- Email: [email protected]
A. tumefaciens-mediated transient expression as a tool for antigen production for cucurbit yellow stunting disorder virus
Journal of Virological Methods 163 (2010) 222–228
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
A. tumefaciens-mediated transient expression as a tool for antigen production for cucurbit yellow stunting disorder virus E. Steel a,∗ , I. Barker b , C. Danks c , D. Coates d , N. Boonham a a
The Food and Environment Research Agency Fera, Sand Hutton, York YO41 1LZ, UK CIP, Av. La Molina 1895, La Molina, Lima, Peru Forsite Diagnostics Limited, Sand Hutton, York YO41 1LZ, UK d School of Life Sciences, University of Bradford, Bradford BD7 1DP, UK b c
a b s t r a c t Article history: Received 30 September 2008 Received in revised form 24 September 2009 Accepted 30 September 2009 Available online 9 October 2009 Keywords: Cucurbit yellow stunting disorder CYSDV Transient expression ELISA TBIA IC-PCR I-EM lateral flow device LFD
The emerging importance of criniviruses, together with their limited characterisation, necessitates the development of simple tools to enable rapid detection and monitoring in case of an outbreak. While serological tools would be ideal, criniviruses are notoriously difficult to purify and traditional methods of antibody production, requiring purified virus particles, are extremely challenging. The development of a novel molecular strategy for in planta viral antigen preparation to bypass particle purification and allow antibody production are described. An A. tumefaciens-mediated transient expression system, coupled with a green fluorescent protein (GFP) purification method was employed to generate CYSDV coat protein (CP) in whole plant leaves. The CYSDV CP gene was ligated into a GFP construct, transformed into A. tumefaciens and agroinfiltrated into N. benthamiana. Expression levels of the recombinant protein were increased by co-infiltration with the viral gene-silencing suppressor P19 from TBSV. The recombinant protein, purified from plant leaves was used to immunise rats for the preparation of polyclonal antisera. Crown Copyright © 2009 Published by Elsevier B.V. All rights reserved.
1. Introduction Cucurbit yellow stunting disorder virus (CYSDV) causes a serious disease of cucurbits, especially cucumbers and melons (Celix et al., 1996; Wisler et al., 1998). The virus was first reported in the United Arab Emirates in 1990 (Hassan and Duffus, 1991) and has since been identified in other Middle Eastern countries and across the Mediterranean basin from Portugal and the Canary islands to Greece and Turkey (Abou-Jawdah et al., 2000; Desbiez et al., 2000; Louro et al., 2000; Ruiz et al., 2006). CYSDV is transmitted by a whitefly vector, Bemisia tabaci, and the disease caused by the virus remains difficult to control and continues to spread within Europe (Janssen and Cuadrado, 2001; Decoin, 2003; Marco and Aranda, 2005). Accurate diagnosis and detection of the virus is an important component of current control strategies, which include implementing quarantine regulations, preventing virus spread and establishment in new areas (Janssen et al., 2003; Wintermantel, 2004). Although nucleic acid based methods are available for the identification of CYSDV (Celix et al., 1996; Berdiales et al., 1999), specific antibodies allow-
∗ Corresponding author. Fax: +44 1904462250. E-mail address: [email protected] (E. Steel).
ing the development of diagnostic methods more suited to routine and ‘in field’ detection such as ELISA, tissue printing and lateral flow devices (LFDs) (Danks and Barker, 2000) remain limited (Cotillon et al., 2005; Hourani and Abou-Jawdah, 2003; Livieratos et al., 1999) Criniviruses however, are notoriously challenging to purify (Karasev, 2000), due in part to being phloem-limited (and hence low titre) and their poor particle stability (Coffin and Coutts, 1993). Their obligate vector transmissibility to plants also results in problems in producing the large numbers of infected plants required for purification. Conventional methods of antibody production typically require purified virus particles with which vertebrate animals are immunised. This strategy requires a sufficient quantity of relatively pure virus, substantially free of host plant contaminants (Vanslogteren and Vanslogteren, 1957; Hull, 2002). To overcome the difficulties associated with virus purification and allow molecular characterisation and antibody development, recombinant virus proteins can be produced in various expression systems including bacteria, yeasts, insect cells, mammalian cell cultures, plants, nematodes and transgenic rodents (Nørh et al., 2003). Recombinant proteins are often expressed in bacterial systems due to their ease of use, readily available vectors and the high yields that can be achieved (Baneyx, 1999). There are, however, a number of potential drawbacks to
0166-0934/$ – see front matter. Crown Copyright © 2009 Published by Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2009.09.024
E. Steel et al. / Journal of Virological Methods 163 (2010) 222–228
prokaryotic expression systems. They lack the post-translational modifications found in eukaryotic cells which can lead to different folding of the protein, creating altered secondary and tertiary structures to the native protein. Over expressed proteins often segregate into insoluble aggregates known as inclusion bodies. Proteins can be released with strong denaturing reagents but then require correct refolding (Baneyx, 1999). This process is especially difficult with large proteins (50 kDa or more) that are more prone to misfolding (Schein, 1989). This is of particular relevance to the development of antibodies, as the physical shape of discontinuous epitopes is vital for antibody recognition of native protein compared to recombinant protein. To counter some of the potential drawbacks of prokaryotic expression systems described, an in planta method of antigen production was developed. The work presented in this paper, describes a novel method of antigen production in which plant virus genes, delivered by agrobacteria are expressed transiently in their natural host, in whole plant leaves (Voinnet et al., 2003). The CYSDV CP was ligated into the A. tumefaciens T-DNA plasmid vector pBIN 35S GFP and expressed in N. benthamiana. In addition, to overcome potential problems with reduced protein expression due to post-transcriptional gene silencing, a second construct consisting of P19, a silencing suppressor from Tomato bushy stunt virus (TBSV) was co-infiltrated (Voinnet et al., 2003). We investigated whether this approach can overcome some of the limitations of prokaryotic expression systems, and whether these proteins would produce diagnostic antibodies which would recognise native viral protein in infected plants.
2. Materials and methods 2.1. Virus maintenance Isolates of CYSDV were maintained in a growth chamber at a controlled temperature of 18 ◦ C with a 12-h photoperiod. Virus was transmitted to healthy cucumber plants by B. tabaci.
2.2. Amplification of CYSDV CP Total plant RNA was extracted from CYSDV-infected leaf material using the KingFisherTM magnetic particle processor system (Thermo Labsystems). The CYSDV coat protein gene was initially amplified using primers CYSDV-CP-F and CYSDV-CP-R. PCR followed cDNA synthesis from total RNA, using the Expand RT-PCR system (Roche), following the manufacturer’s recommended protocol. PCR was performed as follows; 30 cycles of 30 s at 94 ◦ C, 30 s at 55 ◦ C and 1 min at 72 ◦ C; using theTM High Fidelity PCR System (Roche).
223
ˆ P-GFP 2.3. Construction of pBIN 35SC To facilitate cloning of the amplified CYSDV CP into the green fluˆ (Plant Biosciences Ltd., orescent protein (GFP) plasmid pBIN 35SGFP Norwich, UK), a BamH1 recognition sequence (GGATCC) at position 168–173 of the CP, was silenced using site directed mutagenesis; resulting in the replacement of a thymine residue at position 171 with a cytosine residue. The BamH1 site in the CP gene was silenced as this was the only available site for cloning in the CP gene in front of the GFP gene. The PCR was performed on the CYSDV CP PCR product using the primers BamH1-F/CYSDV-CP-R and BamH1-R/CYSDV-CP-F as shown in Table 1 and the following cycling conditions: 94 ◦ C for 5 min followed by 28 cycles of 1 min at 94 ◦ C, 30 s at 60 ◦ C, 1 min at 72 ◦ C and one cycle at 72 ◦ C for 5 min. The fragments of 191 and 573 nts with homologous 8 bp overlap were subjected to further PCR, using CYSDV-CP-F and CYSDV-CP-R and the following cycling condition; 2 min at 48 ◦ C (to allow the two fragments to anneal) followed by 1 cycle of 5 min at 94 ◦ C, 2 min at 48 ◦ C and 2 min at 72 ◦ C, followed by 35 cycles of 1 min at 94 ◦ C, 30 s at 50 ◦ C and 1 min at 72 ◦ C with a final extension step of 5 min at 72 ◦ C. The modified CP sequence was verified by DNA sequencing. In order to clone the CP gene into the BamH1/Xba1 site of pBIN ˆ 35SGFP, restriction sites BamH1 and Xba1 were added to the CP gene by PCR. Following denaturing the template DNA for 5 min at 94 ◦ C, amplification of the modified CP gene was performed using primers Xba1-CP and BamH1-CP (Table 1) using 28 cycles of 1 min at 94 ◦ C, 30 s at 52 ◦ C, 1 min at 72 ◦ C, with a final extension step of 5 min at 72 ◦ C. The amplification product was subcloned into pGEM-T easy® vector (Promega) and digested with BamH1 and Xba1. The 790 bp CYSDV fragment, recovered following gel electrophoresis, was directionally cloned into similarly digested pBIN ˆ 35SGFP plasmid. Sequence analysis confirmed the inserted gene was in-frame with the start codon and showed that there were no sequence re-arrangements or deletions (Fig. 1). 2.4. Expression of CYSDV CP-GFP fusion protein ˆ The pBIN 35SCP-GFP plasmid and an RNA silencing plasmid ˆ pBIN 35Sp19 (Plant Biosciences Ltd., Norwich, UK), were independently, transformed into the A. tumefaciens strain C58C1 (Plant Biosciences Ltd., Norwich, UK), plated onto YEP plates (10 g bactoyeast extract, 10 g bacto-peptone, 5 g NaCl, 15 bacto-agar in 1 l) containing 5 l/ml tetracycline and 50 l/ml kanamycin and incubated for 3 days at 28 ◦ C (Voinnet et al., 2003). A single colony was picked and grown up overnight in YEP broth (10 g bacto-yeast extract, 10 g bacto-peptone, 5 g NaCl in 1 l) supplemented with 5 l/ml tetracycline and 50 l/ml kanamycin. The bacteria were pelleted at 8000 × g, re-suspended in 10 mM MgCl2 solution containing 100 M acetosyringone and the OD600 was checked and
Table 1 Oligonucleotide primers used for PCR amplification of CYSDV CP. Primer sequences are shown in a 5 –3 orientation and the polarity is indicated in parentheses. CYSDV-CP-F and CYSDV-CP-R were designed to amplify the entire CP, based on the nucleotide sequence published by Livieratos et al. (1999). Genebank accession number AJ24300. BamH1-CP and Xba1-CP were used to extend the CP; restriction sites for BamH1 and Xba1 are underlined. BamH1-F and BamH1-R were used to silence the CYSDV CP BamH1 sequence. Application
Primer
Sequence 5 –3
CYSDV CP amplification
CYSDV-CP-F CYSDV-CP-R
ATGGCGAGTTCGAGTGAGAATAA (+) ATTACCACAGCCACCTGGTGCTA (−)
CYSDV CP cloning
Xba1-CP BamH1-CP
GCTCTAGAGCGAACAATGGCGAGTTCGAGTGAGAATAAAACTTCC (+) CGCGGATCCCTCTACCTTCGATATTACCACAGCCACCTGGTGCTA (−)
BamH1 silencing
BamH1-F BamH1-R
TCACATGGACCCAACGAAATTGAAAGACAT (+) CAATTTCGTTGGGTCCATGTGATCTGCGGTG (−)
CYSDV CP amplification for TaqMan®
CYSDV f CYSDV r CYSDV probe
AGAGCAGATGTGATGAGTGATCAAG CCAAAAACTATGGTTGCAAAATCTT TGAAGCAACCTTTGCTAAGTGCAT (fam)
224
E. Steel et al. / Journal of Virological Methods 163 (2010) 222–228
ˆ Fig. 1. Plasmid map of pBIN 35SCP-GFP produced using pDRAW32 analysis software. It shows all single cutting restriction sites.
adjusted to 1. The preparation was incubated at room temperature for 5 h before being infiltrated into 26-day-old N. benthamiana. A tiny abrasion was made on the leaves using a surgical blade and the syringe (without needle) used to force the agrobacteria into the abaxial airspaces. A. tumefaciens containing the CP-GFP construct were co-infiltrated with agrobacteria harbouring the p19 construct into N. benthamiana at a ratio of 50:50 (vol:vol) in a pre mixed bacterial suspension. Plants were transferred to growth cabinets set at 20 ◦ C with 60% humidity and 16 h photoperiod.
ufacturer’s protocols (Amersham Biosciences UK Ltd.). N-terminal sequencing was performed on protein transferred to immobilonFL polyvinylidene fluoride (PVDF) membrane (Sigma). Protein stain (0.005% (w/v) Sulphorhodamine B, 30% (v/v) methanol, 0.2% (v/v) acetic acid) was used to identify the protein to be sequenced. The sections of membrane containing the protein of interest were excised and sequencing performed using a 494 Procise protein sequencer (PE Applied Biosystems) by Leeds University. 2.7. Detecting virus using polyclonal antiserum
2.5. CYSDV CP-GFP fusion protein purification ˆ Leaves that had been co-infiltrated with pBIN 35SCP-GFP and ˆ pBIN 35Sp19 were examined for fluorescence using a UV light (B100A Blak-Ray® 100-watt UV lamp by Ultra-violet Products), leaves that showed significant fluorescence 8 days post-inoculation were harvested. Leaf material was ground to a fine powder in liquid nitrogen using a mortar and pestle and added to grinding buffer (50 mM Tris–HCl pH 7.5, 150 mM NaCl, 0.25% Triton X-100, 20 mM diethyldithiolcarbamic acid and plant protease inhibitor cocktail (Sigma)). The homogenate was stirred for 10 min, strained through cheesecloth and centrifuged at 12,000 × g for 20 min. Ammonium sulphate (50% (w/v)) was added and precipitation left to occur at 4 ◦ C overnight. The precipitate was collected by centrifugation at 12,000 × g for 1 h and re-suspended in Phosphate Buffered Saline (PBS: 20 mM sodium phosphate, 150 mM sodium chloride pH 7.4). The protein preparation was dialysed overnight at 4 ◦ C using SnakeskinTM dialysis tubing with a 10 kDa molecular weight cut off (Pierce Biotechnology Inc., Rockford, IL, USA). The protein was purified further by affinity chromatography using a MACSTM GFP Tag Protein Isolation Kit and sent to Harlan Sera-lab (Belton, Leicestershire, UK) for the immunisation of rats for polyclonal antisera production. 2.6. SDS-PAGE and Western blotting All SDS-PAGE and electrophoretic transfer of proteins to nitrocellulose membrane were carried out using Mini Protean system (Bio-Rad) using the buffer system according to Laemmli (1970) and 10% gels. Protein was boiled for 2 min in running buffer (50 mM Tris–HCl pH 6.8, 100 mM DTT, 2% SDS, 0.1% bromophenol blue and 10% glycerol), prior to addition to the gel. Following transfer, membranes were treated as for TBIA (see below) except antirat antibody conjugated to horseradish peroxidase (Sigma), and a chemi-luminescence detection system were used, following man-
Plate trapped antigen ELISA (PTA-ELISA) was carried out using 96-well microtitre plates. The plates were coated (100 l per well) with plant material ground first at a ratio of 1:10 (tissue:buffer) in PBS with Tween-20 (PBS containing 0.05% Tween-20 and 2% polyvinylpyrrolidone (PVP)) and subsequently diluted 1:10 in coating buffer (0.05 M sodium carbonate, pH 9.6). The plates were incubated for 3 h at 33 ◦ C, then washed three times in PBST. Blocking buffer (5% w/v non-fat dried milk powder, 0.1% Tween 20® in PBS) was then added and the plates incubated for 1 h at 33 ◦ C before being again washed three times in PBST. The polyclonal serum was added to the plates at various dilutions (1:125 to 1:256,000) in PBST containing 0.2% BSA. Normal rat serum (from a non-immunised rat) was used as a negative control. Immuno-capture PCR (IC-PCR) was carried out using 96-well PCR plates coated with 100 l of polyclonal antisera at various dilutions from 1:125 to 1:4000 in coating buffer and incubated for 3 h at 33 ◦ C. The plates were washed three times in PBST and incubated for 2 h at 33 ◦ C with 100 l of CYSDV-infected plant sap diluted 1:10 in PBST. The plates were again washed three times in PBST and 25 l of CYSDV-CP real-time PCR master mix (1× Buffer A, 5.5 mM MgCl2 , 0.2 mM dNTPs, 300 nM of each primer, 100 nM probe (Table 1), 0.625 U of AmpliTaqTM Gold (Applied Biosystems) and 0.25 U of M-MuLV (Promega)) was added to each well. The plates were then cycled on an ABI Prism 7900 Sequence Detection System (PE Biosystems) at generic cycling conditions (Mumford et al., 2000). Tissue blot immunoassay (TBIA) was performed using nitrocellulose membrane (Hybond-P, GE Healthcare) imprinted with transverse sections of the petiole. The membranes were then immersed in blocking buffer (5% w/v non-fat dried milk powder, 0.1% Tween 20® in PBS) for 1 h before being incubated with the serum diluted 1:500 in blocking buffer for 3 h at room temperature. After 3 washes in PBST the membranes were incubated with an anti-rat antibody conjugated with alkaline phosphatase
E. Steel et al. / Journal of Virological Methods 163 (2010) 222–228
(Sigma) at a dilution of 1:4000 for 1 h. The membranes were again washed three times in PBST and the enzyme substrate (Western Blue, Promega) was added for 5 min before the membranes were rinsed in SDW to stop the reaction. Immuno-electron microscopy (I-EM) was used to visualise CYSDV particle decoration by the polyclonal antiserum. Virus infected cucumber leaf (100 g of fresh weight) was ground in liquid nitrogen then added to 500 ml of chilled (4 ◦ C) grinding buffer (0.1 M Tris–HCl pH 7.4, 0.5% (w/v) Na2 SO3 and 0.5% (v/v) 2-mercaptoethanol). The homogenate was stirred for 10 min then strained through cheesecloth. Triton X-100 was added to a final concentration of 2% (v/v) and stirred at 4 ◦ C for 1 h. The preparation was centrifuged at 10,000 × g for 10 min (Sorvall GSA rotor) and the supernatant was layered over 6 ml of 20% (w/v) sucrose in TE and centrifuged for 1 h at 93,000 × g (Beckman 45 Ti rotor). Pellets were re-suspended over night at 4 ◦ C in 1 ml PBS. Carbon coated EM grids were floated on polyclonal antiserum diluted 1 in 10 in PBS pH 6.5 for 10 min. They were then washed with 20 drops of buffer and floated on partially purified virus particles for 10 min. After another wash and incubation on PBS, grids were floated on polyclonal antiserum for 10 min before being, washed with 20 drops of SDW, stained with 5 drops of 2% uranyl acetate and examined using a transmission electron microscope (FEI). 3. Results 3.1. Expression of CYSDV coat protein
225
were co-agroinfiltrated into N. benthamiana. Protein expression was monitored with and without co-infiltration of the silencing suppressor, p19. Fig. 2 shows the fluorescence observed in a plant ˆ ˆ infiltrated with both pBIN 35SCP-GFP and pBIN 35Sp19 and a plant ˆ infiltrated with pBIN 35SCP-GFP alone, when illuminated under UV light. 3.2. Purification of CYSDV CP-GFP fusion protein The recombinant fusion protein was purified and subjected to SDS-PAGE and silver staining, followed by Western blot immunoassay (Fig. 3). SDS-PAGE and Western blot analysis revealed bands at 57 kDa, the expected size of the fusion protein but also revealed bands at ∼30 kDa, the size of GFP; suggesting that the fusion protein was being cleaved in planta. N-terminal sequencing carried out on the ∼30 kDa band identified a seven amino acid sequence located two residues into the GFP sequence: G-E-E-L-F-T-G. Despite cleavage, elution fractions following immunoaffinity chromatography, shown to contain CP-GFP, were concentrated using immunoaffinity chromatography and used for the immunisation of rats for the production of polyclonal antiserum. 3.3. Polyclonal antiserum analysis CYSDV-CP-GFP polyclonal antiserum was tested for its ability to bind to virus in infected plants using a number of techniques such
CYSDV coat protein, the gene selected for expression in whole plant leaves, was successfully ligated upstream of GFP in a GFP ˆ plasmid. Agrobacteria harbouring this plasmid, pBIN 35SCP-GFP ˆ and agrobacteria harbouring the silencing construct, pBIN 35Sp19,
Fig. 2. Photograph of N. benthamiana, illuminated under UV light showing. (A) ˆ ˆ Co-infiltration with pBIN 35SGFP and pBIN 35Sp19 and (B) infiltration with pBIN ˆ 35Sp19 only. In the absence of GFP the tissue appears red due to the fluorescence of chlorophyll.
Fig. 3. (A) SDS-PAGE analysis of purified CP-GFP; the proteins were visualised by silver staining. Lane 1 contains 5 l of SDS-PAGE prestained markers (Bio-Rad) and lane 2 contains 15 l of purified CP-GFP, showing a band at the expected size of the fusion protein, 57 kDa. (B) Western blot immunoassay of purified CP-GFP probed using anti-GFP (sc-8334: Santa-Cruz Biotech, CA, USA). Lane 1 contains 5 l of SDSPAGE prestained markers (Bio-Rad). Lane 2 contains 15 l of purified CP-GFP fusion protein showing a band at the expected size of 57 kDa.
226
E. Steel et al. / Journal of Virological Methods 163 (2010) 222–228
Fig. 4. Graph showing OD405 vs. dilution of the CYSDV polyclonal antiserum following PTA-ELISA. The plates were coated with healthy N. benthamiana (HNb), healthy cucumber (HC), CYSDV-infected cucumber (CC) and the immunogen (CP-GFP).
as plate trapped antigen-ELISA (PTA-ELISA), immune-capture PCR (IC-PCR), tissue blot immunoassay (TBIA) and immuno-electron microscopy (I-EM). Using PTA-ELISA, CYSDV CP-GFP polyclonal antiserum gave high OD405 values when tested with the immunogen and gave OD405 values two-fold higher when tested against CYSDV-infected material than against healthy cucumber (Fig. 4). Real-time RT-PCR following immuno-capture gave significantly lower CT values from wells coated with CYSDV CP-GFP polyclonal antiserum than from wells coated with either the control rat polyclonal antiserum against Barley yellow dwarf virus (BYDV) or from the non-antibody coated wells (Fig. 5). Following tissue blot immunoassay (TBIA), the polyclonal antiserum was observed to specifically label the phloem cells of CYSDV-infected cucumber plants. No labelling of the phloem was observed when either healthy or Cucumber vein yellowing virus (CVYV) infected cucumber plants were assayed (Fig. 6). Following immuno-electron microscopy (IEM), the polyclonal antiserum was observed to decorate the CYSDV virus particles (Fig. 7). The results demonstrate that the A. tumefaciens-mediated transient expression system was able to produce antigens that in turn were able to generate antibodies capable of detecting native virus in infected tissue. The rat antiserum detected CYSDV-infected plant material by PTA-ELISA, immuno-capture real-time PCR, tissue blot immunoassay and immuno-electron microscopy. Our
Fig. 6. Images of tissue prints following TBIA; (A) CYSDV-infected cucumber plant where the lines indicate the labelling of the phloem cells (B) CVYV-infected cucumber plant and (C) healthy cucumber plant.
Fig. 5. A graph showing CT values vs. dilutions of polyclonal antiserum following immuno-capture real-time PCR. PCR microtitre plate wells were either coated with CYSDV CP-GFP polyclonal antiserum or BYDV polyclonal antiserum. The graph plots the mean CT values obtained for each antiserum against their dilution. It also plots the CT values obtained from non-coated wells (no coat). The error bars are the standard errors.
E. Steel et al. / Journal of Virological Methods 163 (2010) 222–228
227
post-transcriptional gene silencing (PTGS) by co-expression of the RNA silencing suppressor p19, from Tomato bushy stunt virus (TBSV) (Voinnet et al., 2003). SDS-PAGE and Western blot analysis following immunoaffinity chromatography of leaf extract harbouring CP-GFP construct identified a ∼57 kDa protein (the size of the fusion protein) and a ∼30 kDa protein (the size of GFP) suggesting protein cleavage. Further analysis of the cleavage products and site directed mutagenesis of the GFP gene could be carried out in attempts to make the CPGFP fusion protein resistant to proteolysis. Regardless of cleavage, GFP immunoaffinity chromatography elution fractions, shown to harbour CP-GFP were used for the immunisation of rats. The rat antiserum was used to successfully detect CYSDVinfected plant material by four different techniques. The first method, PTA-ELISA, gave higher OD405 values for infected material compared to healthy material. The second method was immunocapture real-time PCR, where microtitre plate wells pre-coated with antisera gave lower CT values than non-specific antiserum coated wells or non-coated wells. Thirdly, tissue blot immunoassays were undertaken, leading to the observation of stained virus particles in phloem cells. Finally, immuno-electron microscopy was carried out, leading to the observation of decorated virus particles. This research provides further evidence that the expression of recombinant antigens offers an attractive alternative to conventional virus purification. Furthermore, it is now often the case that virus coat protein sequence information for emerging disease is available before high quality antibodies. Thus, taking a recombinant approach may result in more rapid antigen production than can be achieved using conventional virus purification methods. Acknowledgements Elspeth Steel would like to acknowledge the receipt of a Defra Seedcorn Studentship from the Food and Environment Research Agency, assistance with tissue culture work from the antibody team and additional supervision and mentoring from Celia Knight at the University of Leeds. Fig. 7. Electron microscope images of CYSDV particles observed in a virus enrichment from an infected cucumber leaf at magnification 46,000×; (A) particles decorated with CYSDV antiserum diluted 1:40 in SDW for 30 min at room temperature and (B) un-decorated control particles.
results, taken together, confirmed that the polyclonal antiserum produced against recombinant viral CP contained antibodies specific to CYSDV CP. 4. Discussion The work presented here describes a novel method of recombinant antigen production for the generation of diagnostic antibodies for plant viruses that are difficult to purify. An A. tumefaciensmediated transient expression system was developed as an alternative to bacterial expression systems, to allow recombinant protein expression in a plant host. It was hoped that an in planta expression method, producing viral proteins in their natural host, would lead to the production of recombinant antigens sharing similar properties to their native viral proteins and in turn lead to the development of high quality antibodies, suitable for incorporation into a wide range of serological diagnostic assay formats. The gene selected for in planta expression, CYSDV CP, was ligated immediately upstream of GFP, in an agrobacteria GFP plasmid such that it was expressed as a fusion protein under the control of the GFP promoter. GFP was then employed firstly, to monitor the fusion protein expression levels, through its fluorescence and secondly, to purify the fusion protein using immunoaffinity chromatography. Protein production was protected from the effects of
References Abou-Jawdah, Y., Sobh, H., Fayad, A., Lecoq, H., Delécolle, B., Trad-Ferré, J., 2000. Cucurbit yellow stunting disorder virus—a new threat to cucurbits in Lebanon. Journal of Plant Pathology 82, 55–60. Baneyx, F., 1999. Recombinant protein expression in Escherichia coli. Current Opinion in Biotechnology 10, 411–421. Berdiales, B., Bernal, J.J., Sáez, E., Woudt, B., Beitia, F., Rodríguez-Cerezo, E., 1999. Occurrence of cucurbit yellow stunting disorder virus (CYSDV) and beet pseudoyellows virus in cucurbit crops in Spain and transmission of CYSDV by two biotypes of Bemisia tabaci. European Journal of Plant Pathology 105, 211–215. Celix, A., Lopez-Sese, A., Almarza, N., Gomez-Guillamon, L., Rodriguez Cerezo, E., 1996. Characterization of cucurbit yellow stunting disorder virus, a Bemisia tabaci-transmitted closterovirus. Phytopathology 86, 1370–1376. Coffin, R.S., Coutts, R.H.A., 1993. The closteroviruses, capilloviruses and other similar viruses—a short review. Journal of General Virology 74, 1475–1483. Cotillon, A.C., Desbiez, C., Bouyer, S., Wipf-Scheibel, C., Gros, C., Delécolle, B., Lecoq, H., 2005. Production of a polyclonal antiserum against the coat protein of Cucurbit yellow stunting disorder crinivirus expressed in Escherichia coli. EPPO Bulletin 35, 99–103. Danks, C., Barker, I., 2000. The on-site detection of plant pathogens using lateral flow devices. EPPO Bulletin 30, 421–426. Decoin, M., 2003. Tomates et concombres, gare aux nouveaux virus. Phytoma – la Défense des Végétaux 558, 27–29. Desbiez, C., Lecoq, H., Aboulama, S., Peterschmitt, M., 2000. First report of Cucurbit yellow stunting disorder virus in Morocco. Plant Disease 84, 596. Hassan, A.A., Duffus, J.E., 1991. A review of a yellowing stunting disorder of cucurbits in the United Arab Emirates. Emirates Journal of Agricultural Science 2, 1–16. Hourani, H., Abou-Jawdah, Y., 2003. Immunodiagnosis of Cucurbit yellow stunting disorder virus using polyclonal antibodies developed against recombinant coat protein. Journal of Plant Pathology 85, 197–204. Hull, R., 2002. Matthews’ Plant Virology, 4th edition. San Diego Academic Press Inc., New York, NY, USA. Janssen, D., Ruiz, L., Cano, M., Belmonte, A., Martín, G., Segundo, E., Cuadrado, I.M., 2003. Physical and genetic control of Bemisia tabaci-transmitted Cucurbit yellow stunting disorder virus and Cucumber vein yellowing virus in cucumber.
228
E. Steel et al. / Journal of Virological Methods 163 (2010) 222–228
IOBC/wprs Bulletin—integrated control in protected crops. Mediterranean Climate 26, 101–106. Janssen, D., Cuadrado, I.M., 2001. Whitefly problems escalate within Spanish cucurbit crops. EWSN Newsletter 11, 1–2. Karasev, A.V., 2000. Genetic diversity and evolution of closteroviruses. Annual Review of Phytopathology 38, 293–324. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 (259), 680–685. Livieratos, I.C., Avgelis, A.D., Coutts, R.H.A., 1999. Molecular characterization of the cucurbit yellow stunting disorder virus coat protein gene. Phytopathology 89, 1050–1055. Louro, D., Vicente, M., Vaira, A.M., Accotto, G.P., Nolasco, G., 2000. Cucurbit yellow stunting disorder virus (genus Crinivirus) associated with the yellowing disease of cucurbit crops in Portugal. Plant Disease 84, 1156. Marco, C.F., Aranda, M.A., 2005. Genetic diversity of a natural population of Cucurbit yellow stunting disorder virus. Journal of General Virology 86, 815–822. Nørh, J., Kristiansen, K., Krogsdam, A.M., 2003. Expression of recombinant proteins: an introduction. Springer Protocols 232, 93–101.
Ruiz, L., Janssen, D., Martin, G., Velasco, L., Segundo, E., Cuadrado, I.M., 2006. Analysis of the temporal and spatial disease progress of Bemisia tabaci-transmitted Cucurbit yellow stunting disorder virus and Cucumber vein yellowing virus in cucumber. Plant Pathology 55, 264–275. Schein, C.H., 1989. Production of soluble recombinant proteins in bacteria. BioTechnology 7, 1141–1147. Vanslogteren, E., Vanslogteren, D.H.M., 1957. Serological identification of plant viruses and serological diagnosis of virus diseases of plants. Annual Review of Microbiology 11, 149–164. Voinnet, O., Rivas, S., Mestre, P., Baulcombe, D., 2003. An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant Journal 33, 949–956. Wintermantel, W.M., 2004. Emergence of Greenhouse Whitefly (Trialeurodes vaporariorum) Transmitted Criniviruses as Threats to Vegetable and Fruit Production in North America. In: M. Elliott, L. (Ed.), APSnet Feature. ASPnet. Wisler, G.C., Duffus, J.E., Liu, H.Y., Li, R.H., 1998. Ecology and epidemiology of whitefly-transmitted closteroviruses. Plant Disease 82, 270–280.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
A. tumefaciens-mediated transient expression as a tool for antigen production for cucurbit yellow stunting disorder virus E. Steel a,∗ , I. Barker b , C. Danks c , D. Coates d , N. Boonham a a
The Food and Environment Research Agency Fera, Sand Hutton, York YO41 1LZ, UK CIP, Av. La Molina 1895, La Molina, Lima, Peru Forsite Diagnostics Limited, Sand Hutton, York YO41 1LZ, UK d School of Life Sciences, University of Bradford, Bradford BD7 1DP, UK b c
a b s t r a c t Article history: Received 30 September 2008 Received in revised form 24 September 2009 Accepted 30 September 2009 Available online 9 October 2009 Keywords: Cucurbit yellow stunting disorder CYSDV Transient expression ELISA TBIA IC-PCR I-EM lateral flow device LFD
The emerging importance of criniviruses, together with their limited characterisation, necessitates the development of simple tools to enable rapid detection and monitoring in case of an outbreak. While serological tools would be ideal, criniviruses are notoriously difficult to purify and traditional methods of antibody production, requiring purified virus particles, are extremely challenging. The development of a novel molecular strategy for in planta viral antigen preparation to bypass particle purification and allow antibody production are described. An A. tumefaciens-mediated transient expression system, coupled with a green fluorescent protein (GFP) purification method was employed to generate CYSDV coat protein (CP) in whole plant leaves. The CYSDV CP gene was ligated into a GFP construct, transformed into A. tumefaciens and agroinfiltrated into N. benthamiana. Expression levels of the recombinant protein were increased by co-infiltration with the viral gene-silencing suppressor P19 from TBSV. The recombinant protein, purified from plant leaves was used to immunise rats for the preparation of polyclonal antisera. Crown Copyright © 2009 Published by Elsevier B.V. All rights reserved.
1. Introduction Cucurbit yellow stunting disorder virus (CYSDV) causes a serious disease of cucurbits, especially cucumbers and melons (Celix et al., 1996; Wisler et al., 1998). The virus was first reported in the United Arab Emirates in 1990 (Hassan and Duffus, 1991) and has since been identified in other Middle Eastern countries and across the Mediterranean basin from Portugal and the Canary islands to Greece and Turkey (Abou-Jawdah et al., 2000; Desbiez et al., 2000; Louro et al., 2000; Ruiz et al., 2006). CYSDV is transmitted by a whitefly vector, Bemisia tabaci, and the disease caused by the virus remains difficult to control and continues to spread within Europe (Janssen and Cuadrado, 2001; Decoin, 2003; Marco and Aranda, 2005). Accurate diagnosis and detection of the virus is an important component of current control strategies, which include implementing quarantine regulations, preventing virus spread and establishment in new areas (Janssen et al., 2003; Wintermantel, 2004). Although nucleic acid based methods are available for the identification of CYSDV (Celix et al., 1996; Berdiales et al., 1999), specific antibodies allow-
∗ Corresponding author. Fax: +44 1904462250. E-mail address: [email protected] (E. Steel).
ing the development of diagnostic methods more suited to routine and ‘in field’ detection such as ELISA, tissue printing and lateral flow devices (LFDs) (Danks and Barker, 2000) remain limited (Cotillon et al., 2005; Hourani and Abou-Jawdah, 2003; Livieratos et al., 1999) Criniviruses however, are notoriously challenging to purify (Karasev, 2000), due in part to being phloem-limited (and hence low titre) and their poor particle stability (Coffin and Coutts, 1993). Their obligate vector transmissibility to plants also results in problems in producing the large numbers of infected plants required for purification. Conventional methods of antibody production typically require purified virus particles with which vertebrate animals are immunised. This strategy requires a sufficient quantity of relatively pure virus, substantially free of host plant contaminants (Vanslogteren and Vanslogteren, 1957; Hull, 2002). To overcome the difficulties associated with virus purification and allow molecular characterisation and antibody development, recombinant virus proteins can be produced in various expression systems including bacteria, yeasts, insect cells, mammalian cell cultures, plants, nematodes and transgenic rodents (Nørh et al., 2003). Recombinant proteins are often expressed in bacterial systems due to their ease of use, readily available vectors and the high yields that can be achieved (Baneyx, 1999). There are, however, a number of potential drawbacks to
0166-0934/$ – see front matter. Crown Copyright © 2009 Published by Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2009.09.024
E. Steel et al. / Journal of Virological Methods 163 (2010) 222–228
prokaryotic expression systems. They lack the post-translational modifications found in eukaryotic cells which can lead to different folding of the protein, creating altered secondary and tertiary structures to the native protein. Over expressed proteins often segregate into insoluble aggregates known as inclusion bodies. Proteins can be released with strong denaturing reagents but then require correct refolding (Baneyx, 1999). This process is especially difficult with large proteins (50 kDa or more) that are more prone to misfolding (Schein, 1989). This is of particular relevance to the development of antibodies, as the physical shape of discontinuous epitopes is vital for antibody recognition of native protein compared to recombinant protein. To counter some of the potential drawbacks of prokaryotic expression systems described, an in planta method of antigen production was developed. The work presented in this paper, describes a novel method of antigen production in which plant virus genes, delivered by agrobacteria are expressed transiently in their natural host, in whole plant leaves (Voinnet et al., 2003). The CYSDV CP was ligated into the A. tumefaciens T-DNA plasmid vector pBIN 35S GFP and expressed in N. benthamiana. In addition, to overcome potential problems with reduced protein expression due to post-transcriptional gene silencing, a second construct consisting of P19, a silencing suppressor from Tomato bushy stunt virus (TBSV) was co-infiltrated (Voinnet et al., 2003). We investigated whether this approach can overcome some of the limitations of prokaryotic expression systems, and whether these proteins would produce diagnostic antibodies which would recognise native viral protein in infected plants.
2. Materials and methods 2.1. Virus maintenance Isolates of CYSDV were maintained in a growth chamber at a controlled temperature of 18 ◦ C with a 12-h photoperiod. Virus was transmitted to healthy cucumber plants by B. tabaci.
2.2. Amplification of CYSDV CP Total plant RNA was extracted from CYSDV-infected leaf material using the KingFisherTM magnetic particle processor system (Thermo Labsystems). The CYSDV coat protein gene was initially amplified using primers CYSDV-CP-F and CYSDV-CP-R. PCR followed cDNA synthesis from total RNA, using the Expand RT-PCR system (Roche), following the manufacturer’s recommended protocol. PCR was performed as follows; 30 cycles of 30 s at 94 ◦ C, 30 s at 55 ◦ C and 1 min at 72 ◦ C; using theTM High Fidelity PCR System (Roche).
223
ˆ P-GFP 2.3. Construction of pBIN 35SC To facilitate cloning of the amplified CYSDV CP into the green fluˆ (Plant Biosciences Ltd., orescent protein (GFP) plasmid pBIN 35SGFP Norwich, UK), a BamH1 recognition sequence (GGATCC) at position 168–173 of the CP, was silenced using site directed mutagenesis; resulting in the replacement of a thymine residue at position 171 with a cytosine residue. The BamH1 site in the CP gene was silenced as this was the only available site for cloning in the CP gene in front of the GFP gene. The PCR was performed on the CYSDV CP PCR product using the primers BamH1-F/CYSDV-CP-R and BamH1-R/CYSDV-CP-F as shown in Table 1 and the following cycling conditions: 94 ◦ C for 5 min followed by 28 cycles of 1 min at 94 ◦ C, 30 s at 60 ◦ C, 1 min at 72 ◦ C and one cycle at 72 ◦ C for 5 min. The fragments of 191 and 573 nts with homologous 8 bp overlap were subjected to further PCR, using CYSDV-CP-F and CYSDV-CP-R and the following cycling condition; 2 min at 48 ◦ C (to allow the two fragments to anneal) followed by 1 cycle of 5 min at 94 ◦ C, 2 min at 48 ◦ C and 2 min at 72 ◦ C, followed by 35 cycles of 1 min at 94 ◦ C, 30 s at 50 ◦ C and 1 min at 72 ◦ C with a final extension step of 5 min at 72 ◦ C. The modified CP sequence was verified by DNA sequencing. In order to clone the CP gene into the BamH1/Xba1 site of pBIN ˆ 35SGFP, restriction sites BamH1 and Xba1 were added to the CP gene by PCR. Following denaturing the template DNA for 5 min at 94 ◦ C, amplification of the modified CP gene was performed using primers Xba1-CP and BamH1-CP (Table 1) using 28 cycles of 1 min at 94 ◦ C, 30 s at 52 ◦ C, 1 min at 72 ◦ C, with a final extension step of 5 min at 72 ◦ C. The amplification product was subcloned into pGEM-T easy® vector (Promega) and digested with BamH1 and Xba1. The 790 bp CYSDV fragment, recovered following gel electrophoresis, was directionally cloned into similarly digested pBIN ˆ 35SGFP plasmid. Sequence analysis confirmed the inserted gene was in-frame with the start codon and showed that there were no sequence re-arrangements or deletions (Fig. 1). 2.4. Expression of CYSDV CP-GFP fusion protein ˆ The pBIN 35SCP-GFP plasmid and an RNA silencing plasmid ˆ pBIN 35Sp19 (Plant Biosciences Ltd., Norwich, UK), were independently, transformed into the A. tumefaciens strain C58C1 (Plant Biosciences Ltd., Norwich, UK), plated onto YEP plates (10 g bactoyeast extract, 10 g bacto-peptone, 5 g NaCl, 15 bacto-agar in 1 l) containing 5 l/ml tetracycline and 50 l/ml kanamycin and incubated for 3 days at 28 ◦ C (Voinnet et al., 2003). A single colony was picked and grown up overnight in YEP broth (10 g bacto-yeast extract, 10 g bacto-peptone, 5 g NaCl in 1 l) supplemented with 5 l/ml tetracycline and 50 l/ml kanamycin. The bacteria were pelleted at 8000 × g, re-suspended in 10 mM MgCl2 solution containing 100 M acetosyringone and the OD600 was checked and
Table 1 Oligonucleotide primers used for PCR amplification of CYSDV CP. Primer sequences are shown in a 5 –3 orientation and the polarity is indicated in parentheses. CYSDV-CP-F and CYSDV-CP-R were designed to amplify the entire CP, based on the nucleotide sequence published by Livieratos et al. (1999). Genebank accession number AJ24300. BamH1-CP and Xba1-CP were used to extend the CP; restriction sites for BamH1 and Xba1 are underlined. BamH1-F and BamH1-R were used to silence the CYSDV CP BamH1 sequence. Application
Primer
Sequence 5 –3
CYSDV CP amplification
CYSDV-CP-F CYSDV-CP-R
ATGGCGAGTTCGAGTGAGAATAA (+) ATTACCACAGCCACCTGGTGCTA (−)
CYSDV CP cloning
Xba1-CP BamH1-CP
GCTCTAGAGCGAACAATGGCGAGTTCGAGTGAGAATAAAACTTCC (+) CGCGGATCCCTCTACCTTCGATATTACCACAGCCACCTGGTGCTA (−)
BamH1 silencing
BamH1-F BamH1-R
TCACATGGACCCAACGAAATTGAAAGACAT (+) CAATTTCGTTGGGTCCATGTGATCTGCGGTG (−)
CYSDV CP amplification for TaqMan®
CYSDV f CYSDV r CYSDV probe
AGAGCAGATGTGATGAGTGATCAAG CCAAAAACTATGGTTGCAAAATCTT TGAAGCAACCTTTGCTAAGTGCAT (fam)
224
E. Steel et al. / Journal of Virological Methods 163 (2010) 222–228
ˆ Fig. 1. Plasmid map of pBIN 35SCP-GFP produced using pDRAW32 analysis software. It shows all single cutting restriction sites.
adjusted to 1. The preparation was incubated at room temperature for 5 h before being infiltrated into 26-day-old N. benthamiana. A tiny abrasion was made on the leaves using a surgical blade and the syringe (without needle) used to force the agrobacteria into the abaxial airspaces. A. tumefaciens containing the CP-GFP construct were co-infiltrated with agrobacteria harbouring the p19 construct into N. benthamiana at a ratio of 50:50 (vol:vol) in a pre mixed bacterial suspension. Plants were transferred to growth cabinets set at 20 ◦ C with 60% humidity and 16 h photoperiod.
ufacturer’s protocols (Amersham Biosciences UK Ltd.). N-terminal sequencing was performed on protein transferred to immobilonFL polyvinylidene fluoride (PVDF) membrane (Sigma). Protein stain (0.005% (w/v) Sulphorhodamine B, 30% (v/v) methanol, 0.2% (v/v) acetic acid) was used to identify the protein to be sequenced. The sections of membrane containing the protein of interest were excised and sequencing performed using a 494 Procise protein sequencer (PE Applied Biosystems) by Leeds University. 2.7. Detecting virus using polyclonal antiserum
2.5. CYSDV CP-GFP fusion protein purification ˆ Leaves that had been co-infiltrated with pBIN 35SCP-GFP and ˆ pBIN 35Sp19 were examined for fluorescence using a UV light (B100A Blak-Ray® 100-watt UV lamp by Ultra-violet Products), leaves that showed significant fluorescence 8 days post-inoculation were harvested. Leaf material was ground to a fine powder in liquid nitrogen using a mortar and pestle and added to grinding buffer (50 mM Tris–HCl pH 7.5, 150 mM NaCl, 0.25% Triton X-100, 20 mM diethyldithiolcarbamic acid and plant protease inhibitor cocktail (Sigma)). The homogenate was stirred for 10 min, strained through cheesecloth and centrifuged at 12,000 × g for 20 min. Ammonium sulphate (50% (w/v)) was added and precipitation left to occur at 4 ◦ C overnight. The precipitate was collected by centrifugation at 12,000 × g for 1 h and re-suspended in Phosphate Buffered Saline (PBS: 20 mM sodium phosphate, 150 mM sodium chloride pH 7.4). The protein preparation was dialysed overnight at 4 ◦ C using SnakeskinTM dialysis tubing with a 10 kDa molecular weight cut off (Pierce Biotechnology Inc., Rockford, IL, USA). The protein was purified further by affinity chromatography using a MACSTM GFP Tag Protein Isolation Kit and sent to Harlan Sera-lab (Belton, Leicestershire, UK) for the immunisation of rats for polyclonal antisera production. 2.6. SDS-PAGE and Western blotting All SDS-PAGE and electrophoretic transfer of proteins to nitrocellulose membrane were carried out using Mini Protean system (Bio-Rad) using the buffer system according to Laemmli (1970) and 10% gels. Protein was boiled for 2 min in running buffer (50 mM Tris–HCl pH 6.8, 100 mM DTT, 2% SDS, 0.1% bromophenol blue and 10% glycerol), prior to addition to the gel. Following transfer, membranes were treated as for TBIA (see below) except antirat antibody conjugated to horseradish peroxidase (Sigma), and a chemi-luminescence detection system were used, following man-
Plate trapped antigen ELISA (PTA-ELISA) was carried out using 96-well microtitre plates. The plates were coated (100 l per well) with plant material ground first at a ratio of 1:10 (tissue:buffer) in PBS with Tween-20 (PBS containing 0.05% Tween-20 and 2% polyvinylpyrrolidone (PVP)) and subsequently diluted 1:10 in coating buffer (0.05 M sodium carbonate, pH 9.6). The plates were incubated for 3 h at 33 ◦ C, then washed three times in PBST. Blocking buffer (5% w/v non-fat dried milk powder, 0.1% Tween 20® in PBS) was then added and the plates incubated for 1 h at 33 ◦ C before being again washed three times in PBST. The polyclonal serum was added to the plates at various dilutions (1:125 to 1:256,000) in PBST containing 0.2% BSA. Normal rat serum (from a non-immunised rat) was used as a negative control. Immuno-capture PCR (IC-PCR) was carried out using 96-well PCR plates coated with 100 l of polyclonal antisera at various dilutions from 1:125 to 1:4000 in coating buffer and incubated for 3 h at 33 ◦ C. The plates were washed three times in PBST and incubated for 2 h at 33 ◦ C with 100 l of CYSDV-infected plant sap diluted 1:10 in PBST. The plates were again washed three times in PBST and 25 l of CYSDV-CP real-time PCR master mix (1× Buffer A, 5.5 mM MgCl2 , 0.2 mM dNTPs, 300 nM of each primer, 100 nM probe (Table 1), 0.625 U of AmpliTaqTM Gold (Applied Biosystems) and 0.25 U of M-MuLV (Promega)) was added to each well. The plates were then cycled on an ABI Prism 7900 Sequence Detection System (PE Biosystems) at generic cycling conditions (Mumford et al., 2000). Tissue blot immunoassay (TBIA) was performed using nitrocellulose membrane (Hybond-P, GE Healthcare) imprinted with transverse sections of the petiole. The membranes were then immersed in blocking buffer (5% w/v non-fat dried milk powder, 0.1% Tween 20® in PBS) for 1 h before being incubated with the serum diluted 1:500 in blocking buffer for 3 h at room temperature. After 3 washes in PBST the membranes were incubated with an anti-rat antibody conjugated with alkaline phosphatase
E. Steel et al. / Journal of Virological Methods 163 (2010) 222–228
(Sigma) at a dilution of 1:4000 for 1 h. The membranes were again washed three times in PBST and the enzyme substrate (Western Blue, Promega) was added for 5 min before the membranes were rinsed in SDW to stop the reaction. Immuno-electron microscopy (I-EM) was used to visualise CYSDV particle decoration by the polyclonal antiserum. Virus infected cucumber leaf (100 g of fresh weight) was ground in liquid nitrogen then added to 500 ml of chilled (4 ◦ C) grinding buffer (0.1 M Tris–HCl pH 7.4, 0.5% (w/v) Na2 SO3 and 0.5% (v/v) 2-mercaptoethanol). The homogenate was stirred for 10 min then strained through cheesecloth. Triton X-100 was added to a final concentration of 2% (v/v) and stirred at 4 ◦ C for 1 h. The preparation was centrifuged at 10,000 × g for 10 min (Sorvall GSA rotor) and the supernatant was layered over 6 ml of 20% (w/v) sucrose in TE and centrifuged for 1 h at 93,000 × g (Beckman 45 Ti rotor). Pellets were re-suspended over night at 4 ◦ C in 1 ml PBS. Carbon coated EM grids were floated on polyclonal antiserum diluted 1 in 10 in PBS pH 6.5 for 10 min. They were then washed with 20 drops of buffer and floated on partially purified virus particles for 10 min. After another wash and incubation on PBS, grids were floated on polyclonal antiserum for 10 min before being, washed with 20 drops of SDW, stained with 5 drops of 2% uranyl acetate and examined using a transmission electron microscope (FEI). 3. Results 3.1. Expression of CYSDV coat protein
225
were co-agroinfiltrated into N. benthamiana. Protein expression was monitored with and without co-infiltration of the silencing suppressor, p19. Fig. 2 shows the fluorescence observed in a plant ˆ ˆ infiltrated with both pBIN 35SCP-GFP and pBIN 35Sp19 and a plant ˆ infiltrated with pBIN 35SCP-GFP alone, when illuminated under UV light. 3.2. Purification of CYSDV CP-GFP fusion protein The recombinant fusion protein was purified and subjected to SDS-PAGE and silver staining, followed by Western blot immunoassay (Fig. 3). SDS-PAGE and Western blot analysis revealed bands at 57 kDa, the expected size of the fusion protein but also revealed bands at ∼30 kDa, the size of GFP; suggesting that the fusion protein was being cleaved in planta. N-terminal sequencing carried out on the ∼30 kDa band identified a seven amino acid sequence located two residues into the GFP sequence: G-E-E-L-F-T-G. Despite cleavage, elution fractions following immunoaffinity chromatography, shown to contain CP-GFP, were concentrated using immunoaffinity chromatography and used for the immunisation of rats for the production of polyclonal antiserum. 3.3. Polyclonal antiserum analysis CYSDV-CP-GFP polyclonal antiserum was tested for its ability to bind to virus in infected plants using a number of techniques such
CYSDV coat protein, the gene selected for expression in whole plant leaves, was successfully ligated upstream of GFP in a GFP ˆ plasmid. Agrobacteria harbouring this plasmid, pBIN 35SCP-GFP ˆ and agrobacteria harbouring the silencing construct, pBIN 35Sp19,
Fig. 2. Photograph of N. benthamiana, illuminated under UV light showing. (A) ˆ ˆ Co-infiltration with pBIN 35SGFP and pBIN 35Sp19 and (B) infiltration with pBIN ˆ 35Sp19 only. In the absence of GFP the tissue appears red due to the fluorescence of chlorophyll.
Fig. 3. (A) SDS-PAGE analysis of purified CP-GFP; the proteins were visualised by silver staining. Lane 1 contains 5 l of SDS-PAGE prestained markers (Bio-Rad) and lane 2 contains 15 l of purified CP-GFP, showing a band at the expected size of the fusion protein, 57 kDa. (B) Western blot immunoassay of purified CP-GFP probed using anti-GFP (sc-8334: Santa-Cruz Biotech, CA, USA). Lane 1 contains 5 l of SDSPAGE prestained markers (Bio-Rad). Lane 2 contains 15 l of purified CP-GFP fusion protein showing a band at the expected size of 57 kDa.
226
E. Steel et al. / Journal of Virological Methods 163 (2010) 222–228
Fig. 4. Graph showing OD405 vs. dilution of the CYSDV polyclonal antiserum following PTA-ELISA. The plates were coated with healthy N. benthamiana (HNb), healthy cucumber (HC), CYSDV-infected cucumber (CC) and the immunogen (CP-GFP).
as plate trapped antigen-ELISA (PTA-ELISA), immune-capture PCR (IC-PCR), tissue blot immunoassay (TBIA) and immuno-electron microscopy (I-EM). Using PTA-ELISA, CYSDV CP-GFP polyclonal antiserum gave high OD405 values when tested with the immunogen and gave OD405 values two-fold higher when tested against CYSDV-infected material than against healthy cucumber (Fig. 4). Real-time RT-PCR following immuno-capture gave significantly lower CT values from wells coated with CYSDV CP-GFP polyclonal antiserum than from wells coated with either the control rat polyclonal antiserum against Barley yellow dwarf virus (BYDV) or from the non-antibody coated wells (Fig. 5). Following tissue blot immunoassay (TBIA), the polyclonal antiserum was observed to specifically label the phloem cells of CYSDV-infected cucumber plants. No labelling of the phloem was observed when either healthy or Cucumber vein yellowing virus (CVYV) infected cucumber plants were assayed (Fig. 6). Following immuno-electron microscopy (IEM), the polyclonal antiserum was observed to decorate the CYSDV virus particles (Fig. 7). The results demonstrate that the A. tumefaciens-mediated transient expression system was able to produce antigens that in turn were able to generate antibodies capable of detecting native virus in infected tissue. The rat antiserum detected CYSDV-infected plant material by PTA-ELISA, immuno-capture real-time PCR, tissue blot immunoassay and immuno-electron microscopy. Our
Fig. 6. Images of tissue prints following TBIA; (A) CYSDV-infected cucumber plant where the lines indicate the labelling of the phloem cells (B) CVYV-infected cucumber plant and (C) healthy cucumber plant.
Fig. 5. A graph showing CT values vs. dilutions of polyclonal antiserum following immuno-capture real-time PCR. PCR microtitre plate wells were either coated with CYSDV CP-GFP polyclonal antiserum or BYDV polyclonal antiserum. The graph plots the mean CT values obtained for each antiserum against their dilution. It also plots the CT values obtained from non-coated wells (no coat). The error bars are the standard errors.
E. Steel et al. / Journal of Virological Methods 163 (2010) 222–228
227
post-transcriptional gene silencing (PTGS) by co-expression of the RNA silencing suppressor p19, from Tomato bushy stunt virus (TBSV) (Voinnet et al., 2003). SDS-PAGE and Western blot analysis following immunoaffinity chromatography of leaf extract harbouring CP-GFP construct identified a ∼57 kDa protein (the size of the fusion protein) and a ∼30 kDa protein (the size of GFP) suggesting protein cleavage. Further analysis of the cleavage products and site directed mutagenesis of the GFP gene could be carried out in attempts to make the CPGFP fusion protein resistant to proteolysis. Regardless of cleavage, GFP immunoaffinity chromatography elution fractions, shown to harbour CP-GFP were used for the immunisation of rats. The rat antiserum was used to successfully detect CYSDVinfected plant material by four different techniques. The first method, PTA-ELISA, gave higher OD405 values for infected material compared to healthy material. The second method was immunocapture real-time PCR, where microtitre plate wells pre-coated with antisera gave lower CT values than non-specific antiserum coated wells or non-coated wells. Thirdly, tissue blot immunoassays were undertaken, leading to the observation of stained virus particles in phloem cells. Finally, immuno-electron microscopy was carried out, leading to the observation of decorated virus particles. This research provides further evidence that the expression of recombinant antigens offers an attractive alternative to conventional virus purification. Furthermore, it is now often the case that virus coat protein sequence information for emerging disease is available before high quality antibodies. Thus, taking a recombinant approach may result in more rapid antigen production than can be achieved using conventional virus purification methods. Acknowledgements Elspeth Steel would like to acknowledge the receipt of a Defra Seedcorn Studentship from the Food and Environment Research Agency, assistance with tissue culture work from the antibody team and additional supervision and mentoring from Celia Knight at the University of Leeds. Fig. 7. Electron microscope images of CYSDV particles observed in a virus enrichment from an infected cucumber leaf at magnification 46,000×; (A) particles decorated with CYSDV antiserum diluted 1:40 in SDW for 30 min at room temperature and (B) un-decorated control particles.
results, taken together, confirmed that the polyclonal antiserum produced against recombinant viral CP contained antibodies specific to CYSDV CP. 4. Discussion The work presented here describes a novel method of recombinant antigen production for the generation of diagnostic antibodies for plant viruses that are difficult to purify. An A. tumefaciensmediated transient expression system was developed as an alternative to bacterial expression systems, to allow recombinant protein expression in a plant host. It was hoped that an in planta expression method, producing viral proteins in their natural host, would lead to the production of recombinant antigens sharing similar properties to their native viral proteins and in turn lead to the development of high quality antibodies, suitable for incorporation into a wide range of serological diagnostic assay formats. The gene selected for in planta expression, CYSDV CP, was ligated immediately upstream of GFP, in an agrobacteria GFP plasmid such that it was expressed as a fusion protein under the control of the GFP promoter. GFP was then employed firstly, to monitor the fusion protein expression levels, through its fluorescence and secondly, to purify the fusion protein using immunoaffinity chromatography. Protein production was protected from the effects of
References Abou-Jawdah, Y., Sobh, H., Fayad, A., Lecoq, H., Delécolle, B., Trad-Ferré, J., 2000. Cucurbit yellow stunting disorder virus—a new threat to cucurbits in Lebanon. Journal of Plant Pathology 82, 55–60. Baneyx, F., 1999. Recombinant protein expression in Escherichia coli. Current Opinion in Biotechnology 10, 411–421. Berdiales, B., Bernal, J.J., Sáez, E., Woudt, B., Beitia, F., Rodríguez-Cerezo, E., 1999. Occurrence of cucurbit yellow stunting disorder virus (CYSDV) and beet pseudoyellows virus in cucurbit crops in Spain and transmission of CYSDV by two biotypes of Bemisia tabaci. European Journal of Plant Pathology 105, 211–215. Celix, A., Lopez-Sese, A., Almarza, N., Gomez-Guillamon, L., Rodriguez Cerezo, E., 1996. Characterization of cucurbit yellow stunting disorder virus, a Bemisia tabaci-transmitted closterovirus. Phytopathology 86, 1370–1376. Coffin, R.S., Coutts, R.H.A., 1993. The closteroviruses, capilloviruses and other similar viruses—a short review. Journal of General Virology 74, 1475–1483. Cotillon, A.C., Desbiez, C., Bouyer, S., Wipf-Scheibel, C., Gros, C., Delécolle, B., Lecoq, H., 2005. Production of a polyclonal antiserum against the coat protein of Cucurbit yellow stunting disorder crinivirus expressed in Escherichia coli. EPPO Bulletin 35, 99–103. Danks, C., Barker, I., 2000. The on-site detection of plant pathogens using lateral flow devices. EPPO Bulletin 30, 421–426. Decoin, M., 2003. Tomates et concombres, gare aux nouveaux virus. Phytoma – la Défense des Végétaux 558, 27–29. Desbiez, C., Lecoq, H., Aboulama, S., Peterschmitt, M., 2000. First report of Cucurbit yellow stunting disorder virus in Morocco. Plant Disease 84, 596. Hassan, A.A., Duffus, J.E., 1991. A review of a yellowing stunting disorder of cucurbits in the United Arab Emirates. Emirates Journal of Agricultural Science 2, 1–16. Hourani, H., Abou-Jawdah, Y., 2003. Immunodiagnosis of Cucurbit yellow stunting disorder virus using polyclonal antibodies developed against recombinant coat protein. Journal of Plant Pathology 85, 197–204. Hull, R., 2002. Matthews’ Plant Virology, 4th edition. San Diego Academic Press Inc., New York, NY, USA. Janssen, D., Ruiz, L., Cano, M., Belmonte, A., Martín, G., Segundo, E., Cuadrado, I.M., 2003. Physical and genetic control of Bemisia tabaci-transmitted Cucurbit yellow stunting disorder virus and Cucumber vein yellowing virus in cucumber.
228
E. Steel et al. / Journal of Virological Methods 163 (2010) 222–228
IOBC/wprs Bulletin—integrated control in protected crops. Mediterranean Climate 26, 101–106. Janssen, D., Cuadrado, I.M., 2001. Whitefly problems escalate within Spanish cucurbit crops. EWSN Newsletter 11, 1–2. Karasev, A.V., 2000. Genetic diversity and evolution of closteroviruses. Annual Review of Phytopathology 38, 293–324. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 (259), 680–685. Livieratos, I.C., Avgelis, A.D., Coutts, R.H.A., 1999. Molecular characterization of the cucurbit yellow stunting disorder virus coat protein gene. Phytopathology 89, 1050–1055. Louro, D., Vicente, M., Vaira, A.M., Accotto, G.P., Nolasco, G., 2000. Cucurbit yellow stunting disorder virus (genus Crinivirus) associated with the yellowing disease of cucurbit crops in Portugal. Plant Disease 84, 1156. Marco, C.F., Aranda, M.A., 2005. Genetic diversity of a natural population of Cucurbit yellow stunting disorder virus. Journal of General Virology 86, 815–822. Nørh, J., Kristiansen, K., Krogsdam, A.M., 2003. Expression of recombinant proteins: an introduction. Springer Protocols 232, 93–101.
Ruiz, L., Janssen, D., Martin, G., Velasco, L., Segundo, E., Cuadrado, I.M., 2006. Analysis of the temporal and spatial disease progress of Bemisia tabaci-transmitted Cucurbit yellow stunting disorder virus and Cucumber vein yellowing virus in cucumber. Plant Pathology 55, 264–275. Schein, C.H., 1989. Production of soluble recombinant proteins in bacteria. BioTechnology 7, 1141–1147. Vanslogteren, E., Vanslogteren, D.H.M., 1957. Serological identification of plant viruses and serological diagnosis of virus diseases of plants. Annual Review of Microbiology 11, 149–164. Voinnet, O., Rivas, S., Mestre, P., Baulcombe, D., 2003. An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant Journal 33, 949–956. Wintermantel, W.M., 2004. Emergence of Greenhouse Whitefly (Trialeurodes vaporariorum) Transmitted Criniviruses as Threats to Vegetable and Fruit Production in North America. In: M. Elliott, L. (Ed.), APSnet Feature. ASPnet. Wisler, G.C., Duffus, J.E., Liu, H.Y., Li, R.H., 1998. Ecology and epidemiology of whitefly-transmitted closteroviruses. Plant Disease 82, 270–280.