U87 cells were seeded at a concentration of 1000 cells per well in 6well plates. Twenty-four hours after seeding, cells were treated with different concentrations of re-MM15 (0, 2, 4, 8 μM) for 20 min and then incubated for two weeks to allow colony formation. Colonies in each well were washed with PBS, fixed with 4% paraformaldehyde for 15 min, stained with 0.5% crystal violet for 10 min. Then, the colonies were photographed and counted.
2.1. Recombinant expression of MM15 Total RNA was isolated from the tissues of M. meretrix using Trizol (Takara, Japan) according to the manufacture's protocol and then the first-strand cDNA was synthesized by reverse transcription with RevertAid™ First Strand cDNA Synthesis Kit (Thermo Fisher). The cDNA sequence of MM15 was amplified by rTaq polymerase (Takara, Japan) with specific primers MM15-F: CGCCGAATTCATGGATGCTAT CAAGAAGAAGATGCAGGCA and MM15-R: CCGAAGCTTTTAGTAT AAAGCAAATTCAGCAAATATTGATC. Then, the full-length cDNA sequence of MM15 and the deduced amino acid sequence were analyzed by DNASTAR (version7.1.0) software package and the homology analysis was performed by Blast search (www.ncbi.nih. gov). Bacterial expression system was used to acquire the recombinant MM15. A MM15 expression vector (pET32a/MM15) was constructed by inserting the purified PCR products into the NcoI and XhoI restriction sites of pET32a (t) vector. Then, recombinant MM15 was expressed and purified as described in our former work [19]. Briefly, the recombinant plasmid pET32a/MM15 was transformed into E. coli strain Origami (DE3) (Novagen, USA), and incubated in LB (L-Broth or Luria Bertani) medium (containing 100 mg/ ml ampicillin) at 28 °C. After the value of OD600 of the culture mediums reached around 0.6, isopropylthio-β-galactoside (IPTG) was added at a final concentration of 0.1 mM and the cells were incubated overnight at 25 °C. Then, cells were collected by centrifugation (6000g, 10 min, 4 °C). The purification procedure was performed following the manufacture's protocol (Ni-NTA superflow cartridge, Qiagen). The expression of recombinant protein and the purified protein was determined by SDS-PAGE (15% separating gel and 5% stacking gel), respectively.
2.3. Cell proliferation assay Cell proliferation was determined by MTT assay. The cells were seeded in 96-well plates and incubated overnight. After treated with various concentrations of re-MM15 for different time, the attached cells were incubated with MTT for 4 h. The formazan was dissolved by DMSO and the optical density (OD) was measured at a wavelength of 490 nm. 2.4. Colon formation assay
2.5. Flow cytometry analysis The cell cycle distribution and cell apoptosis were analyzed by flow cytometry (Becton Dickinson, Franklin Lakes, NJ, USA). 2.5.1. Cell cycle analysis For cell cycle assay, the U87 cells (4 × 105 cells/well) were harvested after 0, 2, 4, 8 μM re-MM15 treatment, washed twice with PBS and fixed in cold 70% ethanol at −20 °C overnight. After washed with PBS, the fixed cells were stained with propidium iodide solution containing 20 μg/ml RnaseA (Sigma, St. Louis, MO, USA) and 50 μg/ml propidium iodide (PI, Sigma, St. Louis, MO, USA) for 30 min at 37 °C in the dark. Then, the cells were detected by flow cytometry. 2.5.2. Cell apoptosis analysis After treated with various concentrations of re-MM15 (0, 2, 4, 8 μM) for 20 min, the U87 cells in 6-well plates were trypsinized gently, washed twice with cold PBS, re-suspended in 500 μl Annexin V binding buffer, and then incubated with 5 μl Annexin V-FITC and 5 μl PI in the dark for 15 min. Finally, the cells were analyzed in three different experiments using cytometry and the apoptosis population were measured with FlowJo X software. 2.6. Western blot analysis
2.2. Materials and cell culture U87 MG, PANC-28, ASPC-1, Hela, HCT-116, MCF-7, BEL-7402 and NIH/3 T3 cells were purchased from the Chinese Academy of Science Cell Bank (Shanghai, China). Among them, U87 MG, PANC-28, ASPC-1, Hela and NIH/3 T3 cells were cultured in DMEM (Hyclone); HCT-116 and BEL-7402 were cultured in RPMI-1640 (Hyclone); MCF-7 cell was cultured in MEM. All media were added 10% fetal bovine serum (Gibco) and 1% penicillin/streptomycin and all cell lines were maintained at 37 °C in a humidified atmosphere of 5% CO2. Primary antibodies used in this study: FAK (#1688), MMP-2 (#13595) and MMP-9 (#21733) antibody were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Phospho-FAK (#3398) was obtained from Affinity Biosciences (Cincinnati, OH, USA). PARP (#9532), Bcl-xL (#2764), Cleaved-Caspase 3 (#9661), Phospho-Akt (#4060), Akt (#4685), Phospho-cdc2 (#4539), cdc2 (#77055), cdc25C (#4688), Cyclin B1 (#12231) and Ki67 (#9027) were purchased from Cell Signaling Technology (Danvers, MA, USA). β-Tubulin (#179513),
U87 cells treated with re-MM15 were washed three times with PBS and lysed with RIPA lysis buffer containing PMSF. Protein concentrations were quantified using the BCA Protein Assay Kit (Beyotime, Guangzhou, China). The proteins were separated by 8% or 10% SDS-PAGE and transferred onto PVDF membranes (Millipore, Billerica, MA, USA). The membranes were blocked with 5% non-fat milk for 1 h at room temperature, then incubated with primary antibodies overnight at 4 °C and subsequently incubated with secondary antibody at room temperature for 1 h. Protein antibody complexes were detected using enhanced chemiluminescence (ECL) reagent (Bio-Rad, Hercules, CA) with the ChemiDoc XRS imaging system (Bio-Rad, USA). 2.7. Immunofluorescence assay U87 MG cells were seeded onto glass coverslips and cultured in the 10% FBS DMEM. Twenty-four hours later, cells were treated with
156
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
different concentrations of re-MM15 for 20 min. Then, the cells were washed three times with PBS, fixed with 4% formaldehyde for 20 min and treated with 0.5% Triton-X 100. After washed with PBS, the cells were blocked with 5% bovine serum albumin for 30 min and incubated with anti-β-tubulin antibody (1:500 dilution) and F-actin antibody (1:500 dilution) overnight at 4 °C. Then, the cells were stained with FITC-conjugated secondary antibody (1:400 dilution) at room temperature for 1 h and followed by DAPI staining for 10 min in the dark. Images were recorded by confocal microscopy (Carl Zeiss, Oberkochen, Germany).
2.8. Tubulin polymerization assay The effect of re-MM15 on the tubulin polymerization in vitro was measured using the Tubulin Polymerization Assay Kit (Cytoskeleton Inc., Denver, CO) according to recommended protocol. Briefly, the tubulin proteins (final concentration 2 mg/ml) were added to each well of a prewarmed 96-well, black, flat-bottomed plate (Corning Costar) and exposed to re-MM15, vincristine, docetaxel and control buffer. After 1 min incubation at 37 °C on a fluorescence microplate reader (Tecan, Mannedorf, Switzerland), the polymerization of tubulin was measured
Fig. 1. The recombinant of MM15 and the assessment of its cytotoxicity. (A) Sequence of MM15 cDNA and deduced amino acid. (B and C) Sequence alignment of MM15 with tropomyosin from several marine invertebrate species. (D) The purity assessment of re-MM15. (E) The IC50 values of re-MM15 on U87, PANC-28, ASPC-1, Hela, HCT-116, MCF-7, BEL-7402 cells and NIH/ 3 T3 cells.
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
by the change in fluorescence intensity at Ex 360 nm/Em 450 nm every 1 min for 40 min.
157
3. Result 3.1. re-MM15 is a tropomyosin-like polypeptide and possesses the cytotoxicity to cancer cells
2.9. Wound-scratch assay The effect of re-MM15 on motility ability of U87 cells was assessed using wound scratch assay. U87 cells were seeded into 6-wells plates with a concentration of 5 × 105 cells/well. After reaching 90% confluence, U87 cells were starved in serum-free DMEM for 12 h and then scratched by a sterile pipette tip. The cells were treated with re-MM15 (0 or 4 μM) for 20 min. To observe the recovery post-wounding, images of the matched pair wound regions were imaged using microscope at 0, 12, 24 h.
2.10. Matrigel invasion assay The transwell chambers (8.0 μm pore size, Corning) were used to detect the invasive ability of U87 cells. After treated with indicated concentrations of re-MM15 for 20 min, U87 cells were resuspended with serum-free DMEM at a density of 5 × 104 cells/ml. 200 μl diluted cells were seeded into the upper compartments of Matrigel (5 × dilution, 50 μl, BD Bioscience) coated transwell chambers, and 600 μl 10% FBS DMEM was added to the lower compartments. After 24 h incubation, non-invading cells in the upper compartments were removed using cotton buds, and the invading cells were fixed with 4% paraformaldehyde and stained with 0.5% crystal violet. Then, the invading cells were photographed by microscope and counted by ImageJ software.
2.11. Mouse xenograft model All experiments with animals were approved by the Animal Care and Use Committee of Institute of Oceanology, Chinese Academy of Sciences and in accordance with all appropriate regulatory standards. Subcutaneous tumors were established by injecting U87 cells (1 × 106 cells/mice) into the right flank of 5–6 weeks old nude mice. When the tumor size reached approximately 100 mm3, mice were randomly divided into three groups, with 6 mice in each group; the control group was treated with vehicle and the other two groups were treated with 25 mg/kg and 50 mg/kg re-MM15, respectively. The body weight and tumor size (length × width2 / 2) were measured once every three days. Fifteen days after treated with vehicle or re-MM15, mice were sacrificed. The xenografted tumors were removed for further analysis.
2.12. H&E and immunohistochemistry Tumor, heart, liver, kidney and lung tissues were removed from sacrificed mice, fixed with 10% formaldehyde, embedded in paraffin and then cut into 3–4 μm thick sections. The tumor tissues were stained using antibodies against Ki67, p-FAK and MMP-2. Heart, liver, kidney and lung tissues were stained with hematoxylin and eosin. Stained tissue sections were observed using a light microscope (Nikon, Tokyo, Japan).
2.13. Statistical analysis Statistical analyses were performed using GraphPad Prism 5.0 (San Diego, CA) or SPSS 19.0 (Chicago, IL, USA). All data were present as value of mean ± SEM. Statistical comparison was performed using one-way ANOVA. P b 0.05 was considered significant.
MM15, which was extracted from M. meretrix, possessed good antitumor activity in lung cancer cell and K652 leukemia cell. However, due to the difficulty and the low yield in MM15 isolation, it is essential to obtained more MM15 by recombinant expression. First, based on the results of mass spectrometer analysis on MM15, we cloned the cDNA sequence of MM15 precursor (Fig. 1A). Then, we used the BLAST search to reveal that the amino acid sequence of MM15 shared overall amino acid identities ranged from 83.9% to 98.29% with tropomyosin of some marine invertebrate animals (Fig. 1B and C). Finally, we obtained the purified re-MM15 (~13.58 kD) and re-examined the cytotoxicity of reMM15 to cancer cells, which suggested that re-MM15 significantly inhibited the growth of different types of cancer cells including U87, PANC-28, ASPC-1, Hela, HCT-116, MCF-7 and BEL-7402 cells (Fig. 1D), but had less cytotoxicity to the normal cells (NIH/3T3 cells) (Fig. 1E). 3.2. re-MM15 inhibits U87 cell growth Given that re-MM15 showed most significant cytotoxicity to U87 cell with an IC50 value of 2.12 ± 0.14 μM, we further illustrated the inhibitory activity of re-MM15 against U87 cell proliferation and growth more specifically. We took photos to observe the morphological changes of U87 cells after treating re-MM15 (0, 2, 4, and 8 μM) for 20 min. As shown in Fig. 2A, re-MM15 could lead to cell shrinkage, deformation and viable cells reduction. The cell number was dramatically lower in re-MM15 treated cells than in the control ones (Fig. 2B). Moreover, the U87 cell viability was markedly inhibited when administrated with re-MM15 (8 μM) just for 30 min (Fig. 2C). Next, we used colony formation assay to assess the long-term effects of re-MM15 on U87 cell. As shown in Fig. 2D and E, the colonies formed in re-MM15 treated cells were much fewer than those formed in control cells, indicating reMM15 significantly impaired the clonogenic potential in a dosedependent manner. Therefore, these results demonstrated that reMM15 dramatically inhibited cell proliferation and led to growth arrest in U87 cell. 3.3. re-MM15 induces cell cycle arrest in U87 cell by promoting microtubule polymerization In order to investigate the mechanism of U87 cell growth inhibition by re-MM15, we first detected its contribution to the induction of cell cycle arrest. U87 cells were treated with various concentrations of reMM15 and then were stained with PI for cell cycle analysis. As shown in Fig. 3A, U87 cells, which were treated with re-MM15, arrested in G2/M phase. Compared with the control group, the percentage of G2/ M phase was increased from 4.05 ± 0.73% to 17.6 ± 1.4% at a concentration of 4 μM, while the G0/G1 phase was decreased (Fig. 3B). Accordingly, the G2/M related protein such as Cyclin B1, cdc2 and cdc25C were significantly decreased, and the phosphorylation of cdc2 was increased in re-MM15 treated U87 cells (Fig. 3C and D). Taken together, these results implied that re-MM15 could induce G2/M cell cycle arrest in U87 cells. Additionally, to further explore the mechanism of re-MM15 on G2/M cell cycle, we detected the regulation of re-MM15 on the microtubular dynamics. First, we examined the effect of re-MM15 on the cellular tubulin polymer mass by quantitative immunofluorescent microscopy of cellular β-tubulin and F-actin staining. We discovered that re-MM15 treatment resulted in an increase in the density of cellular microtubules (Fig. 3E). Subsequently, Western blot was used to further evaluate the effect of re-MM15 on the intracellular microtubular network. The results showed that re-MM15 induced the increase expression of β-tubulin in U87 cells (Fig. 3F).
158
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
Fig. 2. The effect of re-MM15 on U87 cell proliferation and growth. (A) Cell morphology was observed and photographed by inverted microscope (magnification 100×). (B and C) Survival rate of U87 cell treated by different concentration and time of re-MM15. The survived cells were detected by MTT assay. Results are normalized to control and represented as mean ± SEM (n = 4). *P b 0.05, **P b 0.01, compared with the control. (D and E) The effect of re-MM15 on the colony formation. After treated by various concentrations of re-MM15 for 20 min, U87 cells were cultured for two weeks to form colonies. The formative colonies were stained with crystal violet and counted. *P b 0.05, **P b 0.01, compared with the control. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
These consistent results indicated that re-MM15 may enhance microtubule assembly and stability. Hence, we used MT assembly assay with purified components in a cell-free system to further determine the direct effect of re-MM15 on tubulin polymerization. As shown in Fig. 3G, as expected, paclitaxel increased polymerization whereas the MT-destabilizing molecule vinblastine inhibited tubulin polymerization. Similar to paclitaxel, re-MM15 exhibited promotion of microtubule formation to some extent, suggesting re-MM15 promoted tubulin polymerization in vitro.
3.4. re-MM15 promotes apoptosis in U87 cell Then, the effect of re-MM15 on cell apoptosis was investigated in U87 cells. U87 cells were treated with various concentrations of re-MM15, then were co-stained with PI and Annexin-V FITC and the number of apoptotic cells was examined by flow cytometry. As shown in Fig. 4A and B, as compared with control group, the percentage of apoptotic cells in re-MM15 treated group was significantly increased in a dose-dependent manner. Subsequently,
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
159
Fig. 3. re-MM15 induced G2/M phase arrest in U87 cells by promoting polymerization. (A–D) re-MM15 induced U87 cell cycle arrest. (A and B) U87 cells were treated by different doses of re-MM15 for 20 min. U87 cells were stained with propidium iodide (PI) and the cell cycle phases were analyzed by flow cytometry. (C and D) Western blot analysis of G2/M related proteins including p-cdc2, cdc2, cdc25C and Cyclin B1 after re-MM15 treatment. Band density was quantified and normalized with GAPDH. (E–G) re-MM15 promoted microtubule polymerization. (E) re-MM15 treated U87 cells were fixed and stained with β-tubulin (green) and F-actin (red) antibodies, fluorescence images were then viewed by confocal microscope (scale bar: 20 μm). (F) After treated with re-MM15 for 20 min, U87 cell lysates was centrifuged to separate polymerized microtubules and the β-tubulin expression was measured by Western blot. (G) In vitro polymerization of tubulin assay. Purified tubulin protein was incubated with 16 μM re-MM15 and reference compounds at 37 °C and polymerization was kinetic monitored by excitation at 360 nm and emission at 450 nm. All data were presented as the mean ± SEM of three independent experiments. *P b 0.05, **P b 0.01 compared with the control. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
we also detected the protein expression of anti-apoptotic Bcl-2 family proteins (Bcl-2 and Bcl-xL), caspase-3 and PARP by Western bolt (Fig. 4C and D). The results showed that re-MM15 could induce the downregulation of Bcl-2 and Bcl-xL and the increase of cleaved caspase-3 and cleaved PARP in U87 cells, which indicated that re-MM15 markedly promoted U87 cells apoptosis.
3.5. re-MM15 inhibits U87 cell migration and invasion via regulating FAK/ Akt/MMPs signaling pathway Next, we further investigated whether re-MM15 affected cell migration and invasion by using wound healing and transwell assay respectively. As shown in Fig. 5A and B, the results of the wound healing assay indicated that re-MM15 (4 μM) markedly inhibited the migration
160
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
Fig. 4. re-MM15 induced apoptosis in U87 cells. (A and B) U87 cells were treated with re-MM15 (0, 2, 4, 8 μM) for indicated time and FITC, Annexin V/PI staining was used to identify apoptosis induced by re-MM15. Three independent experiments were carried and data were represented as mean ± SEM. *P b 0.05, **P b 0.01 compared with the control. (C) Western blot analysis of apoptosis related proteins. (D) Band density was quantified by Image J and normalized with GAPDH. *P b 0.05, **P b 0.01 compared with the control.
of U87 cells. Similarly, the Matrigel invasion assay showed that, compared with control group, the number of U87 cells passed through Matrigel-coated membrane into the lower chamber was significantly lower in re-MM15 treatment group, suggesting that re-MM15 inhibited the invasion ability of U87 cells in a dose-dependent manner (Fig. 5C and D). Then, to further determine the mechanism of re-MM15 contributing to metastasis, we investigated the regulation of re-MM15 on the FAK/Akt/MMPs signaling pathways. As shown in Fig. 5E and F, the results of Western blot indicated that the phosphorylation of FAK and Akt were significantly decreased when U87 cells were treated with reMM15. Moreover, the protein expression levels of MMP-2 and MMP-9
in U87 cells after re-MM15 treatment were both obviously reduced in a dose-dependent manner (Fig. 5E and F). These above findings indicated that re-MM15 inhibited both migration and invasion of U87 cells by targeting FAK/Akt/MMPs pathway. 3.6. re-MM15 blocks U87 cell tumor growth in vivo After characterizing the efficacy of re-MM15 in U87 cells, we finally used a mouse xenograft model to validate its anti-cancer activity in vivo. U87 xenografts were generated by subcutaneous flank injection of U87 cells into nude mice. One week after U87 cells injection, tumors were
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
161
Fig. 5. re-MM15 inhibited the metastasis of U87 cells through downregulating FAK/Akt/MMPs signaling. (A and B) Suppression of U87 cell migration by re-MM15. Wound closures of U87 cells were photographed at 0 h, 12 h and 24 h following treatment with different concentrations of re-MM15 (scale bar: 100 μm). Error bars represented the mean ± SEM of triplicate independent experiments. (C–D) Inhibition of U87 cell invasion by re-MM15. After treated with indicated concentrations of re-MM15, U87 cells were seeded in Matrigel-coated transwell chambers and the invaded cells were stained and calculated. Shown are representative images of invaded cells (scale bar: 100 μm). The bar graphs showed mean ± SEM of the numbers of invaded cells from three independent assays. (E–F) Downregulation of FAK/Akt/MMPs signaling by re-MM15. The expression of p-FAK, FAK, p-Akt, Akt, MMP-2, MMP9 were detected by Western blot. Band density was quantified and normalized with GAPDH. The results shown are mean ± SEM (n = 3). *P b 0.05, **P b 0.01 versus control group.
visible. Another one week later, the volume of most of the subcutaneous tumors reached to 100 mm3, then, these mice were treated with either re-MM15 or PBS. The tumor growth curves showed that tumors in reMM15 treated group grew slowly compared with that in control group (Fig. 6A). And, the tumor volume of re-MM15 treated group was significantly lower than that of control group (Fig. 6B). Immunohistochemistry performed on xenograft tissues also revealed the significant decrease of
cell proliferation in re-MM15 treated tumor, as measured by Ki67 (Fig. 6E). As shown in Supplementary Fig. 1, the tumor in the PBS treated group was found to have abundant vascular tissue, with tumor infiltrating into the surrounding tissue, and its margin was not clear. However, in the re-MM15 treated group, the tumor blood vessels were rarely distributed (Supplementary Fig. 1). Moreover, the expression of p-FAK and MMP-2 in re-MM15 treated tumor tissues was significantly reduced (Fig. 6E).
162
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
Fig. 6. The anticancer activity of re-MM15 in vivo. (A) The tumor growth curve. BALB/c nude mice were intraperitoneally treated with re-MM15 (25, 50 mg/kg) or PBS (served as control) for 15 days. Tumor volume was measured every three days. Data were represented as the mean ± SEM (n = 6). *P b 0.05, **P b 0.01 versus control group. (B) Representative photographs of the tumors in three groups. (C) Mice body weights were measured every 3 days during re-MM15 treatment. *P b 0.05, **P b 0.01 versus control group. (D) The heart, liver, kidney and lung tissues were resected and performed for H&E staining (Scale bar: 200 μm). (E) Tumor tissues in different groups were immunostained for Ki67, p-FAK, MMP-2 (scale bar: 200 μm).
Taken together, these results demonstrated that re-MM15 significantly inhibited U87 cells proliferation and metastasis potential in vivo. Additionally, the systemic toxicity of re-MM15 was also assessed by monitoring body weight and performing H&E staining on mice organs. As shown in Fig. 6C and D, no significant changes in body weight and no obvious abnormalities in the H&E staining of heart, liver, kidney and lung tissues were observed in re-MM15 treated mice, suggesting that re-MM15 had little toxicity to mice at the curative dose. 4. Discussion Glioblastoma (GBM) is the most common and malignant tumor in the central nervous system. The poor clinical outcome of GBM patients
is mainly attributed to its two characteristics: aberrant proliferation and high migration and invasion [20,21]. Hence, inhibition of glioma cell proliferation and metastasis has been an effective strategy for treating GBM. In our present study, on the one hand, we have taken out a series of experiments to detect the effect of re-MM15 on proliferation of U87 cell. The results showed that re-MM15 exhibited the general cytotoxicity to several cancer cell lines and possessed the greatest inhibitory effect against U87, with an IC50 value of 2.12 ± 0.14 μM (Fig. 1E). Moreover, the cell growth and colony formation assays also confirmed the significant inhibitory activity of re-MM15 on U87 cell proliferation (Fig. 2). The further mechanism study attributed this inhibitory effect to the induction of cell cycle arrest and apoptosis by re-MM15 (Figs. 3A and 4A).
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
Usually, cell proliferation is strictly regulated by the cell cycle machinery. Our results showed that re-MM15 induced the G2/M phase arrest of U87 cells, which was proved by the decrease of cdc25C and Cyclin B1, as well as the increase of phosphorylated cdc2 (Fig. 4C and D). Cell apoptosis is another mechanism of U87 cell proliferation inhibition by re-MM15. Actually, one of the reasons for dismal prognosis of GBM is its resistance to different apoptotic stimuli [22]. There are two apoptotic pathways: the mitochondria-mediated apoptosis pathway and the death receptor-mediated apoptosis pathway. The proteins of Bcl-2 family (Bax, Bak, Bcl-2 and Bcl-xL, etc.) play vital role in the mitochondrial pathway of apoptosis [23]. Under the treatment of re-MM15, the antiapoptotic proteins like Bcl-2 and Bcl-xL were decreased, and the cleaved-Caspase-3 and cleaved-PARP were increased, demonstrating that re-MM15 was a good pro-apoptotic agent targeting mitochondrial pathway. So far as we know, the mechanism of microtubule stabilizing agents (MSAs) is usually to bind the tubulin, and then block mitosis in the G2/M phase in cell cycle, and eventually induce programmed cell apoptosis [24]. This fact gave us the motivation to detect the association between the microtubule and re-MM15. Thus in our subsequent study, we determined that re-MM15 could promote microtubule polymerization (Fig. 3E–G), suggesting it is a microtubule-stabilizing agent (MSA), which is not consistent to our previous study [13]. In recent years, as a result of the successful development of microtubule-targeting agents (MTAs) in the cancer treatment, microtubules represented the good cancer target [25]. In our present study, it was because the disturbance of re-MM15 on microtubules that caused the significant inhibitory effect on glioma cell proliferation. On the other hand, for GBM patients, main obstacle to the effective treatment is the migration and invasion of glioma cells from the initial tumor into surrounding normal brain, causing the post-surgical recurrence [26,27]. In the view of this fact, studying the effect of re-MM15 on the metastasis would provide the better assessment of the anticancer activity of re-MM15. Our results demonstrated that re-MM15 significantly inhibited U87 cell migration and invasion in a dosedependent manner (Fig. 5A–D). The migration and invasion of glioblastoma tissue requires the interaction among the cancer cells and the extracellular matrix (ECM), and relies on various signaling pathways [28]. In order to create a path for invasion, glioma cells get through the ECM by degrading extracellular matrix proteins. Many studies have reported that matrix-metalloproteinases (MMPs) are involved in this degradation and are overexpressed in almost all cancer types of cancer, including GBM [29–31]. Especially, MMP-2 and MMP-9 play key roles in glioma progression and aggression [32], and inhibiting MMP-2 or MMP-9 expression or activity usually prevents GBM invasion [33,34]. Our results revealed that re-MM15 treatment significantly decreased the expression of MMP-2 and MMP-9 in U87 cells (Fig. 5E and F). Thus, we determined that MMP-2 and MMP-9 mediated the inhibition of U87 cell migration and invasion by re-MM15. Then, the mechanism underlying re-MM15-induced downregulation of MMPs expression in U87 cells was investigated. Accumulating evidence have demonstrated that PI3K/Akt signaling contributes to the migration and invasion of glioma cell by regulating MMP-2 and MMP-9 expression and activity [31,35,36]. Additionally, as a major kinase of focal adhesions, FAK is involved in the promotion of cell migration and invasion in GBM [37]. Notably, in this process, FAK tyrosine phosphorylation plays a vital role, because the phosphorylation at Tyr 397 of FAK could promote the combination between FAK and PI3K, which in turn activates Akt, ultimately increasing the MMPs [38,39]. In agreement with it, in our study, the phosphorylation of FAK and Akt in re-MM15 treated U87 cells were both decreased (Fig. 5E and F). Hence, we determined that re-MM15 inhibited the U87 cell migration and invasion through FAK/Akt signaling-mediated inhibition of MMP-2 and MMP-9. Furthermore, we used in vivo study to further determine the inhibitory activity of re-MM15 in proliferation and metastasis of glioma cell. In Fig. 6, re-MM15 suppressed the U87 cell proliferation and growth without any significant toxicity in nude mice. In accordance with the
163
finding in vitro, re-MM15 downregulated the phosphorylation level of FAK and the expression of MMP-2 protein in GBM xenografted tissues, which was a prediction that re-MM15 could inhibit the migration and invasion ability of U87 cells in vivo. The decreased tumor blood vessels and fewer tumor infiltrating into surrounding tissue in re-MM15 treated group might be another evidence of migration inhibition (Supplementary Fig. 1), because GBM-associated blood vessels make them highly invasive [40] and anti-angiogenesis might be an effective therapeutic strategy against GBM [41]. Furthermore, MMP-2 and MMP-9 have been well-documented as the contributor to the tumor angiogenesis [42]. It can be seen that angiogenesis inhibition was one of the results of FAK/Akt/MMPs signaling inhibition by re-MM15. Hence, the further assessment about the effect of re-MM15 on glioma cell invasion in vivo will be conducted and the results will be reported in due course. Taken together, re-MM15, a new recombinant polypeptide, was identified as a microtubule-stabilizing agent and exerted effective anti-GBM activity by suppressing the proliferation and metastasis of U87 cell in vitro and in vivo. As a result, re-MM15 is a promising anticancer candidate for the treatment of human glioblastoma and is worth further investigation.
Author statement Each of the coauthors has seen and agreed with the changes made to this manuscript in the revision. Supplementary data to this article can be found online at https://doi. org/10.1016/j.ijbiomac.2019.12.158. Acknowledgement This work was funded by the National Natural Science Foundation of China (Grant No. 81872906) and was supported by Fujian Provincial Science and Technology Department project (2017T3015) and supported by National Key Research and Development Program of China (2018 YFD0901104) and also was supported by the Key Research & Development Plan of Shandong Province (2016GSF115009). Declaration of competing interest All the authors declared no competing interest. References [1] S. Bahadur, A.K. Sahu, P. Baghel, S. Saha, Current promising treatment strategy for glioblastoma multiform: a review, Oncol. Rev. 13 (2019) 417, https://doi.org/10. 4081/oncol.2019.417. [2] J.P. Thakkar, T.A. Dolecek, C. Horbinski, Q.T. Ostrom, D.D. Lightner, J.S. BarnholtzSloan, J.L. Villano, Epidemiologic and molecular prognostic review of glioblastoma, Cancer Epidemiol. Biomark. Prev. 23 (2014) 1985–1996, https://doi.org/10.1158/ 1055-9965.EPI-14-0275. [3] A.S. Silantyev, L. Falzone, M. Libra, O.I. Gurina, K.S. Kardashova, T.K. Nikolouzakis, A.E. Nosyrev, C.W. Sutton, P.D. Mitsias, A. Tsatsakis, Current and future trends on diagnosis and prognosis of glioblastoma: from molecular biology to proteomics, Cells 8 (2019) https://doi.org/10.3390/cells8080863. [4] C. Alifieris, D.T. Trafalis, Glioblastoma multiforme: pathogenesis and treatment, Pharmacol Therapeut 152 (2015) 63–82, https://doi.org/10.1016/j.pharmthera. 2015.05.005. [5] E. Pasquier, M. Kavallaris, Microtubules: a dynamic target in cancer therapy, IUBMB Life 60 (2008) 165–170, https://doi.org/10.1002/iub.25. [6] E. Mukhtar, V.M. Adhami, H. Mukhtar, Targeting microtubules by natural agents for cancer therapy, Mol. Cancer Ther. 13 (2014) 275–284, https://doi.org/10.1158/ 1535-7163.Mct-13-0791. [7] G. Chandrasekaran, P. Tatrai, F. Gergely, Hitting the brakes: targeting microtubule motors in cancer, Brit J Cancer 113 (2015) 693–698, https://doi.org/10.1038/bjc. 2015.264. [8] P. Diaz, E. Horne, C. Xu, E. Hamel, M. Wagenbach, R.R. Petrov, B. Uhlenbruck, B. Haas, P. Hothi, L. Wordeman, R. Gussio, N. Stella, Modified carbazoles destabilize microtubules and kill glioblastoma multiform cells, Eur. J. Med. Chem. 159 (2018) 74–89, https://doi.org/10.1016/j.ejmech.2018.09.026. [9] C. Oehler, K. Frei, E.J. Rushing, P.M. McSheehy, D. Weber, P.R. Allegrini, D. Weniger, U.M. Lutolf, A. Knuth, Y. Yonekawa, K. Barath, A. Broggini-Tenzer, M. Pruschy, S. Hofer, Patupilone (epothilone B) for recurrent glioblastoma: clinical outcome and
164
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[19]
[20]
[21]
[22] [23] [24] [25]
[26]
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164 translational analysis of a single-institution phase I/II trial, Oncology 83 (2012) 1–9, https://doi.org/10.1159/000339152. R. Stupp, S. Taillibert, A.A. Kanner, S. Kesari, D.M. Steinberg, S.A. Toms, L.P. Taylor, F. Lieberman, A. Silvani, K.L. Fink, G.H. Barnett, J.J. Zhu, J.W. Henson, H.H. Engelhard, T.C. Chen, D.D. Tran, J. Sroubek, N.D. Tran, A.F. Hottinger, J. Landolfi, R. Desai, M. Caroli, Y. Kew, J. Honnorat, A. Idbaih, E.D. Kirson, U. Weinberg, Y. Palti, M.E. Hegi, Z. Ram, Maintenance therapy with tumor-treating fields plus temozolomide vs temozolomide alone for glioblastoma: a randomized clinical trial, JAMA 314 (2015) 2535–2543, https://doi.org/10.1001/jama.2015.16669. Z.G. Liu, P.F. Xu, T. Wu, W.B. Zeng, Microtubule-targeting anticancer agents from marine natural substance, Anti-Cancer Agent Me 14 (2014) 409–417, https://doi. org/10.2174/187152061403140207163402. J.H. Miller, J.J. Field, A. Kanakkanthara, J.G. Owen, A.J. Singh, P.T. Northcote, Marine invertebrate natural products that target microtubules, J. Nat. Prod. 81 (2018) 691–702, https://doi.org/10.1021/acs.jnatprod.7b00964. M. Liu, X. Zhao, J. Zhao, L. Xiao, H. Liu, C. Wang, L. Cheng, N. Wu, X. Lin, Induction of apoptosis, G(0)/G(1) phase arrest and microtubule disassembly in K562 leukemia cells by Mere15, a novel polypeptide from Meretrix meretrix Linnaeus, Mar Drugs 10 (2012) 2596–2607, https://doi.org/10.3390/md10112596. H. Wang, J. Wei, N. Wu, M. Liu, C. Wang, Y. Zhang, F. Wang, H. Liu, X. Lin, Mere15, a novel polypeptide from Meretrix meretrix, inhibits adhesion, migration and invasion of human lung cancer A549 cells via down-regulating MMPs, Pharm. Biol. 51 (2013) 145–151, https://doi.org/10.3109/13880209.2012.715169. C. Wang, M. Liu, L. Cheng, J. Wei, N. Wu, L. Zheng, X. Lin, A novel polypeptide from Meretrix meretrix Linnaeus inhibits the growth of human lung adenocarcinoma, Exp Biol Med (Maywood) 237 (2012) 442–450, https://doi.org/10.1258/ebm.2012. 011337. J. Wang, C. Tang, C. Yang, Q. Zheng, Y.C. Hou, Tropomyosin-1 functions as a tumor suppressor with respect to cell proliferation, angiogenesis and metastasis in renal cell carcinoma, J. Cancer 10 (2019) 2220–2228, https://doi.org/10.7150/jca.28261. H. Pan, L.Q. Gu, B.J. Liu, Y.P. Li, Y.H. Wang, X.N. Bai, L. Li, B.S. Wang, Q. Peng, Z.G.G. Yao, Z.G. Tang, Tropomyosin-1 acts as a potential tumor suppressor in human oral squamous cell carcinoma, PLoS One 12 (2017) https://doi.org/10.1371/journal. pone.0168900ARTN e0168900. J. Zhao, J. Wei, M. Liu, L. Xiao, N. Wu, G. Liu, H. Huang, Y. Zhang, L. Zheng, X. Lin, Cloning, characterization and expression of a cDNA encoding a granulin-like polypeptide in Ciona savignyi, Biochimie 95 (2013) 1611–1619, https://doi.org/10.1016/j.biochi. 2013.05.001. V. Sarrazy, N. Vedrenne, F. Billet, N. Bordeau, S. Lepreux, A. Vital, M.O. Jauberteau, A. Desmouliere, TLR4 signal transduction pathways neutralize the effect of Fas signals on glioblastoma cell proliferation and migration, Cancer Lett. 311 (2011) 195–202, https://doi.org/10.1016/j.canlet.2011.07.018. Z.H. Chen, H.K. Hu, C.R. Zhang, C.Y. Lu, Y. Bao, Z. Cai, Y.X. Zou, G.H. Hu, L. Jiang, Downregulation of long non-coding RNA FOXD3 antisense RNA 1 (FOXD3-AS1) inhibits cell proliferation, migration, and invasion in malignant glioma cells, Am. J. Transl. Res. 8 (2016) 4106–4119. G. Eisele, M. Weller, Targeting apoptosis pathways in glioblastoma, Cancer Lett. 332 (2013) 335–345, https://doi.org/10.1016/j.canlet.2010.12.012. D. Hanahan, R.A. Weinberg, Hallmarks of cancer: the next generation, Cell 144 (2011) 646–674, https://doi.org/10.1016/j.cell.2011.02.013. J.J. Field, J.F. Diaz, J.H. Miller, The binding sites of microtubule-stabilizing agents, Chem. Biol. 20 (2013) 301–315, https://doi.org/10.1016/j.chembiol.2013.01.014. E. Mukhtar, V.M. Adhami, H. Mukhtar, Targeting microtubules by natural agents for cancer therapy, Mol. Cancer Ther. 13 (2014) 275–284, https://doi.org/10.1158/ 1535-7163.MCT-13-0791. B.H. Liu, H.M. Dong, X. Lin, X.S. Yang, X.J. Yue, J. Yang, Y.T. Li, L.Q. Wu, X.N. Zhu, S.Q. Zhang, D.F. Tian, J.M. Wang, Q. Cai, S.P. Mao, Q.X. Chen, J. Chang, RND3 promotes snail 1 protein degradation and inhibits glioblastoma cell migration and invasion, Oncotarget 7 (2016) 82411–82423, https://doi.org/10.18632/oncotarget.12396.
[27] F. Lefranc, J. Brotchi, R. Kiss, Possible future issues in the treatment of glioblastomas: special emphasis on cell migration and the resistance of migrating glioblastoma cells to apoptosis, J. Clin. Oncol. 23 (2005) 2411–2422, https://doi.org/10.1200/JCO.2005. 03.089. [28] S. Agarwal, P. Muniyandi, T. Maekawa, D.S. Kumar, Vesicular systems employing natural substances as promising drug candidates for MMP inhibition in glioblastoma: a nanotechnological approach, Int. J. Pharm. 551 (2018) 339–361, https:// doi.org/10.1016/j.ijpharm.2018.09.033. [29] P.F. Lu, V.M. Weaver, Z. Werb, The extracellular matrix: a dynamic niche in cancer progression, J. Cell Biol. 196 (2012) 395–406, https://doi.org/10.1083/jcb. 201102147. [30] K. Kessenbrock, V. Plaks, Z. Werb, Matrix metalloproteinases: regulators of the tumor microenvironment, Cell 141 (2010) 52–67, https://doi.org/10.1016/j.cell. 2010.03.015. [31] I. Paw, R.C. Carpenter, K. Watabe, W. Debinski, H.W. Lo, Mechanisms regulating glioma invasion, Cancer Lett. 362 (2015) 1–7, https://doi.org/10.1016/j.canlet.2015.03. 015. [32] K. Li, Y. Tu, Q. Liu, Y. Ouyang, M. He, M. Luo, J. Chen, R. Pi, A. Liu, PT93, a novel caffeic acid amide derivative, suppresses glioblastoma cells migration, proliferation and MMP-2/-9 expression, Oncol. Lett. 13 (2017) 1990–1996, https://doi.org/10.3892/ ol.2017.5663. [33] W. Yan, W. Zhang, L. Sun, Y. Liu, G. You, Y. Wang, C. Kang, Y. You, T. Jiang, Identification of MMP-9 specific microRNA expression profile as potential targets of antiinvasion therapy in glioblastoma multiforme, Brain Res. 1411 (2011) 108–115, https://doi.org/10.1016/j.brainres.2011.07.002. [34] O. Cohen-Inbar, M. Zaaroor, Glioblastoma multiforme targeted therapy: the chlorotoxin story, J. Clin. Neurosci. 33 (2016) 52–58, https://doi.org/10.1016/j. jocn.2016.04.012. [35] Q. Zheng, S. Diao, Q. Wang, C. Zhu, X. Sun, B. Yin, X. Zhang, X. Meng, B. Wang, IL-17A promotes cell migration and invasion of glioblastoma cells via activation of PI3K/ AKT signalling pathway, J. Cell. Mol. Med. 23 (2019) 357–369, https://doi.org/10. 1111/jcmm.13938. [36] X.J. Liu, X. Wu, Y.M. Wang, Y.H. Li, X.L. Chen, W.C. Yang, L.H. Jiang, CD47 promotes human glioblastoma invasion through activation of the PI3K/Akt pathway, Oncol. Res. 27 (2019) 415–422, https://doi.org/10.3727/096504018x15155538502359. [37] M. Natarajan, T.P. Hecker, C.L. Gladson, FAK signaling in anaplastic astrocytoma and glioblastoma tumors, Cancer J. 9 (2003) 126–133. [38] J.-S. Chen, X.-h. Huang, Q. Wang, J.-Q. Huang, L.-j. Zhang, X.-L. Chen, J. Lei, Z.-X. Cheng, Sonic hedgehog signaling pathway induces cell migration and invasion through focal adhesion kinase/AKT signaling-mediated activation of matrix metalloproteinase (MMP)-2 and MMP-9 in liver cancer, Carcinogenesis 34 (2013) 10–19, https://doi.org/10.1093/carcin/bgs274. [39] J.S. Chen, H.S. Li, J.Q. Huang, S.H. Dong, Z.J. Huang, W. Yi, G.F. Zhan, J.T. Feng, J.C. Sun, X.H. Huang, MicroRNA-379-5p inhibits tumor invasion and metastasis by targeting FAK/AKT signaling in hepatocellular carcinoma, Cancer Lett. 375 (2016) 73–83, https://doi.org/10.1016/j.canlet.2016.02.043. [40] K. Angara, T.F. Borin, M.H. Rashid, I. Lebedyeva, R. Ara, P.C. Lin, A. Iskander, R.J. Bollag, B.R. Achyut, A.S. Arbab, CXCR2-expressing tumor cells drive vascular mimicry in antiangiogenic therapy-resistant glioblastoma, Neoplasia 20 (2018) 1070–1082, https://doi.org/10.1016/j.neo.2018.08.011. [41] W. Kang, S.H. Kim, H.J. Cho, J. Jin, J. Lee, K.M. Joo, D.H. Nam, Talin1 targeting potentiates anti-angiogenic therapy by attenuating invasion and stem-like features of glioblastoma multiforme, Oncotarget 6 (2015) 27239–27251, https://doi.org/10. 18632/oncotarget.4835. [42] E.I. Deryugina, J.P. Quigley, Pleiotropic roles of matrix metalloproteinases in tumor angiogenesis: contrasting, overlapping and compensatory functions, Biochim. Biophys. Acta 1803 (2010) 103–120, https://doi.org/10.1016/j.bbamcr.2009.09.017.
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules journal homepage: http://www.elsevier.com/locate/ijbiomac
A tropomyosin-like Meretrix meretrix Linnaeus polypeptide inhibits the proliferation and metastasis of glioma cells via microtubule polymerization and FAK/Akt/MMPs signaling Zhongjun Fan a,c,1, Qi Xu a,d,1, Changhui Wang e, Xiukun Lin f, Quanbin Zhang a, Ning Wu a,b,⁎ a
Key Laboratory of Experimental Marine Biology, Center of Ocean Mega-Science, Institute of Oceanology, Chinese Academy of Sciences, Qingdao, China Laboratory for Marine Drugs and Bioproducts, Pilot National Laboratory for Marine Science and Technology, Qingdao, China c School of Marine and Biological Engineering, Yancheng Teachers University, Yancheng, China d Laboratory of Immunology for Environment and Health, Shandong Analysis and Test Center, Qilu University of Technology (Shandong Academy of sciences), Jinan, China e Shanghai Neuromedical Center, Qingdao University, Shanghai, China f Department of Pharmacology, School of Pharmacy, Southwest Medical University, Luzhou, China b
a r t i c l e
i n f o
Article history: Received 17 October 2019 Received in revised form 18 December 2019 Accepted 18 December 2019 Available online 20 December 2019 Keywords: Polypeptide Glioblastoma Proliferation Metastasis
a b s t r a c t Glioblastoma (GBM) represents the most common, aggressive and deadliest primary tumors with poor prognosis as available therapeutic approaches fail to control its aberrant proliferation and high invasiveness. Thus, the therapeutic agents targeting these two characteristics will be more effective. In present study, a novel polypeptide (MM15), which was originally purified from Meretrix meretrix Linnaeus and has been proven to possess potent antitumor activity by our laboratory, was recombinant expressed and identified as a tropomyosin homologous protein. The recombinant polypeptide (re-MM15) could induce the U87 cell cycle arrest in G2/M phase and cell apoptosis by inducing tubulin polymerization. Additionally, re-MM15 displayed the significant inhibition to the migration and invasion of U87 cells through downregulating FAK/Akt/MMPs signaling. Furthermore, the in vivo analysis suggested that re-MM15 significantly blocked tumor growth in U87 xenograft model. Collectively, our results indicated that re-MM15, with anti-GBM properties in vitro and in vivo, has promising potential as a new anticancer candidate for GBM. © 2018 Elsevier B.V. All rights reserved.
1. Introduction Glioblastoma (GBM) is a highly aggressive primary brain tumor [1]. Even with the current standard therapies, such as surgery resection of the tumor and followed by radio-therapy and chemotherapy, the survival of GBM patients remains poor, with a 5-year survival rate of only 3% [2]. Therefore, GBM has been the third leading cause of cancer related death for 15–34 aged people [3]. To date, chemotherapy is expected to provide more and better opportunities for effective treatment of GBM. However, chemotherapies for GBM, including TMZ, carmustine (BCNU) and lomustine (CCNU), platinum agents, etoposide, irinotecan and PCV combination, have not been able to battle effectively GBM [4]. Thus, more novel and effective therapeutic agents for treating GBM should be developed.
⁎ Corresponding author at: Key Laboratory of Experimental Marine Biology, Center of Ocean Mega-Science, Institute of Oceanology, Chinese Academy of Sciences, Qingdao, China. E-mail address: [email protected] (N. Wu). 1 The two authors are equal contribute to this work.
https://doi.org/10.1016/j.ijbiomac.2019.12.158 0141-8130/© 2018 Elsevier B.V. All rights reserved.
In proliferating cells, microtubules are the essential components of mitotic spindle formation in division process. Disrupting the dynamic equilibrium of microtubule could arrest cell-cycle progression at mitosis, leading to cell proliferation inhibition [5]. Based on this function, small molecules that target microtubules (MTs) like paclitaxel and vinca alkaloids provide the promising therapeutics to treat many subtypes of cancers [6,7], particularly GBM [8]. Because there are accumulating evidence suggested that GBM is especially sensitive to microtubule-targeting agents (MTAs) [8]. Furthermore, human clinical trials that MTA treatment could receive the positive results in GBM patients further indicated the sensitivity of GBM to disruption of MT function [9,10]. As we all know, marine sources are a promising source for developing MTAs, for example, invertebrate animals, algae and fungi [11,12]. In our previous study, we had isolated a novel ~15 kDa polypeptide we call MM15 from Meretrix meretrix Linnaeus, which not only blocked the proliferation of K652 leukemia cells through inducing microtubule disassembly [13] but also inhibited the metastasis of human lung cancer cell via downregulating matrix metalloproteinases (MMPs) [14,15]. According to the above findings, we guessed that MM15, a microtubule-targeting agent, may also exhibit the anti-tumor activity in GBM.
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
155
Hence, in order to verify the above-mentioned guess, the anticancer activity of MM15 against GBM in vitro and in vivo was comprehensively detected in present study. We first got the recombinant MM15 (re-MM15) and confirmed it as a novel tropomyosin-like polypeptide by sequence analysis. There are studies have reported that tropomyosin such as tropomyosin-1 (TPM1) acted as tumor suppressor in some type cancers [16,17]. Additionally, we demonstrated that re-MM15 exerted its cytotoxic effect on U87 cells by promoting myotubule polymerization and G2/M arrest, which was followed by cell apoptosis induction eventually. We also found that re-MM15 suppressed the migration and invasion ability of U87 cells through inhibiting FAK/Akt/MMPs signaling. Moreover, the anti-proliferation activity and edible safety of re-MM15 in vivo were further clarified.
F-actin (#205) and Bcl-2 (#32124) were purchased from Abcam (Cambridge, MA, USA). GAPDH, β-actin antibody and all secondary antibodies were obtained from Proteintech Group (Wuhan, China).
2. Materials and methods
U87 cells were seeded at a concentration of 1000 cells per well in 6well plates. Twenty-four hours after seeding, cells were treated with different concentrations of re-MM15 (0, 2, 4, 8 μM) for 20 min and then incubated for two weeks to allow colony formation. Colonies in each well were washed with PBS, fixed with 4% paraformaldehyde for 15 min, stained with 0.5% crystal violet for 10 min. Then, the colonies were photographed and counted.
2.1. Recombinant expression of MM15 Total RNA was isolated from the tissues of M. meretrix using Trizol (Takara, Japan) according to the manufacture's protocol and then the first-strand cDNA was synthesized by reverse transcription with RevertAid™ First Strand cDNA Synthesis Kit (Thermo Fisher). The cDNA sequence of MM15 was amplified by rTaq polymerase (Takara, Japan) with specific primers MM15-F: CGCCGAATTCATGGATGCTAT CAAGAAGAAGATGCAGGCA and MM15-R: CCGAAGCTTTTAGTAT AAAGCAAATTCAGCAAATATTGATC. Then, the full-length cDNA sequence of MM15 and the deduced amino acid sequence were analyzed by DNASTAR (version7.1.0) software package and the homology analysis was performed by Blast search (www.ncbi.nih. gov). Bacterial expression system was used to acquire the recombinant MM15. A MM15 expression vector (pET32a/MM15) was constructed by inserting the purified PCR products into the NcoI and XhoI restriction sites of pET32a (t) vector. Then, recombinant MM15 was expressed and purified as described in our former work [19]. Briefly, the recombinant plasmid pET32a/MM15 was transformed into E. coli strain Origami (DE3) (Novagen, USA), and incubated in LB (L-Broth or Luria Bertani) medium (containing 100 mg/ ml ampicillin) at 28 °C. After the value of OD600 of the culture mediums reached around 0.6, isopropylthio-β-galactoside (IPTG) was added at a final concentration of 0.1 mM and the cells were incubated overnight at 25 °C. Then, cells were collected by centrifugation (6000g, 10 min, 4 °C). The purification procedure was performed following the manufacture's protocol (Ni-NTA superflow cartridge, Qiagen). The expression of recombinant protein and the purified protein was determined by SDS-PAGE (15% separating gel and 5% stacking gel), respectively.
2.3. Cell proliferation assay Cell proliferation was determined by MTT assay. The cells were seeded in 96-well plates and incubated overnight. After treated with various concentrations of re-MM15 for different time, the attached cells were incubated with MTT for 4 h. The formazan was dissolved by DMSO and the optical density (OD) was measured at a wavelength of 490 nm. 2.4. Colon formation assay
2.5. Flow cytometry analysis The cell cycle distribution and cell apoptosis were analyzed by flow cytometry (Becton Dickinson, Franklin Lakes, NJ, USA). 2.5.1. Cell cycle analysis For cell cycle assay, the U87 cells (4 × 105 cells/well) were harvested after 0, 2, 4, 8 μM re-MM15 treatment, washed twice with PBS and fixed in cold 70% ethanol at −20 °C overnight. After washed with PBS, the fixed cells were stained with propidium iodide solution containing 20 μg/ml RnaseA (Sigma, St. Louis, MO, USA) and 50 μg/ml propidium iodide (PI, Sigma, St. Louis, MO, USA) for 30 min at 37 °C in the dark. Then, the cells were detected by flow cytometry. 2.5.2. Cell apoptosis analysis After treated with various concentrations of re-MM15 (0, 2, 4, 8 μM) for 20 min, the U87 cells in 6-well plates were trypsinized gently, washed twice with cold PBS, re-suspended in 500 μl Annexin V binding buffer, and then incubated with 5 μl Annexin V-FITC and 5 μl PI in the dark for 15 min. Finally, the cells were analyzed in three different experiments using cytometry and the apoptosis population were measured with FlowJo X software. 2.6. Western blot analysis
2.2. Materials and cell culture U87 MG, PANC-28, ASPC-1, Hela, HCT-116, MCF-7, BEL-7402 and NIH/3 T3 cells were purchased from the Chinese Academy of Science Cell Bank (Shanghai, China). Among them, U87 MG, PANC-28, ASPC-1, Hela and NIH/3 T3 cells were cultured in DMEM (Hyclone); HCT-116 and BEL-7402 were cultured in RPMI-1640 (Hyclone); MCF-7 cell was cultured in MEM. All media were added 10% fetal bovine serum (Gibco) and 1% penicillin/streptomycin and all cell lines were maintained at 37 °C in a humidified atmosphere of 5% CO2. Primary antibodies used in this study: FAK (#1688), MMP-2 (#13595) and MMP-9 (#21733) antibody were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Phospho-FAK (#3398) was obtained from Affinity Biosciences (Cincinnati, OH, USA). PARP (#9532), Bcl-xL (#2764), Cleaved-Caspase 3 (#9661), Phospho-Akt (#4060), Akt (#4685), Phospho-cdc2 (#4539), cdc2 (#77055), cdc25C (#4688), Cyclin B1 (#12231) and Ki67 (#9027) were purchased from Cell Signaling Technology (Danvers, MA, USA). β-Tubulin (#179513),
U87 cells treated with re-MM15 were washed three times with PBS and lysed with RIPA lysis buffer containing PMSF. Protein concentrations were quantified using the BCA Protein Assay Kit (Beyotime, Guangzhou, China). The proteins were separated by 8% or 10% SDS-PAGE and transferred onto PVDF membranes (Millipore, Billerica, MA, USA). The membranes were blocked with 5% non-fat milk for 1 h at room temperature, then incubated with primary antibodies overnight at 4 °C and subsequently incubated with secondary antibody at room temperature for 1 h. Protein antibody complexes were detected using enhanced chemiluminescence (ECL) reagent (Bio-Rad, Hercules, CA) with the ChemiDoc XRS imaging system (Bio-Rad, USA). 2.7. Immunofluorescence assay U87 MG cells were seeded onto glass coverslips and cultured in the 10% FBS DMEM. Twenty-four hours later, cells were treated with
156
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
different concentrations of re-MM15 for 20 min. Then, the cells were washed three times with PBS, fixed with 4% formaldehyde for 20 min and treated with 0.5% Triton-X 100. After washed with PBS, the cells were blocked with 5% bovine serum albumin for 30 min and incubated with anti-β-tubulin antibody (1:500 dilution) and F-actin antibody (1:500 dilution) overnight at 4 °C. Then, the cells were stained with FITC-conjugated secondary antibody (1:400 dilution) at room temperature for 1 h and followed by DAPI staining for 10 min in the dark. Images were recorded by confocal microscopy (Carl Zeiss, Oberkochen, Germany).
2.8. Tubulin polymerization assay The effect of re-MM15 on the tubulin polymerization in vitro was measured using the Tubulin Polymerization Assay Kit (Cytoskeleton Inc., Denver, CO) according to recommended protocol. Briefly, the tubulin proteins (final concentration 2 mg/ml) were added to each well of a prewarmed 96-well, black, flat-bottomed plate (Corning Costar) and exposed to re-MM15, vincristine, docetaxel and control buffer. After 1 min incubation at 37 °C on a fluorescence microplate reader (Tecan, Mannedorf, Switzerland), the polymerization of tubulin was measured
Fig. 1. The recombinant of MM15 and the assessment of its cytotoxicity. (A) Sequence of MM15 cDNA and deduced amino acid. (B and C) Sequence alignment of MM15 with tropomyosin from several marine invertebrate species. (D) The purity assessment of re-MM15. (E) The IC50 values of re-MM15 on U87, PANC-28, ASPC-1, Hela, HCT-116, MCF-7, BEL-7402 cells and NIH/ 3 T3 cells.
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
by the change in fluorescence intensity at Ex 360 nm/Em 450 nm every 1 min for 40 min.
157
3. Result 3.1. re-MM15 is a tropomyosin-like polypeptide and possesses the cytotoxicity to cancer cells
2.9. Wound-scratch assay The effect of re-MM15 on motility ability of U87 cells was assessed using wound scratch assay. U87 cells were seeded into 6-wells plates with a concentration of 5 × 105 cells/well. After reaching 90% confluence, U87 cells were starved in serum-free DMEM for 12 h and then scratched by a sterile pipette tip. The cells were treated with re-MM15 (0 or 4 μM) for 20 min. To observe the recovery post-wounding, images of the matched pair wound regions were imaged using microscope at 0, 12, 24 h.
2.10. Matrigel invasion assay The transwell chambers (8.0 μm pore size, Corning) were used to detect the invasive ability of U87 cells. After treated with indicated concentrations of re-MM15 for 20 min, U87 cells were resuspended with serum-free DMEM at a density of 5 × 104 cells/ml. 200 μl diluted cells were seeded into the upper compartments of Matrigel (5 × dilution, 50 μl, BD Bioscience) coated transwell chambers, and 600 μl 10% FBS DMEM was added to the lower compartments. After 24 h incubation, non-invading cells in the upper compartments were removed using cotton buds, and the invading cells were fixed with 4% paraformaldehyde and stained with 0.5% crystal violet. Then, the invading cells were photographed by microscope and counted by ImageJ software.
2.11. Mouse xenograft model All experiments with animals were approved by the Animal Care and Use Committee of Institute of Oceanology, Chinese Academy of Sciences and in accordance with all appropriate regulatory standards. Subcutaneous tumors were established by injecting U87 cells (1 × 106 cells/mice) into the right flank of 5–6 weeks old nude mice. When the tumor size reached approximately 100 mm3, mice were randomly divided into three groups, with 6 mice in each group; the control group was treated with vehicle and the other two groups were treated with 25 mg/kg and 50 mg/kg re-MM15, respectively. The body weight and tumor size (length × width2 / 2) were measured once every three days. Fifteen days after treated with vehicle or re-MM15, mice were sacrificed. The xenografted tumors were removed for further analysis.
2.12. H&E and immunohistochemistry Tumor, heart, liver, kidney and lung tissues were removed from sacrificed mice, fixed with 10% formaldehyde, embedded in paraffin and then cut into 3–4 μm thick sections. The tumor tissues were stained using antibodies against Ki67, p-FAK and MMP-2. Heart, liver, kidney and lung tissues were stained with hematoxylin and eosin. Stained tissue sections were observed using a light microscope (Nikon, Tokyo, Japan).
2.13. Statistical analysis Statistical analyses were performed using GraphPad Prism 5.0 (San Diego, CA) or SPSS 19.0 (Chicago, IL, USA). All data were present as value of mean ± SEM. Statistical comparison was performed using one-way ANOVA. P b 0.05 was considered significant.
MM15, which was extracted from M. meretrix, possessed good antitumor activity in lung cancer cell and K652 leukemia cell. However, due to the difficulty and the low yield in MM15 isolation, it is essential to obtained more MM15 by recombinant expression. First, based on the results of mass spectrometer analysis on MM15, we cloned the cDNA sequence of MM15 precursor (Fig. 1A). Then, we used the BLAST search to reveal that the amino acid sequence of MM15 shared overall amino acid identities ranged from 83.9% to 98.29% with tropomyosin of some marine invertebrate animals (Fig. 1B and C). Finally, we obtained the purified re-MM15 (~13.58 kD) and re-examined the cytotoxicity of reMM15 to cancer cells, which suggested that re-MM15 significantly inhibited the growth of different types of cancer cells including U87, PANC-28, ASPC-1, Hela, HCT-116, MCF-7 and BEL-7402 cells (Fig. 1D), but had less cytotoxicity to the normal cells (NIH/3T3 cells) (Fig. 1E). 3.2. re-MM15 inhibits U87 cell growth Given that re-MM15 showed most significant cytotoxicity to U87 cell with an IC50 value of 2.12 ± 0.14 μM, we further illustrated the inhibitory activity of re-MM15 against U87 cell proliferation and growth more specifically. We took photos to observe the morphological changes of U87 cells after treating re-MM15 (0, 2, 4, and 8 μM) for 20 min. As shown in Fig. 2A, re-MM15 could lead to cell shrinkage, deformation and viable cells reduction. The cell number was dramatically lower in re-MM15 treated cells than in the control ones (Fig. 2B). Moreover, the U87 cell viability was markedly inhibited when administrated with re-MM15 (8 μM) just for 30 min (Fig. 2C). Next, we used colony formation assay to assess the long-term effects of re-MM15 on U87 cell. As shown in Fig. 2D and E, the colonies formed in re-MM15 treated cells were much fewer than those formed in control cells, indicating reMM15 significantly impaired the clonogenic potential in a dosedependent manner. Therefore, these results demonstrated that reMM15 dramatically inhibited cell proliferation and led to growth arrest in U87 cell. 3.3. re-MM15 induces cell cycle arrest in U87 cell by promoting microtubule polymerization In order to investigate the mechanism of U87 cell growth inhibition by re-MM15, we first detected its contribution to the induction of cell cycle arrest. U87 cells were treated with various concentrations of reMM15 and then were stained with PI for cell cycle analysis. As shown in Fig. 3A, U87 cells, which were treated with re-MM15, arrested in G2/M phase. Compared with the control group, the percentage of G2/ M phase was increased from 4.05 ± 0.73% to 17.6 ± 1.4% at a concentration of 4 μM, while the G0/G1 phase was decreased (Fig. 3B). Accordingly, the G2/M related protein such as Cyclin B1, cdc2 and cdc25C were significantly decreased, and the phosphorylation of cdc2 was increased in re-MM15 treated U87 cells (Fig. 3C and D). Taken together, these results implied that re-MM15 could induce G2/M cell cycle arrest in U87 cells. Additionally, to further explore the mechanism of re-MM15 on G2/M cell cycle, we detected the regulation of re-MM15 on the microtubular dynamics. First, we examined the effect of re-MM15 on the cellular tubulin polymer mass by quantitative immunofluorescent microscopy of cellular β-tubulin and F-actin staining. We discovered that re-MM15 treatment resulted in an increase in the density of cellular microtubules (Fig. 3E). Subsequently, Western blot was used to further evaluate the effect of re-MM15 on the intracellular microtubular network. The results showed that re-MM15 induced the increase expression of β-tubulin in U87 cells (Fig. 3F).
158
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
Fig. 2. The effect of re-MM15 on U87 cell proliferation and growth. (A) Cell morphology was observed and photographed by inverted microscope (magnification 100×). (B and C) Survival rate of U87 cell treated by different concentration and time of re-MM15. The survived cells were detected by MTT assay. Results are normalized to control and represented as mean ± SEM (n = 4). *P b 0.05, **P b 0.01, compared with the control. (D and E) The effect of re-MM15 on the colony formation. After treated by various concentrations of re-MM15 for 20 min, U87 cells were cultured for two weeks to form colonies. The formative colonies were stained with crystal violet and counted. *P b 0.05, **P b 0.01, compared with the control. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
These consistent results indicated that re-MM15 may enhance microtubule assembly and stability. Hence, we used MT assembly assay with purified components in a cell-free system to further determine the direct effect of re-MM15 on tubulin polymerization. As shown in Fig. 3G, as expected, paclitaxel increased polymerization whereas the MT-destabilizing molecule vinblastine inhibited tubulin polymerization. Similar to paclitaxel, re-MM15 exhibited promotion of microtubule formation to some extent, suggesting re-MM15 promoted tubulin polymerization in vitro.
3.4. re-MM15 promotes apoptosis in U87 cell Then, the effect of re-MM15 on cell apoptosis was investigated in U87 cells. U87 cells were treated with various concentrations of re-MM15, then were co-stained with PI and Annexin-V FITC and the number of apoptotic cells was examined by flow cytometry. As shown in Fig. 4A and B, as compared with control group, the percentage of apoptotic cells in re-MM15 treated group was significantly increased in a dose-dependent manner. Subsequently,
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
159
Fig. 3. re-MM15 induced G2/M phase arrest in U87 cells by promoting polymerization. (A–D) re-MM15 induced U87 cell cycle arrest. (A and B) U87 cells were treated by different doses of re-MM15 for 20 min. U87 cells were stained with propidium iodide (PI) and the cell cycle phases were analyzed by flow cytometry. (C and D) Western blot analysis of G2/M related proteins including p-cdc2, cdc2, cdc25C and Cyclin B1 after re-MM15 treatment. Band density was quantified and normalized with GAPDH. (E–G) re-MM15 promoted microtubule polymerization. (E) re-MM15 treated U87 cells were fixed and stained with β-tubulin (green) and F-actin (red) antibodies, fluorescence images were then viewed by confocal microscope (scale bar: 20 μm). (F) After treated with re-MM15 for 20 min, U87 cell lysates was centrifuged to separate polymerized microtubules and the β-tubulin expression was measured by Western blot. (G) In vitro polymerization of tubulin assay. Purified tubulin protein was incubated with 16 μM re-MM15 and reference compounds at 37 °C and polymerization was kinetic monitored by excitation at 360 nm and emission at 450 nm. All data were presented as the mean ± SEM of three independent experiments. *P b 0.05, **P b 0.01 compared with the control. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
we also detected the protein expression of anti-apoptotic Bcl-2 family proteins (Bcl-2 and Bcl-xL), caspase-3 and PARP by Western bolt (Fig. 4C and D). The results showed that re-MM15 could induce the downregulation of Bcl-2 and Bcl-xL and the increase of cleaved caspase-3 and cleaved PARP in U87 cells, which indicated that re-MM15 markedly promoted U87 cells apoptosis.
3.5. re-MM15 inhibits U87 cell migration and invasion via regulating FAK/ Akt/MMPs signaling pathway Next, we further investigated whether re-MM15 affected cell migration and invasion by using wound healing and transwell assay respectively. As shown in Fig. 5A and B, the results of the wound healing assay indicated that re-MM15 (4 μM) markedly inhibited the migration
160
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
Fig. 4. re-MM15 induced apoptosis in U87 cells. (A and B) U87 cells were treated with re-MM15 (0, 2, 4, 8 μM) for indicated time and FITC, Annexin V/PI staining was used to identify apoptosis induced by re-MM15. Three independent experiments were carried and data were represented as mean ± SEM. *P b 0.05, **P b 0.01 compared with the control. (C) Western blot analysis of apoptosis related proteins. (D) Band density was quantified by Image J and normalized with GAPDH. *P b 0.05, **P b 0.01 compared with the control.
of U87 cells. Similarly, the Matrigel invasion assay showed that, compared with control group, the number of U87 cells passed through Matrigel-coated membrane into the lower chamber was significantly lower in re-MM15 treatment group, suggesting that re-MM15 inhibited the invasion ability of U87 cells in a dose-dependent manner (Fig. 5C and D). Then, to further determine the mechanism of re-MM15 contributing to metastasis, we investigated the regulation of re-MM15 on the FAK/Akt/MMPs signaling pathways. As shown in Fig. 5E and F, the results of Western blot indicated that the phosphorylation of FAK and Akt were significantly decreased when U87 cells were treated with reMM15. Moreover, the protein expression levels of MMP-2 and MMP-9
in U87 cells after re-MM15 treatment were both obviously reduced in a dose-dependent manner (Fig. 5E and F). These above findings indicated that re-MM15 inhibited both migration and invasion of U87 cells by targeting FAK/Akt/MMPs pathway. 3.6. re-MM15 blocks U87 cell tumor growth in vivo After characterizing the efficacy of re-MM15 in U87 cells, we finally used a mouse xenograft model to validate its anti-cancer activity in vivo. U87 xenografts were generated by subcutaneous flank injection of U87 cells into nude mice. One week after U87 cells injection, tumors were
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
161
Fig. 5. re-MM15 inhibited the metastasis of U87 cells through downregulating FAK/Akt/MMPs signaling. (A and B) Suppression of U87 cell migration by re-MM15. Wound closures of U87 cells were photographed at 0 h, 12 h and 24 h following treatment with different concentrations of re-MM15 (scale bar: 100 μm). Error bars represented the mean ± SEM of triplicate independent experiments. (C–D) Inhibition of U87 cell invasion by re-MM15. After treated with indicated concentrations of re-MM15, U87 cells were seeded in Matrigel-coated transwell chambers and the invaded cells were stained and calculated. Shown are representative images of invaded cells (scale bar: 100 μm). The bar graphs showed mean ± SEM of the numbers of invaded cells from three independent assays. (E–F) Downregulation of FAK/Akt/MMPs signaling by re-MM15. The expression of p-FAK, FAK, p-Akt, Akt, MMP-2, MMP9 were detected by Western blot. Band density was quantified and normalized with GAPDH. The results shown are mean ± SEM (n = 3). *P b 0.05, **P b 0.01 versus control group.
visible. Another one week later, the volume of most of the subcutaneous tumors reached to 100 mm3, then, these mice were treated with either re-MM15 or PBS. The tumor growth curves showed that tumors in reMM15 treated group grew slowly compared with that in control group (Fig. 6A). And, the tumor volume of re-MM15 treated group was significantly lower than that of control group (Fig. 6B). Immunohistochemistry performed on xenograft tissues also revealed the significant decrease of
cell proliferation in re-MM15 treated tumor, as measured by Ki67 (Fig. 6E). As shown in Supplementary Fig. 1, the tumor in the PBS treated group was found to have abundant vascular tissue, with tumor infiltrating into the surrounding tissue, and its margin was not clear. However, in the re-MM15 treated group, the tumor blood vessels were rarely distributed (Supplementary Fig. 1). Moreover, the expression of p-FAK and MMP-2 in re-MM15 treated tumor tissues was significantly reduced (Fig. 6E).
162
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
Fig. 6. The anticancer activity of re-MM15 in vivo. (A) The tumor growth curve. BALB/c nude mice were intraperitoneally treated with re-MM15 (25, 50 mg/kg) or PBS (served as control) for 15 days. Tumor volume was measured every three days. Data were represented as the mean ± SEM (n = 6). *P b 0.05, **P b 0.01 versus control group. (B) Representative photographs of the tumors in three groups. (C) Mice body weights were measured every 3 days during re-MM15 treatment. *P b 0.05, **P b 0.01 versus control group. (D) The heart, liver, kidney and lung tissues were resected and performed for H&E staining (Scale bar: 200 μm). (E) Tumor tissues in different groups were immunostained for Ki67, p-FAK, MMP-2 (scale bar: 200 μm).
Taken together, these results demonstrated that re-MM15 significantly inhibited U87 cells proliferation and metastasis potential in vivo. Additionally, the systemic toxicity of re-MM15 was also assessed by monitoring body weight and performing H&E staining on mice organs. As shown in Fig. 6C and D, no significant changes in body weight and no obvious abnormalities in the H&E staining of heart, liver, kidney and lung tissues were observed in re-MM15 treated mice, suggesting that re-MM15 had little toxicity to mice at the curative dose. 4. Discussion Glioblastoma (GBM) is the most common and malignant tumor in the central nervous system. The poor clinical outcome of GBM patients
is mainly attributed to its two characteristics: aberrant proliferation and high migration and invasion [20,21]. Hence, inhibition of glioma cell proliferation and metastasis has been an effective strategy for treating GBM. In our present study, on the one hand, we have taken out a series of experiments to detect the effect of re-MM15 on proliferation of U87 cell. The results showed that re-MM15 exhibited the general cytotoxicity to several cancer cell lines and possessed the greatest inhibitory effect against U87, with an IC50 value of 2.12 ± 0.14 μM (Fig. 1E). Moreover, the cell growth and colony formation assays also confirmed the significant inhibitory activity of re-MM15 on U87 cell proliferation (Fig. 2). The further mechanism study attributed this inhibitory effect to the induction of cell cycle arrest and apoptosis by re-MM15 (Figs. 3A and 4A).
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164
Usually, cell proliferation is strictly regulated by the cell cycle machinery. Our results showed that re-MM15 induced the G2/M phase arrest of U87 cells, which was proved by the decrease of cdc25C and Cyclin B1, as well as the increase of phosphorylated cdc2 (Fig. 4C and D). Cell apoptosis is another mechanism of U87 cell proliferation inhibition by re-MM15. Actually, one of the reasons for dismal prognosis of GBM is its resistance to different apoptotic stimuli [22]. There are two apoptotic pathways: the mitochondria-mediated apoptosis pathway and the death receptor-mediated apoptosis pathway. The proteins of Bcl-2 family (Bax, Bak, Bcl-2 and Bcl-xL, etc.) play vital role in the mitochondrial pathway of apoptosis [23]. Under the treatment of re-MM15, the antiapoptotic proteins like Bcl-2 and Bcl-xL were decreased, and the cleaved-Caspase-3 and cleaved-PARP were increased, demonstrating that re-MM15 was a good pro-apoptotic agent targeting mitochondrial pathway. So far as we know, the mechanism of microtubule stabilizing agents (MSAs) is usually to bind the tubulin, and then block mitosis in the G2/M phase in cell cycle, and eventually induce programmed cell apoptosis [24]. This fact gave us the motivation to detect the association between the microtubule and re-MM15. Thus in our subsequent study, we determined that re-MM15 could promote microtubule polymerization (Fig. 3E–G), suggesting it is a microtubule-stabilizing agent (MSA), which is not consistent to our previous study [13]. In recent years, as a result of the successful development of microtubule-targeting agents (MTAs) in the cancer treatment, microtubules represented the good cancer target [25]. In our present study, it was because the disturbance of re-MM15 on microtubules that caused the significant inhibitory effect on glioma cell proliferation. On the other hand, for GBM patients, main obstacle to the effective treatment is the migration and invasion of glioma cells from the initial tumor into surrounding normal brain, causing the post-surgical recurrence [26,27]. In the view of this fact, studying the effect of re-MM15 on the metastasis would provide the better assessment of the anticancer activity of re-MM15. Our results demonstrated that re-MM15 significantly inhibited U87 cell migration and invasion in a dosedependent manner (Fig. 5A–D). The migration and invasion of glioblastoma tissue requires the interaction among the cancer cells and the extracellular matrix (ECM), and relies on various signaling pathways [28]. In order to create a path for invasion, glioma cells get through the ECM by degrading extracellular matrix proteins. Many studies have reported that matrix-metalloproteinases (MMPs) are involved in this degradation and are overexpressed in almost all cancer types of cancer, including GBM [29–31]. Especially, MMP-2 and MMP-9 play key roles in glioma progression and aggression [32], and inhibiting MMP-2 or MMP-9 expression or activity usually prevents GBM invasion [33,34]. Our results revealed that re-MM15 treatment significantly decreased the expression of MMP-2 and MMP-9 in U87 cells (Fig. 5E and F). Thus, we determined that MMP-2 and MMP-9 mediated the inhibition of U87 cell migration and invasion by re-MM15. Then, the mechanism underlying re-MM15-induced downregulation of MMPs expression in U87 cells was investigated. Accumulating evidence have demonstrated that PI3K/Akt signaling contributes to the migration and invasion of glioma cell by regulating MMP-2 and MMP-9 expression and activity [31,35,36]. Additionally, as a major kinase of focal adhesions, FAK is involved in the promotion of cell migration and invasion in GBM [37]. Notably, in this process, FAK tyrosine phosphorylation plays a vital role, because the phosphorylation at Tyr 397 of FAK could promote the combination between FAK and PI3K, which in turn activates Akt, ultimately increasing the MMPs [38,39]. In agreement with it, in our study, the phosphorylation of FAK and Akt in re-MM15 treated U87 cells were both decreased (Fig. 5E and F). Hence, we determined that re-MM15 inhibited the U87 cell migration and invasion through FAK/Akt signaling-mediated inhibition of MMP-2 and MMP-9. Furthermore, we used in vivo study to further determine the inhibitory activity of re-MM15 in proliferation and metastasis of glioma cell. In Fig. 6, re-MM15 suppressed the U87 cell proliferation and growth without any significant toxicity in nude mice. In accordance with the
163
finding in vitro, re-MM15 downregulated the phosphorylation level of FAK and the expression of MMP-2 protein in GBM xenografted tissues, which was a prediction that re-MM15 could inhibit the migration and invasion ability of U87 cells in vivo. The decreased tumor blood vessels and fewer tumor infiltrating into surrounding tissue in re-MM15 treated group might be another evidence of migration inhibition (Supplementary Fig. 1), because GBM-associated blood vessels make them highly invasive [40] and anti-angiogenesis might be an effective therapeutic strategy against GBM [41]. Furthermore, MMP-2 and MMP-9 have been well-documented as the contributor to the tumor angiogenesis [42]. It can be seen that angiogenesis inhibition was one of the results of FAK/Akt/MMPs signaling inhibition by re-MM15. Hence, the further assessment about the effect of re-MM15 on glioma cell invasion in vivo will be conducted and the results will be reported in due course. Taken together, re-MM15, a new recombinant polypeptide, was identified as a microtubule-stabilizing agent and exerted effective anti-GBM activity by suppressing the proliferation and metastasis of U87 cell in vitro and in vivo. As a result, re-MM15 is a promising anticancer candidate for the treatment of human glioblastoma and is worth further investigation.
Author statement Each of the coauthors has seen and agreed with the changes made to this manuscript in the revision. Supplementary data to this article can be found online at https://doi. org/10.1016/j.ijbiomac.2019.12.158. Acknowledgement This work was funded by the National Natural Science Foundation of China (Grant No. 81872906) and was supported by Fujian Provincial Science and Technology Department project (2017T3015) and supported by National Key Research and Development Program of China (2018 YFD0901104) and also was supported by the Key Research & Development Plan of Shandong Province (2016GSF115009). Declaration of competing interest All the authors declared no competing interest. References [1] S. Bahadur, A.K. Sahu, P. Baghel, S. Saha, Current promising treatment strategy for glioblastoma multiform: a review, Oncol. Rev. 13 (2019) 417, https://doi.org/10. 4081/oncol.2019.417. [2] J.P. Thakkar, T.A. Dolecek, C. Horbinski, Q.T. Ostrom, D.D. Lightner, J.S. BarnholtzSloan, J.L. Villano, Epidemiologic and molecular prognostic review of glioblastoma, Cancer Epidemiol. Biomark. Prev. 23 (2014) 1985–1996, https://doi.org/10.1158/ 1055-9965.EPI-14-0275. [3] A.S. Silantyev, L. Falzone, M. Libra, O.I. Gurina, K.S. Kardashova, T.K. Nikolouzakis, A.E. Nosyrev, C.W. Sutton, P.D. Mitsias, A. Tsatsakis, Current and future trends on diagnosis and prognosis of glioblastoma: from molecular biology to proteomics, Cells 8 (2019) https://doi.org/10.3390/cells8080863. [4] C. Alifieris, D.T. Trafalis, Glioblastoma multiforme: pathogenesis and treatment, Pharmacol Therapeut 152 (2015) 63–82, https://doi.org/10.1016/j.pharmthera. 2015.05.005. [5] E. Pasquier, M. Kavallaris, Microtubules: a dynamic target in cancer therapy, IUBMB Life 60 (2008) 165–170, https://doi.org/10.1002/iub.25. [6] E. Mukhtar, V.M. Adhami, H. Mukhtar, Targeting microtubules by natural agents for cancer therapy, Mol. Cancer Ther. 13 (2014) 275–284, https://doi.org/10.1158/ 1535-7163.Mct-13-0791. [7] G. Chandrasekaran, P. Tatrai, F. Gergely, Hitting the brakes: targeting microtubule motors in cancer, Brit J Cancer 113 (2015) 693–698, https://doi.org/10.1038/bjc. 2015.264. [8] P. Diaz, E. Horne, C. Xu, E. Hamel, M. Wagenbach, R.R. Petrov, B. Uhlenbruck, B. Haas, P. Hothi, L. Wordeman, R. Gussio, N. Stella, Modified carbazoles destabilize microtubules and kill glioblastoma multiform cells, Eur. J. Med. Chem. 159 (2018) 74–89, https://doi.org/10.1016/j.ejmech.2018.09.026. [9] C. Oehler, K. Frei, E.J. Rushing, P.M. McSheehy, D. Weber, P.R. Allegrini, D. Weniger, U.M. Lutolf, A. Knuth, Y. Yonekawa, K. Barath, A. Broggini-Tenzer, M. Pruschy, S. Hofer, Patupilone (epothilone B) for recurrent glioblastoma: clinical outcome and
164
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[19]
[20]
[21]
[22] [23] [24] [25]
[26]
Z. Fan et al. / International Journal of Biological Macromolecules 145 (2020) 154–164 translational analysis of a single-institution phase I/II trial, Oncology 83 (2012) 1–9, https://doi.org/10.1159/000339152. R. Stupp, S. Taillibert, A.A. Kanner, S. Kesari, D.M. Steinberg, S.A. Toms, L.P. Taylor, F. Lieberman, A. Silvani, K.L. Fink, G.H. Barnett, J.J. Zhu, J.W. Henson, H.H. Engelhard, T.C. Chen, D.D. Tran, J. Sroubek, N.D. Tran, A.F. Hottinger, J. Landolfi, R. Desai, M. Caroli, Y. Kew, J. Honnorat, A. Idbaih, E.D. Kirson, U. Weinberg, Y. Palti, M.E. Hegi, Z. Ram, Maintenance therapy with tumor-treating fields plus temozolomide vs temozolomide alone for glioblastoma: a randomized clinical trial, JAMA 314 (2015) 2535–2543, https://doi.org/10.1001/jama.2015.16669. Z.G. Liu, P.F. Xu, T. Wu, W.B. Zeng, Microtubule-targeting anticancer agents from marine natural substance, Anti-Cancer Agent Me 14 (2014) 409–417, https://doi. org/10.2174/187152061403140207163402. J.H. Miller, J.J. Field, A. Kanakkanthara, J.G. Owen, A.J. Singh, P.T. Northcote, Marine invertebrate natural products that target microtubules, J. Nat. Prod. 81 (2018) 691–702, https://doi.org/10.1021/acs.jnatprod.7b00964. M. Liu, X. Zhao, J. Zhao, L. Xiao, H. Liu, C. Wang, L. Cheng, N. Wu, X. Lin, Induction of apoptosis, G(0)/G(1) phase arrest and microtubule disassembly in K562 leukemia cells by Mere15, a novel polypeptide from Meretrix meretrix Linnaeus, Mar Drugs 10 (2012) 2596–2607, https://doi.org/10.3390/md10112596. H. Wang, J. Wei, N. Wu, M. Liu, C. Wang, Y. Zhang, F. Wang, H. Liu, X. Lin, Mere15, a novel polypeptide from Meretrix meretrix, inhibits adhesion, migration and invasion of human lung cancer A549 cells via down-regulating MMPs, Pharm. Biol. 51 (2013) 145–151, https://doi.org/10.3109/13880209.2012.715169. C. Wang, M. Liu, L. Cheng, J. Wei, N. Wu, L. Zheng, X. Lin, A novel polypeptide from Meretrix meretrix Linnaeus inhibits the growth of human lung adenocarcinoma, Exp Biol Med (Maywood) 237 (2012) 442–450, https://doi.org/10.1258/ebm.2012. 011337. J. Wang, C. Tang, C. Yang, Q. Zheng, Y.C. Hou, Tropomyosin-1 functions as a tumor suppressor with respect to cell proliferation, angiogenesis and metastasis in renal cell carcinoma, J. Cancer 10 (2019) 2220–2228, https://doi.org/10.7150/jca.28261. H. Pan, L.Q. Gu, B.J. Liu, Y.P. Li, Y.H. Wang, X.N. Bai, L. Li, B.S. Wang, Q. Peng, Z.G.G. Yao, Z.G. Tang, Tropomyosin-1 acts as a potential tumor suppressor in human oral squamous cell carcinoma, PLoS One 12 (2017) https://doi.org/10.1371/journal. pone.0168900ARTN e0168900. J. Zhao, J. Wei, M. Liu, L. Xiao, N. Wu, G. Liu, H. Huang, Y. Zhang, L. Zheng, X. Lin, Cloning, characterization and expression of a cDNA encoding a granulin-like polypeptide in Ciona savignyi, Biochimie 95 (2013) 1611–1619, https://doi.org/10.1016/j.biochi. 2013.05.001. V. Sarrazy, N. Vedrenne, F. Billet, N. Bordeau, S. Lepreux, A. Vital, M.O. Jauberteau, A. Desmouliere, TLR4 signal transduction pathways neutralize the effect of Fas signals on glioblastoma cell proliferation and migration, Cancer Lett. 311 (2011) 195–202, https://doi.org/10.1016/j.canlet.2011.07.018. Z.H. Chen, H.K. Hu, C.R. Zhang, C.Y. Lu, Y. Bao, Z. Cai, Y.X. Zou, G.H. Hu, L. Jiang, Downregulation of long non-coding RNA FOXD3 antisense RNA 1 (FOXD3-AS1) inhibits cell proliferation, migration, and invasion in malignant glioma cells, Am. J. Transl. Res. 8 (2016) 4106–4119. G. Eisele, M. Weller, Targeting apoptosis pathways in glioblastoma, Cancer Lett. 332 (2013) 335–345, https://doi.org/10.1016/j.canlet.2010.12.012. D. Hanahan, R.A. Weinberg, Hallmarks of cancer: the next generation, Cell 144 (2011) 646–674, https://doi.org/10.1016/j.cell.2011.02.013. J.J. Field, J.F. Diaz, J.H. Miller, The binding sites of microtubule-stabilizing agents, Chem. Biol. 20 (2013) 301–315, https://doi.org/10.1016/j.chembiol.2013.01.014. E. Mukhtar, V.M. Adhami, H. Mukhtar, Targeting microtubules by natural agents for cancer therapy, Mol. Cancer Ther. 13 (2014) 275–284, https://doi.org/10.1158/ 1535-7163.MCT-13-0791. B.H. Liu, H.M. Dong, X. Lin, X.S. Yang, X.J. Yue, J. Yang, Y.T. Li, L.Q. Wu, X.N. Zhu, S.Q. Zhang, D.F. Tian, J.M. Wang, Q. Cai, S.P. Mao, Q.X. Chen, J. Chang, RND3 promotes snail 1 protein degradation and inhibits glioblastoma cell migration and invasion, Oncotarget 7 (2016) 82411–82423, https://doi.org/10.18632/oncotarget.12396.
[27] F. Lefranc, J. Brotchi, R. Kiss, Possible future issues in the treatment of glioblastomas: special emphasis on cell migration and the resistance of migrating glioblastoma cells to apoptosis, J. Clin. Oncol. 23 (2005) 2411–2422, https://doi.org/10.1200/JCO.2005. 03.089. [28] S. Agarwal, P. Muniyandi, T. Maekawa, D.S. Kumar, Vesicular systems employing natural substances as promising drug candidates for MMP inhibition in glioblastoma: a nanotechnological approach, Int. J. Pharm. 551 (2018) 339–361, https:// doi.org/10.1016/j.ijpharm.2018.09.033. [29] P.F. Lu, V.M. Weaver, Z. Werb, The extracellular matrix: a dynamic niche in cancer progression, J. Cell Biol. 196 (2012) 395–406, https://doi.org/10.1083/jcb. 201102147. [30] K. Kessenbrock, V. Plaks, Z. Werb, Matrix metalloproteinases: regulators of the tumor microenvironment, Cell 141 (2010) 52–67, https://doi.org/10.1016/j.cell. 2010.03.015. [31] I. Paw, R.C. Carpenter, K. Watabe, W. Debinski, H.W. Lo, Mechanisms regulating glioma invasion, Cancer Lett. 362 (2015) 1–7, https://doi.org/10.1016/j.canlet.2015.03. 015. [32] K. Li, Y. Tu, Q. Liu, Y. Ouyang, M. He, M. Luo, J. Chen, R. Pi, A. Liu, PT93, a novel caffeic acid amide derivative, suppresses glioblastoma cells migration, proliferation and MMP-2/-9 expression, Oncol. Lett. 13 (2017) 1990–1996, https://doi.org/10.3892/ ol.2017.5663. [33] W. Yan, W. Zhang, L. Sun, Y. Liu, G. You, Y. Wang, C. Kang, Y. You, T. Jiang, Identification of MMP-9 specific microRNA expression profile as potential targets of antiinvasion therapy in glioblastoma multiforme, Brain Res. 1411 (2011) 108–115, https://doi.org/10.1016/j.brainres.2011.07.002. [34] O. Cohen-Inbar, M. Zaaroor, Glioblastoma multiforme targeted therapy: the chlorotoxin story, J. Clin. Neurosci. 33 (2016) 52–58, https://doi.org/10.1016/j. jocn.2016.04.012. [35] Q. Zheng, S. Diao, Q. Wang, C. Zhu, X. Sun, B. Yin, X. Zhang, X. Meng, B. Wang, IL-17A promotes cell migration and invasion of glioblastoma cells via activation of PI3K/ AKT signalling pathway, J. Cell. Mol. Med. 23 (2019) 357–369, https://doi.org/10. 1111/jcmm.13938. [36] X.J. Liu, X. Wu, Y.M. Wang, Y.H. Li, X.L. Chen, W.C. Yang, L.H. Jiang, CD47 promotes human glioblastoma invasion through activation of the PI3K/Akt pathway, Oncol. Res. 27 (2019) 415–422, https://doi.org/10.3727/096504018x15155538502359. [37] M. Natarajan, T.P. Hecker, C.L. Gladson, FAK signaling in anaplastic astrocytoma and glioblastoma tumors, Cancer J. 9 (2003) 126–133. [38] J.-S. Chen, X.-h. Huang, Q. Wang, J.-Q. Huang, L.-j. Zhang, X.-L. Chen, J. Lei, Z.-X. Cheng, Sonic hedgehog signaling pathway induces cell migration and invasion through focal adhesion kinase/AKT signaling-mediated activation of matrix metalloproteinase (MMP)-2 and MMP-9 in liver cancer, Carcinogenesis 34 (2013) 10–19, https://doi.org/10.1093/carcin/bgs274. [39] J.S. Chen, H.S. Li, J.Q. Huang, S.H. Dong, Z.J. Huang, W. Yi, G.F. Zhan, J.T. Feng, J.C. Sun, X.H. Huang, MicroRNA-379-5p inhibits tumor invasion and metastasis by targeting FAK/AKT signaling in hepatocellular carcinoma, Cancer Lett. 375 (2016) 73–83, https://doi.org/10.1016/j.canlet.2016.02.043. [40] K. Angara, T.F. Borin, M.H. Rashid, I. Lebedyeva, R. Ara, P.C. Lin, A. Iskander, R.J. Bollag, B.R. Achyut, A.S. Arbab, CXCR2-expressing tumor cells drive vascular mimicry in antiangiogenic therapy-resistant glioblastoma, Neoplasia 20 (2018) 1070–1082, https://doi.org/10.1016/j.neo.2018.08.011. [41] W. Kang, S.H. Kim, H.J. Cho, J. Jin, J. Lee, K.M. Joo, D.H. Nam, Talin1 targeting potentiates anti-angiogenic therapy by attenuating invasion and stem-like features of glioblastoma multiforme, Oncotarget 6 (2015) 27239–27251, https://doi.org/10. 18632/oncotarget.4835. [42] E.I. Deryugina, J.P. Quigley, Pleiotropic roles of matrix metalloproteinases in tumor angiogenesis: contrasting, overlapping and compensatory functions, Biochim. Biophys. Acta 1803 (2010) 103–120, https://doi.org/10.1016/j.bbamcr.2009.09.017.