H+ antiporter gene, IbNHX2, enhances salt and drought tolerance in transgenic sweetpotato

Scientia Horticulturae 201 (2016) 153–166

Contents lists available at ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

A vacuolar Na+ /H+ antiporter gene, IbNHX2, enhances salt and drought tolerance in transgenic sweetpotato Bing Wang 1 , Hong Zhai 1 , Shaozhen He 1 , Huan Zhang, Zhitong Ren, Dongdong Zhang, Qingchang Liu ∗ Beijing Key Laboratory of Crop Genetic Improvement/Laboratory of Crop Heterosis and Utilization, Ministry of Education, China Agricultural University, Beijing 100193, China

a r t i c l e

i n f o

Article history: Received 2 April 2015 Received in revised form 4 September 2015 Accepted 19 January 2016 Keywords: Drought tolerance IbNHX2 Salt tolerance Sweetpotato Vacuolar Na+ /H+ antiporter

a b s t r a c t Plant vacuolar Na+ /H+ antiporters (NHX) play a critical role in adaption to abiotic stresses by compartmentalizing Na+ into vacuoles from the cytosol. In this study, a vacuolar Na+ /H+ antiporter gene, named IbNHX2, was isolated and characterized from salt-tolerant sweetpotato (Ipomoea batatas (L.) Lam.) line ND98. IbNHX2 consisted of 542 amino acid residues with a conserved binding domain ‘FFIYLLPPI’ for amiloride and a cation/H+ exchanger domain, and shared a high amino acid identity (73.72–96.13%) with the identified vacuolar Na+ /H+ antiporters in other plant species. The genomic DNA of IbNHX2 contained 14 exons and 13 introns. Expression of IbNHX2 was induced by abscisic acid (ABA), NaCl and polyethylene glycol (PEG). Its overexpression significantly enhanced salt and drought tolerance in the transgenic sweetpotato. An significant increase of proline content and superoxide dismutase (SOD) and photosynthesis activities and significant reduction of malonaldehyde (MDA) and H2 O2 content were found in the transgenic sweetpotato plants. Up-regulation of the stress-responsive genes encoding pyrroline5-carboxylate synthase (P5CS), SOD, catalase (CAT), zeaxanthinepoxidase (ZEP), 9-cis-epoxycarotenoid dioxygenase (NCED), aldehyde oxidase (AO), late embryogenesis abundant protein (LEA), psbA and phosphoribulokinase (PRK) in the transgenic plants was also found under salt and drought stresses. The overall results demonstrate the explicit role of IbNHX2 in conferring salt and drought tolerance of sweetpotato. The IbNHX2 gene has the potential to be used for improving salt and drought tolerance of plants. © 2016 Elsevier B.V. All rights reserved.

1. Introduction Soil salinity and drought reduce the agricultural productivity worldwide (Munns and Tester, 2008; Hu and Xiong, 2014). Approximately 20% of the irrigated soils worldwide are suffering salt stress (Zhao et al., 2013). The problem of the global water scarcity caused by the increasing world population and worldwide climate change threatens sustainable traditional crop farming (Yang et al., 2010). Therefore, it is extremely important to develop crops with elevated levels of salt and drought tolerance. Plants have evolved kinds of smart and precise mechanisms, comprising growth and development regulation, detoxification, ion homeostasis and osmotic adjustment, to deal with and adapt to salt and drought stresses (Bohnert et al., 1995; Zhu, 2001). In recent years, extensive studies have focused on the mechanism of ion

∗ Corresponding author. Fax: +86 10 62733710. E-mail address: [email protected] (Q. Liu). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.scienta.2016.01.027 0304-4238/© 2016 Elsevier B.V. All rights reserved.

homeostasis in plant cells (Yamaguchi et al., 2013; Reguera et al., 2014). It has been indicated that salt-tolerant plants have ability to adopt efficient strategies, including restricting the uptake of environmental Na+ , increasing the efflux of Na+ from the cell and compartmentalizing Na+ into vacuoles from the cytosol, to prevent superfluous accumulation of Na+ in cytosol, so that plant cells can sustain the ion homoestasis. These biological processes might involve Na+ /H+ antiporter (NHX) family (Xu et al., 2009). In Arabidopsis, the NHX family consists of eight members, six of which are intracellular (AtNHX1 to AtNHX6), located either to the vacuole (AtNHX1 to AtNHX4) or endosomes (AtNHX5 and AtNHX6) and the additional two more divergent members (AtNHX7/SOS1 and AtNHX8) at the plasma membrane (Bassil et al., 2012; Reguera et al., 2014). In plants, AtNHX1 is the first characterized gene of the vacuolar NHX type (Apse et al., 1999; Gaxiola et al., 1999). Subsequently, several AtNHX1-like Na+ /H+ antiporter genes have been cloned and characterized from different plant species including Oryza sativa, Brassica, Atriplex dimorphostegia, Chenopodium glaucum, Zygophyllum xanthoxylum, Solanum lycopersicum, Vigna radiate and Vigna

154

B. Wang et al. / Scientia Horticulturae 201 (2016) 153–166

unguiculata (Fukuda et al., 1999; Zhang et al., 2001; Li et al., 2008; Wu et al., 2011; Gálvez et al., 2012; Mishra et al., 2014, 2015). NHX1 has been shown to enhance salt and drought tolerance in several plant species (Apse et al., 1999; Xu et al., 2009; Banjara et al., 2012; Yarra et al., 2012; Chen et al., 2014; Mishra et al., 2014). However, there are only a few reports on isolation and characterization of the NHX2 gene. The results of Yokoi et al. (2002) implicated AtNHX2 and AtNHX5, together with AtNHX1, as salt tolerance determinants, and indicated that AtNHX2 had a major function in vacuolar compartmentalization of Na+ . Bassil et al. (2011) found that AtNHX1 and AtNHX2 controlled vacuolar pH and K+ homeostasis to regulate growth, flower development and reproduction in Arabidopsis. AtNHX1 and AtNHX2 were also found to mediate active potassium uptake into vacuoles to regulate cell turgor and stomatal function in Arabidopsis (Barragán et al., 2012). Overexpression of AmNHX2 from Ammopiptanthus mongolicus enhanced salt and drought tolerance in transgenic Arabidopsis (Wei et al., 2011). Sweetpotato, Ipomoea batatas (L.) Lam., is an important food crop in the world and its yield is often limited by salt and drought stresses (Xiao et al., 2009; Zang et al., 2009; Liu et al., 2015). Genetic engineering has been shown to have the potential for improving the tolerance to abiotic stresses in sweetpotato. Several salt toleranceassociated genes, IbOr, IbNFU1, IbP5CR, IbMas and IbSIMT1, have been isolated and characterized in sweetpotato (Kim et al., 2013a; Wang et al., 2013; Liu et al., 2014a,b,c, 2015). Lu et al. (2010) found that overexpression of IbCu/ZnSOD and IbAPX improved drought tolerance of transgenic sweetpotato plants. Overexpression of LEA14 and down-regulation of IbLCY-ε enhanced salt and drought tolerance in transgenic sweetpotato calluses (Park et al., 2011; Kim et al., 2013b). In this study, we isolated a new vacuolar Na+ /H+ antiporter gene, named IbNHX2, from sweetpotato and found that this gene significantly enhanced salt and drought tolerance in the transgenic sweetpotato.

2. Materials and methods 2.1. Plant materials Sweetpotato line ND98 was used for gene cloning in this study. One expressed sequence tag (EST) clone, with 33.88% homology to AtNHX2 (AT3G05030) of Arabidopsis, was selected from the ND98 EST library constructed at our laboratory and used to clone the gene. The cloned gene was further introduced into ND98 to characterize its function in responses of the transgenic plants to salt and drought stresses. This study was conducted at Experimental Station for Transgenic Crops of China Agricultural University, Beijing, China.

2.2. Cloning and sequence analysis of IbNHX2 Extraction and reverse-transcription of total RNA from fresh leaves of 4-week-old in vitro-grown plants of ND98 were conducted according to the method of Liu et al. (2014c). The 5 and 3 ends of the coding region were amplified using the 5 and 3 Full RACE Kit (TaKaRa, Beijing, China). Using the Primer 3 program (http://frodo.wi.mit.edu/primer3/), primers were designed based on the sequence of EST (Table 1). PCR amplifications were performed with an initial denaturation at 94 ◦ C for 3 min, followed by 35 cycles at 94 ◦ C for 30 s, 55 ◦ C for 30 s, 72 ◦ C for 2 min and final extension at 72 ◦ C for 10 min. PCR products were separated on a 1.0% (w/v) agarose gel. Target DNA bands were recovered, then cloned into PMD19-T, and finally transformed into competent cells of Escherichia coli strain DH5␣ for sequencing as described in detail previously (Liu et al., 2014c).

Table 1 Primers used for the cloning, transformation and identification of IbNHX2 in sweetpotato. Primer sequence (5 -3 )

Primer name 



Primers for 5 /3 RACE IbNHX2 3 RACE primer 1 IbNHX2 3 RACE primer 2 IbNHX2 5 RACE primer 1 IbNHX2 5 RACE primer 2

TATCATTTGGTGCGGTCAAA CCGATTCTGTTTGCACATTG GTGCCAATAGCTCCAAACAG AACTGCTTCTTTTTCACCTG

Primers for genomic DNA IbNHX2 GD-F IbNHX2 GD-R

AGTGATTTTTTATGTTTTGGGGAG AGCCAAATTGATAATTCAGTCATTA

Primers for constructing expression vector IbNHX2-OE-F GCTCTAGAATGGCGTTCGGATTATCTTC IbNHX2-OE-R GGAGCTCTCATCTAGGGCTCTGCTCAG Primers for identifying transformants TCAGAAAGAATGCTAACCCACA 35S-F TTCGCTAAAGACGAGAAGATGTG IbNHX2-R Primers for Southern blotting IbNHX2-probe-F IbNHX2-probe-R

GTGTTCGGGTTGATGACGC TGCCCCTAGAGCCCATTT

Primers for real-time quantitative PCR Actin-F Actin-R AO-F AO-R CAT-F CAT-R LEA-F LEA-R NCED-F NCED-R NHX2-F NHX2-R P5CS-F P5CS-R PRK-F PRK-R psbA-F psbA-R SOD-F SOD-R ZEP-F ZEP-R

AGCAGCATGAAGATTAAGGTTGTAGCAC TGGAAAATTAGAAGCACTTCCTGTGAAC GTCGTTTATGCGGGCTCCT CCTTTTCGTCCACCGATTTT ACGCAATTCCCGGACGTGAT AAGCCTTCCATGTGGCGGTA CCCGTCACTGGGTACTAC CAAGAATCCATCATAAGC AGAAGCAGGGCAAATAAACAAG CCGTCGCCGTACCTAAACTC TGTTCGGGTTGATGACGC GTTGGTTGTCCAGAAGTGGC GCCTGATGCACTTGTTCAGA GCCTGATGCACTTGTTCAGA GCTCTCAACATAGATCAGCT TGAAGGCTCTACTATCTCAT CATCCGTTGATGAATGGTTA GCAACAGGAGCTGAGTATGC TCCTGGACCTCATGGATTTC GCCACTATGTTTCCCAGGTC CCGTCTCGGGGCAGTTAAT GACTGATTTGCGTAGTAAACATGGT

Multiple sequence alignment, phylogenetic analysis and theoretical molecular weight and isoelectric point (pI) calculation of IbNHX2 were conducted according to the method of Liu et al. (2014a). The conserved domain was scanned by InterPro program (http://www.ebi.ac.uk/interpro/). Transmembrane domains TM were predicted by TMHMM Sever 2.0 (http://www.cbs.dtu.dk/ services/TMHMM/). Post-translational modification sites were predicted using ScanProsite (http://www.ebi.ac.uk/Tools/pfa/ps scan/ ). Genomic DNA was extracted from fresh leaves of 4-week-old in vitro-grown plants of ND98 using EasyPure Plant Genomic DNA Kit (Transgen, Beijing, China). The corresponding fragment was amplified using primers of IbNHX2 (Table 1). PCR amplifications were conducted with an initial denaturation at 94 ◦ C for 5 min, followed by 35 cycles at 94 ◦ C for 30 s, 55 ◦ C for 30 s, 72 ◦ C for 6 min and final extension at 72 ◦ C for 10 min. Cloning and sequencing of the corresponding product was done as described above. Exon-intron structure was constructed by alignment of cDNA sequence with the genomic sequence using Spidey tool (http://www.ncbi.nlm.nih. gov/IEB/Research/Ostell/Spidey/) and compared with the NHX gene family of Arabidopsis (http://www.arabidopsis.org/).

B. Wang et al. / Scientia Horticulturae 201 (2016) 153–166

155

Fig. 1. Sequence alignment of IbNHX2, AtNHX1 (Arabidopsis thaliana, NP 198067), AtNHX2 (NP 187154), AtNHX3 (NP 200358) and AtNHX4 (NP 187288). The 12 putative transmembrane domains (labeled as TMl-TM12) of IbNHX2 are indicated by thick lines above the sequences. The amiloride binding domain is framed with a box in the TM3. The cation/H+ exchanger domain is indicated by asterisk line.

2.3. Expression analysis of IbNHX2 The 4-week-old in vitro-grown plants of ND98 were treated in 1/2 Murashige and Skoog (MS) medium containing 100 ␮M abscisic acid (ABA), 200 mM NaCl and 20% polyethylene glycol (PEG) 6000, respectively, and sampled at 0, 2, 4, 6, 12, 24 and 48 h after treatment and were analyzed for IbNHX2 expression by realtime quantitative PCR (qRT-PCR) as described by Liu et al. (2014a). Specific primers of IbNHX2 were listed in Table 1. A 169 bp fragment of sweetpotato ␤-actin gene (Genbank AY905538), used as an internal control, was amplified by the specific primers (Table 1). Quantification of the gene expression was done with comparative CT method (Schmittgen and Livak, 2008).

erance was conducted using MS medium with 150 mM NaCl and 20% PEG6000, respectively, at 27 ± 1 ◦ C under 13 h of cool-white fluorescent light at 54 ␮M/m2 /s. Three plants were treated for each line. The growth and rooting ability were observed for 4 weeks and fresh weight (FW) was measured immediately. Proline and malonaldehyde (MDA) content and superoxide dismutase (SOD) activity were analyzed as described by Gao et al. (2011). 2.6. In vivo assay for salt and drought tolerance

The binary vector pCAMBIA3301 used in this study contained IbNHX2 gene under the control of CaMV 35S promoter and NOS terminator and gusA and bar genes driven by a CaMV 35S promoter, respectively. Embryogenic suspension cultures of ND98 were prepared for the transformation according to the method of Liu et al. (2001). Transgenic plants were produced as described by Yu et al. (2007), but selection culture was conducted using 0.5 mg L−1 phosphinothricin (PPT). The putatively transgenic plants were tested for GUS expression using histochemical GUS assay as described by Liu et al. (2014b). PCR analysis was conducted using 35S forward and IbNHX2-specific reverse primers (Table 1) followed by the protocols of Liu et al. (2014a). These primers were expected to give products of 1057 bp.

The transgenic plants and WT were transferred to soils in a greenhouse and further in a field. The cuttings about 25 cm in length from 6-week-old plants grown in a field were cultured in the Hoagland solution (Hoagland and Arnon, 1950) with no stress for 8 weeks, 150 mM NaCl for 4 weeks and 20% PEG6000 for 3 weeks and then recovered for 5 weeks in Hoagland solution without stress, respectively. Three cuttings were treated for each line. The growth and rooting ability were observed and FW and dry weight (DW) were measured immediately according to the method of Liu et al. (2014c). The 25-cm-long cuttings of the transgenic plants and WT were grown in transplanting boxes containing a mixture of soil, vermiculite and humus (1:1:1, v/v/v) in a greenhouse. All plants were irrigated sufficiently with half-Hoagland solution for 10 days until the cuttings formed new leaves and then irrigated with a 200 mL of 200 mM NaCl solution once every 2 days for 3 weeks, or subjected to drought stress without water for 6 weeks. Three cuttings were treated for each line. The growth was observed and FW and DW were measured as described above.

2.5. In vitro assay for salt and drought tolerance

2.7. Analyses of photosynthesis and H2 O2

The expression of IbNHX2 in the in vitro-grown transgenic and wild-type (WT) plants under normal conditions were analyzed by qRT-PCR as described above. In vitro assay for salt and drought tol-

Photosynthetic rate, stomatal conductance, transpiration rate and relative chlorophyll content in the leaves of the salt- and drought-tolerant transgenic plants and WT grown in a transplant-

2.4. Production of sweetpotato plants overexpressing IbNHX2

156

B. Wang et al. / Scientia Horticulturae 201 (2016) 153–166

Fig. 2. Comparison of exon and intron constituents between IbNHX2 and AtNHX2, AtNHX1, AtNHX3, and AtNHX4. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) Locus tags obtained from TAIR are given for coding sequence. Exons are represented by colorful boxes and introns by black lines, with length (bp) displayed above exons and below introns. The split exons of NHX2 are framed with red boxes.

Fig. 3. Expression analysis of IbNHX2 in sweetpotato line ND98 by qRT-PCR. (A–C) Relative expression level of IbNHX2 in ND98 after different times (h) of stresses with 100 ␮M ABA, 200 mM NaCl and 20% PEG6000, respectively. Data are presented as means ± SE (n = 3).

Fig. 4. GUS assay and PCR analysis of the IbNHX2-overexpressing sweetpotato plants. (A–C) GUS expression in leaf, stem and root of a transgenic plant and no GUS expression in WT, respectively. (D) PCR analysis of transgenic plants. Lane M: DL2000 DNA marker; Lane W: water as negative control; Lane P: plasmid pCAMBIA3301-IbNHX2 as positive control; Lane WT: WT as negative control; Lanes L8, L31, . . ., L277: transgenic plants.

ing box for 2 weeks under 200 mM NaCl stress and for 4 weeks under drought stress, respectively, were measured according to the method of Liu et al. (2014a). H2 O2 accumulation was analyzed by using 3,3 -diaminobenzidine (DAB) staining as described by Liu et al. (2014a).

2.8. Southern blot analysis Southern blot analysis was conducted as described by Liu et al. (2014a). Coding sequence of the 474 bp IbNHX2 was used as probe (Table 1). The labeling of probe, prehybridization, hybridization and

B. Wang et al. / Scientia Horticulturae 201 (2016) 153–166

157

Fig. 5. Expression analysis of IbNHX2 in the transgenic sweetpotato plants. The in vitro-grown transgenic plants and WT were used to analyze the expression of IbNHX2. The results are expressed as relative values based on WT as reference sample set to 1.0. Data are presented as means ± SE (n = 3). * and ** indicate a significant difference from that of WT at P < 0.05 and <0.01, respectively, by Student’s t-test.

Table 2 Comparison of salt tolerance between the IbNHX2-overexpressing sweetpotato plants and WT after 4 weeks of culture on MS medium with 150 mM NaCl. Plant lines L143 L241 L277 L61 L271 L235 L248 L65 L226 L93 L210 L101 L67 L68 L137 L8 L136 L142 L199 L205 L211 L64 L82 L104 L132 L133 L166 L209 L62 L255 L256 L33 L81 WT L105 L161 L165 L167 L31 L71 a * **

Fresh weight (g plant−1 ) 1.44 1.37 1.26 1.19 1.10 1.03 0.91 0.74 0.78 0.62 0.60 0.56 0.51 0.53 0.47 0.45 0.42 0.38 0.36 0.33 0.34 0.32 0.31 0.29 0.27 0.25 0.25 0.24 0.21 0.22 0.19 0.17 0.17 0.19 0.17 0.16 0.16 0.22 0.21 0.18

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

** , a

0.01 0.03** 0.03** 0.02** 0.02** 0.06** 0.05** 0.03** 0.03** 0.02** 0.04** 0.03** 0.02** 0.03** 0.02** 0.04** 0.03** 0.02** 0.03** 0.05** 0.02** 0.01** 0.02** 0.01** 0.02** 0.01** 0.02* 0.01 0.01 0.02 0.02 0.01 0.01 0.02 0.01 0.01 0.01 0.04 0.03 0.02

Proline content (␮g g−1 FW)

SOD activity (U g−1 FW)

MDA content (nM g−1 FW)

171.90 ± 1.87 162.64 ± 3.95** 159.28 ± 2.37** 158.77 ± 2.36** 157.39 ± 3.22** 148.45 ± 1.83** 141.46 ± 1.58** 141.37 ± 3.11** 121.87 ± 3.67** 118.41 ± 3.04** 117.53 ± 3.97** 116.22 ± 1.49** 114.56 ± 2.72** 110.42 ± 1.39** 102.47 ± 2.61** 100.06 ± 1.12** 93.97 ± 1.46** 91.90 ± 3.14** 90.99 ± 1.25** 90.94 ± 2.31** 87.92 ± 3.97** 85.82 ± 2.53* 85.08 ± 2.39* 83.45 ± 1.72 82.66 ± 0.79 82.23 ± 3.80 81.68 ± 2.91 81.21 ± 2.03 80.55 ± 5.01 78.36 ± 2.47 75.16 ± 4.27 73.80 ± 1.68 72.52 ± 5.82 69.11 ± 2.00 66.07 ± 3.47 65.48 ± 1.03 62.25 ± 4.80 59.35 ± 1.87 56.42 ± 0.79 59.26 ± 1.96

980.24 ± 21.86 761.75 ± 15.07** 680.56 ± 6.50** 698.01 ± 13.56** 675.21 ± 28.33** 597.37 ± 4.29** 617.52 ± 5.14** 561.49 ± 5.35** 556.27 ± 31.14** 546.53 ± 7.81** 528.85 ± 11.90** 542.26 ± 16.18** 515.67 ± 15.57** 518.52 ± 9.69** 500.00 ± 10.52** 497.15 ± 7.44** 488.17 ± 10.78** 487.68 ± 12.76** 487.46 ± 8.23** 478.4 ± 19.69** 467.47 ± 15.11** 453.23 ± 19.95** 449.67 ± 6.14** 424.15 ± 27.84** 406.46 ± 9.30** 353.51 ± 10.23** 335.23 ± 4.17 348.29 ± 21.04** 315.76 ± 12.12 314.10 ± 10.78 308.64 ± 4.63 299.38 ± 5.00 194.68 ± 12.83 185.90 ± 3.26 187.74 ± 8.07 181.68 ± 6.79 179.28 ± 9.38 177.64 ± 15.76 182.64 ± 5.38 173.46 ± 12.38

5.74 6.94 6.32 6.98 7.11 7.64 7.48 7.79 8.20 8.22 8.37 8.41 8.23 8.52 8.54 8.59 8.71 9.07 9.34 9.64 10.81 10.19 11.08 10.81 10.91 11.10 12.04 12.22 12.72 13.14 14.16 14.28 15.22 15.40 16.10 16.34 16.34 16.35 15.47 16.18

**

Data are presented as means ± SE (n = 3). Indicate a significant difference from that of WT at P < 0.05, by Student’s t-test. Indicate a significant difference from that of WT at P < 0.01, by Student’s t-test.

**

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.35** 0.08** 0.87** 0.43** 1.29** 0.76** 0.26** 0.34** 0.05** 0.13** 0.52** 0.18** 0.24** 0.31** 0.28** 0.70** 1.11** 1.49** 0.23** 0.73** 0.35** 1.13** 1.39** 0.73** 0.92** 0.02** 1.12** 1.26** 0.42** 0.86** 1.43 0.57 0.37 0.43 0.74 0.38 1.83 1.27 1.69 2.05

158

B. Wang et al. / Scientia Horticulturae 201 (2016) 153–166

Table 3 Comparison of drought tolerance between the IbNHX2-overexpressing sweetpotato plants and WT after 4 weeks of culture on MS medium with 20% PEG6000. Fresh weight (g plant−1 )

Plant lines

2.48 2.42 1.88 2.14 1.78 1.73 1.67 1.52 1.59 1.48 1.36 1.26 1.34 1.24 1.24 1.23 1.17 1.23 1.23 1.09 1.03 0.98 0.96 0.82 0.85 0.88 0.85 0.78 0.74 0.69 0.69 0.70 0.63 0.64 0.64 0.67 0.57 0.54 0.34 0.23

L143 L241 L277 L61 L271 L64 L31 L65 L93 L101 L68 L166 L62 L67 L82 L137 L248 L199 L256 L205 L210 L142 L211 L104 L133 L132 L8 L81 L136 L209 L167 WT L226 L161 L165 L33 L255 L105 L71 L235 a * **

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

** , a

0.12 0.12** 0.11** 0.05** 0.01** 0.03** 0.02** 0.07** 0.02** 0.04** 0.03** 0.03** 0.09** 0.02** 0.03** 0.02** 0.05** 0.02** 0.07** 0.02** 0.06** 0.09** 0.06** 0.01* 0.02** 0.09** 0.02** 0.05 0.02 0.03 0.06 0.04 0.07 0.09 0.06 0.05 0.02 0.09 0.05 0.02

Proline content (␮g g−1 FW) 184.79 183.86 172.02 162.23 166.81 158.39 152.34 133.31 133.49 128.48 126.96 130.28 122.09 116.25 108.13 112.75 108.17 107.09 101.02 104.76 100.29 97.07 96.12 95.76 94.79 93.23 95.2 94.36 92.97 89.96 88.70 83.31 77.98 67.35 76.35 62.23 57.44 58.99 62.34 58.84

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

**

SOD activity (U g−1 FW)

MDA content (nM g−1 FW)

1094.85 ± 15.67 1058.77 ± 16.02** 1006.17 ± 6.06** 964.74 ± 15.24** 881.71 ± 22.27** 853.53 ± 8.36** 754.98 ± 6.53** 722.93 ± 26.18** 672.72 ± 7.15** 642.69 ± 12.27** 613.49 ± 7.81** 587.37 ± 14.71** 540.69 ± 10.43** 513.59 ± 25.56** 463.79 ± 9.11** 448.95 ± 3.29** 433.05 ± 7.44** 405.86 ± 8.55** 376.31 ± 19.96** 346.63 ± 11.12** 316.59 ± 5.25** 308.96 ± 0.27** 293.00 ± 1.24** 287.26 ± 1.58** 271.92 ± 3.62** 251.65 ± 3.93** 228.87 ± 3.93** 210.24 ± 1.49** 203.28 ± 2.34* 198.72 ± 1.24 192.16 ± 0.56 183.08 ± 2.14 187.38 ± 4.90 186.72 ± 2.07 181.83 ± 7.06 179.09 ± 6.69 178.08 ± 1.70 177.74 ± 8.94 180.34 ± 2.29 177.24 ± 3.82

3.28 4.59 5.07 4.96 5.15 5.43 5.32 5.22 6.53 6.64 6.97 6.76 6.74 6.79 6.89 6.98 7.10 7.13 7.24 7.06 7.29 7.37 7.43 7.81 8.68 8.82 9.55 9.98 10.14 10.39 12.32 11.29 11.33 12.40 12.35 11.89 11.50 10.89 12.57 12.22

**

4.24 13.96** 3.94** 12.48** 3.96** 6.34** 2.42** 2.20** 4.14** 2.22** 4.49** 2.79** 2.95** 2.64** 2.08** 4.26** 3.43** 0.96** 1.12** 6.94** 4.08* 3.38* 10.63* 3.01 2.51 1.63 10.72 2.61 5.84 3.10 7.96 4.59 1.89 5.92 6.62 2.40 13.38 3.46 5.21 2.12

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.06** 0.22** 0.06** 0.08** 0.31** 0.43** 0.04** 0.05** 0.06** 0.07** 0.25** 0.01** 0.70** 0.52** 0.04** 0.12** 0.29** 0.02** 0.05** 0.04** 0.76** 0.02** 0.83** 0.04** 0.60** 0.05** 0.03** 0.02** 1.08* 0.17 1.35 0.41 0.12 0.49 0.73 0.37 0.27 0.07 0.08 0.02

Data are presented as means ± SE (n = 3). Indicate a significant difference from that of WT at P < 0.05, by Student’s t-test. Indicate a significant difference from that of WT at P < 0.01, by Student’s t-test.

Table 4 Leaf and root formation of the IbNHX2-overexpressing sweetpotato plants cultured for 4 weeks in the Hoagland solution with 150 mM NaCl and cultured for 3 weeks in the Hoagland solution with 20% PEG6000 and then allowed to recover for 5 weeks, respectively. Plant lines L143 L241 L277 L61 L271 L235 L248 L93 L65 L226 L210 L101 L67 L68 L137 L136 L8 WT a b * **

Leaf formation

No. of roots

NaCl

PEG6000

NaCl

++a ++ ++ ++ ++ ++ ++ ++ ++ + + + + − − − − −

++ ++ ++ ++ ++ + + + + + + + − − − − − −

42.00 38.00 37.33 34.33 32.67 24.67 23.67 21.33 16.67 15.33 15.00 12.67 11.33 6.33 5.67 5.33 3.33 1.33

Length of roots (cm) PEG6000

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

7.81** , b 2.65** 7.77** 2.08** 3.22** 7.37** 7.02** 10.69** 3.06** 2.52** 5.29** 7.23* 1.53* 3.79 1.53 2.52 1.53 0.58

23.00 22.67 19.33 19.33 18.67 15.00 14.67 15.33 14.00 13.67 10.67 10.00 4.33 4.33 3.00 3.33 2.33 1.67

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

4.36** 3.21** 2.08** 2.52** 2.08** 2.65** 3.06** 1.73** 3.00** 3.06** 3.79** 5.29** 1.53** 2.08 1.00 1.53 0.58 0.58

NaCl 6.00 5.60 5.30 5.30 5.13 5.60 4.87 5.30 4.47 3.07 5.67 3.53 2.57 1.57 2.00 2.07 1.33 1.07

PEG6000 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.56** 0.44** 1.05** 1.05** 0.45** 0.70** 1.16** 1.95** 0.21* 0.25* 2.11** 3.44* 0.72 0.61 0.36 0.45 0.15 0.25

‘++’ Indicates that cuttings formed obvious new leaves; ‘+’ indicates that cuttings survived, but failed to form new leaves; ‘−’ indicates that cuttings died. Data are presented as means ± SE (n = 3). Indicate a significant difference from that of WT at P < 0.05, by Student’s t-test. Indicate a significant difference from that of WT at P< 0.01, by Student’s t-test.

5.10 5.00 5.00 5.33 4.97 4.73 4.63 4.97 4.63 4.13 3.27 3.17 1.80 1.37 1.07 1.20 0.73 0.77

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.44** 0.56** 0.79** 0.50** 0.71** 0.61** 1.05** 0.67** 0.55** 0.45** 0.15** 0.25** 0.61* 0.38 0.45 0.36 0.15 0.15

B. Wang et al. / Scientia Horticulturae 201 (2016) 153–166

159

Fig. 6. Responses of transgenic sweetpotato plants and WT cultured on MS medium supplemented with NaCl and PEG6000. All plants were cultured for 4 weeks on MS medium with no stress (A), 150 mM NaCl (B) and 20% PEG6000 (C).

detection were performed using DIG High Prime DNA Labeling and Detection Starter Kit II (Roche, Basel, Switzerland).

2.9. Expression analyses of salt and drought stress-responsive genes

2.10. Statistical analysis All experiments were independently performed three times and values were presented as the mean ± SE. Results were analyzed by Student’s t-test in a two-tailed analysis. Significance was defined as P < 0.05 and P < 0.01. 3. Results

Leaves of the transgenic and WT plants grown in a transplanting box for 2 weeks under 200 mM NaCl stress and for 4 weeks under drought stress, respectively, were used to analyze the expression of salt and drought stress-responsive genes as described by Liu et al. (2014c). Specific primers designed from conserved regions of genes were listed in Table 1.

3.1. Cloning and sequence analysis of IbNHX2 The IbNHX2 cDNA of 2122 bp in length, with an open reading frame (ORF) of 1629 bp, was cloned from ND98 by RACE. It encodes a 542 amino acids polypeptide with a molecular weight of 59.80 kDa

160

B. Wang et al. / Scientia Horticulturae 201 (2016) 153–166

Fig. 7. Responses of transgenic sweetpotato plants and WT incubated in Hoagland solution with NaCl and PEG6000. (A1–A3) Phenotypes, FW and DW of transgenic plants and WT incubated for 8 weeks in Hoagland solution without stress. (B1–B3) Phenotypes, FW and DW of transgenic plants and WT incubated for 4 weeks in Hoagland solution with 150 mM NaCl. (C1–C3) Phenotypes, FW and DW of transgenic plants and WT incubated for 3 weeks in Hoagland solution with 20% PEG6000 and then recovered for 5 weeks in Hoagland solution without stress. Data are presented as means ± SE (n = 3). * and ** indicate a significant difference from that of WT at P < 0.05 and <0.01, respectively, by Student’s t-test.

Fig. 8. Responses of transgenic sweetpotato plants and WT grown in transplanting box under NaCl and drought stresses. (A1–A3) Phenotypes, FW and DW of transgenic plants and WT grown for 6 weeks under normal condition. (B1–B3) Phenotypes, FW and DW of transgenic plants and WT grown for 3 weeks under 200 mM NaCl stress. (C1–C3) Phenotypes, FW and DW of transgenic plants and WT grown for 6 weeks under drought stress. Data are presented as means ± SE (n = 3). * and ** indicate a significant difference from that of WT at P < 0.05 and <0.01, respectively, by Student’s t-test.

and an isoelectric point (pI) of 6.73. A BLASTP search indicated that the amino acid sequence of IbNHX2 showed a high amino acid identity with predicted protein products of I. nil (BAB16380, 96.13%), Ipomoea tricolor (BAB60901, 95.94%), Nicotiana benthamiana (AGS56985, 78.45%), Prunus persica (XP 007208463, 78.21%), Glycine max (AAY43006, 77.37%), Eucalyptus grandis (XP 010041937, 76.97%), S. lycopersicum (XP 010324152, 76.80%),

Fragaria vesca subspecies vesca (XP 004289614, 76.68%), Rosa rugosa (AGF50178, 76.68%) and Arabidopsis thaliana (NP 187154, 73.72%). Phylogenetic analysis revealed that IbNHX2 had a close relationship with the predicted protein products of Ipomoea nil and I. tricolor. IbNHX2 clustered into the vacuolar group belonging to intracellular NHX Na+ /H+ antiporters and was closer to AtNHX2. Multiple sequence alignment figured that IbNHX2 had 73.67%

B. Wang et al. / Scientia Horticulturae 201 (2016) 153–166

161

Fig. 9. Photosynthetic performance in the leaves of transgenic sweetpotato plants under salt and drought stresses. Transgenic plants and WT were grown in transplanting boxes and incubated for 2 weeks under 200 mM NaCl stress and for 4 weeks under drought stress. Data are presented as means ± SE (n = 3). * and ** indicate a significant difference from that of WT at P < 0.05 and <0.01, respectively, by Student’s t-test.

sequence identity with AtNHX1 (NP 198067), 73.72% with AtNHX2 (NP 187154), 56.99% with AtNHX3 (NP 200358) and 67.59% with AtNHX4 (NP 187288) and was also closer to AtNHX2 (Fig. 1). Sequence analysis via InterPro program revealed that IbNHX2 contained an amiloride binding domain and a cation/H+ exchanger domain (Fig. 1). Sequence analysis via TMHMM program showed that IbNHX2 comprised 12 highly conserved putative TM (Fig. 1). The amiloride binding motif, ‘FFIYLLPPI’, detected in TM3 segment, is highly conserved in eukaryotic NHX family as a classic inhibitor of Na+ /H+ antiporters (Kinsella and Aronson, 1981; Harris and Fliegel, 1999). The prediction of putative post-translational modification sites by ScanProsite program assumed the presence of 3 potential N-glycosylation sites (ASN GLYCOSYLATION), 1 cAMP- and cGMP-dependent protein kinase phosphorylation site (CAMP PHOSPHO SITE), 7 Protein kinase C phosphorylation sites (PKC PHOSPHO SITE), 8Casein kinase II phosphorylation sites (CK2 PHOSPHO SITE), 10 N-myristoylation sites (MYRISTYL) and 1 Leucine Zipper site (LEUCINE ZIPPER). The genomic DNA of IbNHX2 gene was 5736 bp and was deduced to contain 14 exons and 13 introns with Spidey program, the numbers of which were the same as those of AtNHX2 (Fig. 2). The 1st to 13th exons of IbNHX2 were the same as those of AtNHX2 in size, but the 14th exon was different between both genes, and their introns were also different in size (Fig. 2). 3.2. Expression analysis of IbNHX2 in ND98 qRT-PCR analysis figured that the expression of IbNHX2 in ND98 was strongly induced by ABA, NaCl and PEG 6000, respectively. The expression of IbNHX2 reached the highest level (7.77-folds) at 6 h of 100 ␮M ABA treatment (Fig. 3A), followed by a decrease. Its expression peaked (11.86-folds) at 4 h of exposure to 200 mM NaCl and then declined (Fig. 3B). For 20% PEG6000 stress, its expression was induced to the highest level (4.65-folds) at 2 h of treatment (Fig. 3C).

3.3. Production of the IbNHX2-overerpressing sweetpotato plants Eighty PPT-resistant embryogenic calluses were produced from 1600 cell aggregates of ND98 cocultivated with A. tumefaciens strain EHA 105 on the selective medium with 2.0 mg L−1 2,4dichlorophenoxyacetic acid (2,4-D), 100 mg L−1 carbenicillin (Carb) and 0.5 mg L−1 PPT. Forty-two of them formed 282 putatively transgenic plants, named L1, L2, . . ., L282, respectively, after transferred to MS medium with 1.0 mg L−1 ABA, 100 mg L−1 Carb and 0.5 mg L−1 PPT. GUS assay showed that 91 of the 282 putatively transgenic plants had visible GUS activity in leaf, stem and root tissues (Fig. 4A–C). PCR analysis of genomic DNA confirmed the presence of IbNHX2 in all of the 91 GUS-positive plants and the absence of IbNHX2 in WT (Fig. 4D). 3.4. Enhanced salt and drought tolerance The randomly sampled 39 transgenic plants were evaluated for their salt and drought tolerance. qRT-PCR analysis showed that the expression level of IbNHX2 was significantly higher in the transgenic plants, especially L143, L241, L277, L61 and L271, than in WT (Fig. 5). The transgenic plants exhibited vigorous growth and rooting in contrast to the poor-growing WT on MS medium with 150 mM NaCl and 20% PEG6000, respectively, while no differences in growth and rooting were observed between the transgenic plants and WT on MS medium without stress (Fig. 6A–C; Tables 2 and 3). Proline content and SOD activity were significantly increased, whereas MDA content was significantly decreased in the 18 transgenic plants, especially L143, L241, L277, L61 and L271, compared to WT (Tables 2 and 3). These results indicated that the 18 transgenic plants, especially L143, L241, L277, L61 and L271, had higher salt and drought tolerance than WT. The 18 transgenic plants and WT showed 100% survival after transferred to the soil in a greenhouse and a field. The cuttings of

162

B. Wang et al. / Scientia Horticulturae 201 (2016) 153–166

Fig. 10. Effects of salt and drought stresses on H2 O2 accumulation in transgenic sweetpotato plants. (A) Accumulation of H2 O2 in the leaves of transgenic plants (L143, L241, L277, L61 and L271) and WT grown for 4 weeks in a transplanting box under normal condition. (B) Accumulation of H2 O2 in the leaves of the transgenic plants and WT grown for 2 weeks in a transplanting box under 200 mM NaCl stress. (C) Accumulation of H2 O2 in the leaves of the transgenic plants and WT grown for 4 weeks in a transplanting box under drought stress. (D) The average intensity of DAB staining leaves after converting to 256 grey scale images. Data are presented as means ± SE (n = 3). * and ** indicate a significant difference from that of WT at P < 0.05 and <0.01, respectively, by Student’s t-test.

these 18 transgenic plants and WT were cultured in the Hoagland solution containing 150 mM NaCl and 20% PEG6000, respectively. The results indicated that the growth and rooting of the transgenic and WT cuttings were normal in Hoagland solution without stress (Fig. 7A1–A3). Under NaCl and PEG stresses, L143, L241, L277, L61 and L271 formed obvious new leaves and roots; the remaining transgenic plants survived, but failed to form new leaves, or gradually turned brown to death; WT died (Fig. 7B1,B2,C1,C2; Table 4). FW and DW of L143, L241, L277, L61 and L271 were increased by 166–205% and 49–127%, respectively, under NaCl stress and 222–263% and 6–86%, respectively, under PEG stress compared to WT (Fig. 7B3 and C3). L143, L241, L277, L61, L271 and WT were grown in the transplanting boxes under 200 mM NaCl stress and drought stress without water, respectively, for further salt and drought evaluation. No differences in growth were observed between the transgenic plants and WT without stress (Fig. 8A1–A3). The transgenic plants exhibited vigorous growth and increased physical size and their FW and DW were increased by 260–300% and 4–80%, respectively, under NaCl stress and 216–255% and 40–97%, respectively, under

drought stress, while WT died (Fig. 8B1–C3). These results further confirmed the enhanced salt and drought tolerance of L143, L241, L277, L61 and L271.

3.5. Increased photosynthesis and reduced H2 O2 accumulation L143, L241, L277, L61 and L271 maintained significantly higher photosynthetic rate, stomatal conductance, transpiration rate and chlorophyll relative content, which were increased by 27–175%, 29–114%, 61–129% and 11–29%, respectively, under NaCl stress and 23–137%, 33–94%, 18–64% and 7–27%, respectively, under drought stress compared to WT (Fig. 9). DAB staining revealed that the transgenic plants accumulated less H2 O2 than WT under NaCl and drought stresses, while there is no significant difference between the transgenic plants and WT without stress (Fig. 10A–D). In addition, Southern blot analysis indicated that the transgenic plants displayed different integration patterns and the increased copy number of integrated IbNHX2 gene varied from 1 to 3, but clear relationship between salt and drought tolerance and the copy number was not found (Fig. 11).

B. Wang et al. / Scientia Horticulturae 201 (2016) 153–166

Fig. 11. Southern blot analysis of the salt- and drought-tolerant sweetpotato plants overexpressing IbNXH2 to detect the copy number of integrated IbNHX2 gene. DNA was digested with EcoRI and hybridized with the DIG-labeled IbNHX2 gene probe. Lane WT: WT; Lanes L143, L241, L277, L61 and L271: salt- and droughttolerant transgenic plants.

3.6. Expression analyses of salt and drought stress-responsive genes qRT-PCR analysis showed that the expression of IbNHX2 was significantly increased in the 5 salt- and drought-tolerant transgenic plants than in WT (Fig. 12). The well-known salt and drought stress-responsive genes, which encode pyrroline-5-carboxylate synthase (P5CS), SOD, catalase (CAT), zeaxanthinepoxidase (ZEP), 9-cis-epoxycarotenoid dioxygenase (NCED), aldehyde oxidase (AO) and late embryogenesis abundant protein (LEA), were significantly up-regulated in the tolerant transgenic plants compared to WT under NaCl and drought stresses (Fig. 12). The psbA and PRK genes encoding D1 protein and phosphoribulokinase (PRKase), respectively, were also up-regulated in the tolerant transgenic plants (Fig. 12). 4. Discussion This is the first report on isolation and functional characterization of a vacuolar Na+ /H+ antiporter gene, named IbNHX2, from sweetpotato. IbNHX2 contained an amiloride binding motif, a cation/H+ exchanger domain and 12 highly conserved putative TM, and therefore belonged to plant vacuolar Na+ /H+ antiporter group (Fig. 1). It was found that IbNHX2 gene was closer to AtNHX2, but the 14th exon was different between both genes and their introns were also different in size though both had the same number of exons and introns (Figs. 1 and 2). Thus, it is thought that IbNHX2 is a new vacuolar Na+ /H+ antiporter gene orthologous to AtNHX2 from sweetpotato. Furthermore, we found that the expression of IbNHX2 was strongly induced by ABA, NaCl and PEG. Its overexpres-

163

sion significantly enhanced salt and drought tolerance in transgenic sweetpotato. It was shown that there was positive correlationship between expression level of the IbNHX2 gene and salt and drought tolerance of transgenic plants (Fig. 5). Especially, the 5 transgenic plants, L143, L241, L277, L61 and L271, showed significantly higher level of IbNHX2 expression than that of the other transgenic plants and WT, indicating that the 5 transgenic plants had better tolerance to salinity and drought. The similar results were also reported by Liu et al. (2014c). Proline accumulation occurs after plants being exposed to high levels of salt and drought (Hare and Cress, 1997; Somal and Yapa, 1998; Kusvuran et al., 2013). It has been suggested that proline plays pivotal roles in the tolerance of abiotic stresses, as an osmoticum (Yoshiba et al., 1997; Trinchant et al., 1998; Zhang et al., 2012), either as a reactive oxygen species (ROS) scavenger (Smirnoff and Cumbes, 1989; Apel and Hirt, 2004), or maybe as part of the stress signal influencing adaptive responses (Maggio et al., 2002). In the present study, the significant increase of proline content was found in the IbNHX2-overexpressing sweetpotato plants, especially L143, L241, L277, L61 and L271, under salt and drought stresses (Figs. 6–8; Tables 2 and 3). The expression level of P5CS involved in proline biosynthesis was also found to be significantly higher in the IbNHX2-overexpressing sweetpotato plants under salt and drought stresses (Fig. 12). The up-regulation of P5CS might lead to more accumulation of proline in the transgenic plants. More proline accumulation might maintain the osmotic balance between the intracellular and extracellular environment and protect membrane integrity, which resulted in the enhanced salt and drought tolerance in the IbNHX2-overexpressing sweetpotato plants. The similar results were also reported in several studies (Storey et al., 1977; Delauney and Verma, 1993; Hare and Cress, 1997; Ma et al., 2008; Kumar et al., 2010; Liu et al., 2014a). In plants, higher MDA content can induce cell membrane damage and further reduces salt and drought tolerance of plants (Bao et al., 2009; Zou et al., 2012; Deng et al., 2013). In the present study, lower levels of MDA were observed in the IbNHX2-overexpressing sweetpotato plants under salt and drought stresses when compared to WT (Tables 2 and 3; Fig. 10). Thus, the enhanced salt and drought tolerance might be due to the reduced MDA content in the transgenic plants. SOD activity constitutes the first line of defense against ROS and is induced by salt and drought to enhance the conversion of superoxide into oxygen and H2 O2 , which is further converted to non-toxic water and monodehydroascorbate by CAT (Koca et al., 2006; Wang et al., 2009; Pagariya et al., 2012; Zhang et al., 2012; Liu et al., 2013; Negi et al., 2015). In the present study, SOD activity was significantly increased and SOD gene was also significantly up-regulated in the IbNHX2-overexpressing sweetpotato plants compared to WT under salt and drought stresses (Fig. 12; Tables 2 and 3). The accumulation of H2 O2 reduced as CAT was up-regulated in the transgenic plants (Figs. 10 and 12). These results suggest that the ROS scavenging ability is enhanced in the transgenic plants. The overall results support that more proline accumulation stimulates ROS scavenging system, which leads to the improved salt and drought tolerance in the transgenic plants (Liu et al., 2014a,b,c). In addition, the photosynthesis capacity was increased and psbA and PRK genes were also up-regulated in the IbNHX2overexpressing sweetpotato plants (Figs. 9 and 12). The increased photosynthesis is thought to be due to more accumulation of proline, which might provide protection against photoinhibition in the transgenic plants under salt and drought stresses (Liu et al., 2014c). ABA is a prime mediator of plant responses to abiotic stresses and regulates the expression of ABA-dependent stress-responsive genes (Zhu, 2002; Liu et al., 2014a). In Arabidopsis, it has been

164

B. Wang et al. / Scientia Horticulturae 201 (2016) 153–166

Fig. 12. Relative expression level of IbNHX2 and stress-responsive genes in transgenic sweetpotato plants. Transgenic plants and WT were grown in transplanting boxes and incubated for 4 weeks under normal condition, for 2 weeks under 200 mM NaCl stress and for 4 weeks under drought stress. The results are expressed as relative values based on WT as reference sample set to 1.0. Data are presented as means ± SE (n = 3). * and ** indicate a significant difference from that of WT at P < 0.05 and <0.01, respectively, by Student’s t-test.

B. Wang et al. / Scientia Horticulturae 201 (2016) 153–166

proved that expression of AtNHX1 and AtNHX2 increased in response to high salt stress through an ABA-dependent signalling pathway (Yokoi et al., 2002). The expression of NHX1 from Gossypium hirsutum and Thellungiella halophila was induced by ABA (Wu et al., 2004; Wu et al., 2009). Exogenous ABA treatment increased LEA transcript levels in Brassica napus (Dalal et al., 2009). In the present study, the up-regulation of ABA signalling pathway related genes (ZEP, NCED and AO) might lead to the increase of ABA content, which further led to the up-regulation of ABA-dependent stressresponsive genes (IbNHX2, LEA and P5CS) (Fig. 12) (Zhu, 2002). In conclusion, a new vacuolar Na+ /H+ antiporter gene, IbNHX2, has been isolated and characterized from sweetpotato. Its overexpression significantly enhanced salt and drought tolerance in the transgenic sweetpotato plants. This gene has the potential to be used for improving salt and drought tolerance of plants. Acknowledgments We thank Dr. Daniel Q. Tong, University of Maryland, USA, for English improvement. We also thank Prof. Wang T, State Key Laboratory of Agrobiotechnology, Beijing, China, for providing Strain EHA 105. This work was supported by China Agriculture Research System (CARS-11, Sweetpotato) and the National Natural Science Foundation of China (31371680). References Apel, K., Hirt, H., 2004. Reactive oxygen species: metabolism oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 55, 373–399. Apse, M.P., Aharon, G.S., Snedden, W.A., Blumwald, E., 1999. Salt tolerance conferred by overexpression of a vacuolar Na+ /H+ antiport in Arabidopsis. Science 285, 1256–1258. Banjara, M., Zhu, L.F., Shen, G.X., Payton, P., Zhang, H., 2012. Expression of an Arabidopsis sodium/proton antiporter gene (AtNHX1) in peanut to improve salt tolerance. Plant Biotechnol. Rep. 6, 59–67. Bao, A.K., Wang, S.M., Wu, G.Q., Xi, J.J., Zhang, J.L., Wang, C.M., 2009. Overexpression of the Arabidopsis H+ -PPase enhanced resistance to salt and drought stress in transgenic alfalfa (Medicago sativa L.). Plant Sci. 176, 232–240. Barragán, V., Leidi, E.O., Andrés, Z., Rubio, L., De, L.A., Fernández, J.A., et al., 2012. Ion exchangers NHX1 and NHX2 mediate active potassium uptake into vacuoles to regulate cell turgor and stomatal function in Arabidopsis. Plant Cell 24, 1127–1142. Bassil, E., Coku, A., Blumwald, E., 2012. Cellular ion homeostasis: emerging roles of intracellular NHX Na+ /H+ antiporters in plant growth and development. J. Exp. Bot. 63, 5727–5740. Bassil, E., Tajima, H., Liang, Y.C., Ohto, M.A., Ushijima, K., Nakano, R., Esumi, T., Coku, A., Belmonte, M., Blumwald, E., 2011. The Arabidopsis Na+ /H+ antiporters NHX1 and NHX2 control vacuolar pH and K+ homeostasis to regulate growth, flower development, and reproduction. Plant Cell 23, 3482–3497. Bohnert, H.J., Nelson, D.E., Jensen, R.G., 1995. Adaptations to environmental stresses. Plant Cell 7, 1099–1111. Chen, G.H., Yan, W., Yang, L.F., Gai, J.Y., Zhu, Y.L., 2014. Overexpression of StNHX1 a novel vacuolar Na+ /H+ antiporter gene from Solanum torvum, enhances salt tolerance in transgenic vegetable soybean. Hortic. Environ. Biotechnol. 55, 213–221. Dalal, M., Tayal, D., Chinnusamy, V., Bansal, K.C., 2009. Abiotic stress and ABA-inducible Group 4 LEA from Brassica napus plays a key role in salt and drought tolerance. J. Biotechnol. 139, 137–145. Delauney, A.J., Verma, D.P.S., 1993. Proline biosynthesis and osmoregulation in plants. Plant J. 4, 215–223. Deng, X.M., Hu, W., Wei, S.Y., Zhou, S.Y., Zhang, F., Han, J.P., Chen, L., Li, Y., Feng, J., Fang, B., Luo, Q., Li, S., Liu, Y., Yang, G., He, G., 2013. TaCIPK29, a CBL-interacting protein kinase gene from wheat, confers salt stress tolerance in transgenic tobacco. PLoS One 8, e69881. Fukuda, A., Nakamura, A., Tanaka, Y., 1999. Molecular cloning and expression of the Na+ /H+ exchanger gene in Oryza sativa. Biochim. Biophys. Acta 1446, 149–155. Gálvez, F.J., Baghour, M., Hao, G.P., Cagnac, O., Rodríguez-Rosales, M.P., Venema, K., 2012. Expression of LeNHX isoforms in response to salt stress in salt sensitive and salt tolerant tomato species. Plant Physiol. Biochem. 51, 109–115. Gao, S., Yuan, L., Zhai, H., Liu, C.L., He, S.Z., Liu, Q.C., 2011. Transgenic sweetpotato plants expressing an LOS5 gene are tolerant to salt stress. Plant Cell Tissue Organ Cult. 107, 205–213. Gaxiola, R.A., Rao, R., Sherman, A., Grisafi, P., Alper, S.L., Fink, G.R., 1999. The Arabidopsis thaliana proton transporters, AtNhx1 and Avp1: can function in cation detoxification in yeast. Proc. Natl. Acad. Sci. U. S. A. 96, 1480–1485. Hare, P.D., Cress, W.A., 1997. Metabolic implications of stress-induced proline accumulation in plants. Plant Growth Regul. 21, 79–102.

165

Harris, C., Fliegel, L., 1999. Amiloride and the Na+ /H+ exchanger protein: mechanism and significance of inhibition of the Na+ /H+ exchanger. Int. J. Mol. Med. 3, 315–321. Hoagland, D.R., Arnon, D.I., 1950. The water-culture method for growing plants without soil. Calif. Agric. Exp. Stn. Circ. 347, 1–39. Hu, H.H., Xiong, L.Z., 2014. Genetic engineering and breeding of drought-resistant crops. Annu. Rev. Plant Biol. 65, 715–741. Kim, S.H., Ahn, Y.O., Ahn, M.J., Jeong, J.C., Lee, H.S., Kwak, S.S., 2013a. Cloning and characterization of an orange gene that increases carotenoid accumulation and salt stress tolerance in transgenic sweetpotato cultures. Plant Physiol. Biochem. 70, 445–454. Kim, S.H., Kim, Y.H., Ahn, Y.O., Ahn, M.J., Jeong, J.C., Lee, H.S., Kwak, S.S., 2013b. Down-regulation of the lycopene ␧-cyclase gene increases carotenoid synthesis via the ␤-branch-specific pathway and enhances salt-stress tolerance in sweetpotato transgenic calli. Physiol. Plant 147, 432–442. Kinsella, J.L., Aronson, P.S., 1981. Amiloride inhibition of the Na+ /H+ exchanger in renal microvillus membrane vesicles. Am. J. Physiol. Heart Circ. 241, F374–F379. Koca, H., Ozdemir, F., Turkan, I., 2006. Effect of salt stress on lipid peroxidation and superoxide dismutase and peroxidase activities of Lycopersicon esculentum and L. pennellii. Biol. Plant. 50, 745–748. Kumar, V., Shriram, V., Kishor, P.B.K., Jawali, N., Shitole, M.G., 2010. Enhanced proline accumulation and salt stress tolerance of transgenic indica rice by over-expressing P5CSF129A gene. Plant Biotechnol. Rep. 4, 37–48. Kusvuran, S., Ellialtioglu, S., Polat, Z., 2013. Antioxidative enzyme activity lipid peroxidation, and proline accumulation in the callus tissues of salt and drought tolerant and sensitive pumpkin genotypes under chilling stress. Hortic. Environ. Biotechnol. 54, 319–325. Li, J.Y., He, X.W., Xu, L., Zhou, J., Wu, P., Shou, H.X., Zhang, F.C., 2008. Molecular and functional comparisons of the vacuolar Na+ /H+ exchangers originated from glycophytic and halophytic species. J. Zhejiang Univ. Sci. B 9, 132–140. Liu, D.G., He, S.Z., Song, X.J., Zhai, H., Liu, N., Zhang, D.D., Ren, Z.T., Liu, Q.C., 2015. IbSIMT1 a novel salt-induced methyltransferase gene from Ipomoea batatas, is involved in salt tolerance. Plant Cell Tissue Organ Cult. 120, 701–715. Liu, D.G., He, S.Z., Zhai, H., Wang, L.J., Zhao, Y., Wang, B., Li, R.J., Liu, Q.C., 2014a. Overexpression of IbP5CR enhances salt tolerance in transgenic sweetpotato. Plant Cell Tissue Organ Cult. 117, 1–16. Liu, D.G., Wang, L.J., Liu, C.L., Song, X.J., He, S.Z., Zhai, H., Liu, Q.C., 2014b. An Ipomoea batatas iron-sulfur cluster scaffold protein gene, IbNFU1, is involved in salt tolerance. PLoS One 9, e93935. Liu, D.G., Wang, L.J., Zhai, H., Song, X.J., He, S.Z., Liu, Q.C., 2014c. A novel ␣/␤-hydrolase gene IbMas enhances salt tolerance in transgenic sweetpotato. PLoS One 9, e115128. Liu, J.J., Xia, Z.L., Wang, M.P., Zhang, X.Q., Yang, T.Z., Wu, J.Y., 2013. Overexpression of a maize E3 ubiquitin ligase gene enhances drought tolerance through regulating stomatal aperture and antioxidant system in transgenic tobacco. Plant Physiol. Biochem. 73, 114–120. Liu, Q.C., Zhai, H., Wang, Y., Zhang, D.P., 2001. Efficient plant regeneration from embryogenic suspension cultures of sweetpotato. In Vitro Cell. Dev. Biol. Plant 37, 564–567. Lu, Y.Y., Deng, X.P., Kwak, S.S., 2010. Over expression of CuZn superoxide dismutase (CuZn SOD) and ascorbate peroxidase (APX) in transgenic sweet potato enhances tolerance and recovery from drought stress. Afr. J. Biotechnol. 9, 8378–8391. Ma, L., Zhou, E., Gao, L., Mao, X., Zhou, R., Jia, J., 2008. Isolation: expression analysis and chromosomal location of P5CR gene in common wheat (Triticum aestivum L.). S. Afr. J. Bot. 74, 705–712. Maggio, A., Miyazaki, S., Veronese, P., Fujita, T., Ibeas, J.I., Damsz, B., Narasimhan, M.L., Hasegawa, P.M., Joly, R.J., Bressan, R.A., 2002. Does proline accumulation play an active role in stress-induced growth reduction? Plant J. 31, 699–712. Mishra, S., Alavilli, H., Lee, B., Panda, S.K., Sahoo, L., 2014. Cloning and functional characterization of a vacuolar Na+ /H+ antiporter gene from Mungbean (VrNHX1) and its ectopic expression enhanced salt tolerance in Arabidopsis thaliana. PLoS One 9, e106678. Mishra, S., Alavilli, H., Lee, B., Panda, S.K., Sahoo, L., 2015. Cloning and characterization of a novel vacuolar Na+ /H+ antiporter gene (VuNHX1) from drought hardy legume, cowpea for salt tolerance. Plant Cell Tissue Organ Cult. 120, 19–33. Munns, R., Tester, M., 2008. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 59, 651–681. Negi, N.P., Shrivastava, D.C., Sharma, V., Sarin, N.B., 2015. Overexpression of CuZnSOD from Arachis hypogaea alleviates salinity and drought stress in tobacco. Plant Cell Rep., http://dx.doi.org/10.1007/s00299-015-1770-4. Pagariya, M.C., Devarumath, R.M., Kawar, P.G., 2012. Biochemical characterization and identification of differentially expressed candidate genes in salt stressed sugarcane. Plant Sci. 184, 1–13. Park, S.C., Kim, Y.H., Jeong, J.C., Kim, C.Y., Lee, H.S., Bang, J.W., et al., 2011. Sweetpotato late embryogenesis abundant 14 (IbLEA14) gene influences lignification and increases osmotic- and salt stress-tolerance of transgenic calli. Planta 233, 621–634. Reguera, M., Bassil, E., Blumwald, E., 2014. Intracellular NHX-type cation/H+ antiporters in plants. Mol. Plant 7, 261–263. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 3, 1101–1108. Smirnoff, N., Cumbes, Q.J., 1989. Hydroxyl radical scavenging activity of compatible solutes. Phytochemistry 28, 1057–1060.

166

B. Wang et al. / Scientia Horticulturae 201 (2016) 153–166

Somal, T.L.C., Yapa, P.A.J., 1998. Accumulation of proline in cowpea under nutrient, drought, and saline stresses. J. Plant Nutr. 21, 2465–2473. Storey, R., Ahmad, N., Jones, R.G.W., 1977. Taxonomic and ecological aspects of the distribution of glycinebetaine and related compounds in plants. Oecologia 27, 319–332. Trinchant, J.C., Yang, Y.S., Rigaud, J., 1998. Proline accumulation inside symbiosomes of faba bean nodules under salt stress. Physiol. Plant. 104, 38–49. Wang, L.J., He, S.Z., Zhai, H., Liu, D.G., Wang, Y.N., Liu, Q.C., 2013. Molecular cloning and fanctional characterization of a salt tolerance-associated gene IbNFU1 from sweetpotato. J. Integr. Agric. 12, 27–35. Wang, W.B., Kim, Y.H., Lee, H.S., Kim, K.Y., Deng, X.P., Kwak, S.S., 2009. Analysis of antioxidant enzyme activity during germination of alfalfa under salt and drought stresses. Plant Physiol. Biochem. 47, 570–577. Wei, Q., Guo, Y.J., Cao, H.M., Kuai, B.K., 2011. Cloning and characterization of an AtNHX2-like Na+ /H+ antiporter gene from Ammopiptanthus mongolicus (Leguminosae) and its ectopic expression enhanced drought and salt tolerance in Arabidopsis thaliana. Plant Cell Tissue Organ Cult. 105, 309–316. Wu, C.A., Yang, G.D., Meng, Q.W., Zheng, C.C., 2004. The cotton GhNHX1 gene encoding a novel putative tonoplast Na+ /H+ antiporter plays an important role in salt stress. Plant Cell Physiol. 45, 600–607. Wu, C.X., Gao X. h. Kong, X.Q., Zhao, Y.X., Zhang, H., 2009. Molecular cloning and functional analysis of a Na+ /H+ antiporter gene ThNHX1 from a halophytic plant Thellungiella halophila. Plant Mol. Biol. Rep. 27, 1–12. Wu, G.Q., Xi, J.J., Wang, Q., Bao, A.K., Ma, Q., Zhang, J.L., Wang, S.M., 2011. The ZxNHX gene encoding tonoplast Na+ /H+ antiporter from the xerophyte Zygophyllum xanthoxylum plays important roles in response to salt and drought. J. Plant Physiol. 168, 758–767. Xiao, B.Z., Chen, X., Xiang, C.B., Tang, N., Zhang, Q.F., Xiong, L.Z., 2009. Evaluation of seven function-known candidate genes for their effects on improving drought resistance of transgenic rice under field conditions. Mol. Plant 2, 73–83. Xu, K., Hong, P., Luo, L.J., Xia, T., 2009. Overexpression of AtNHX1, a vacuolar Na+ /H+ antiporter from Arabidopsis thalina, in Petunia hybrida enhances salt and drought tolerance. J. Plant Biol. 52, 453–461. Yamaguchi, T., Hamamoto, S., Uozumi, N., 2013. Sodium transport system in plant cells. Front. Plant Sci. 4, 410.

Yang, S.J., Vanderbeld, B., Wan, J.X., Huang, Y.F., 2010. Narrowing down the targets: towards successful genetic engineering of drought-tolerant crops. Mol. Plant 3, 469–490. Yarra, R., He, S.J., Abbagani, S., Ma, B., Bulle, M., Zhang, W.K., 2012. Overexpression of a wheat Na+ /H+ antiporter gene (TaNHX2) enhances tolerance to salt stress in transgenic tomato plants (Solanum lycopersicum L.). Plant Cell Tissue Organ Cult. 111, 49–57. Yokoi, S., Quintero, F.J., Cubero, B., Ruiz, M.T., Bressan, R.A., Hasegawa, P.M., Pardo, J.M., 2002. Differential expression and function of Arabidopsis thaliana NHX Na+ /H+ antiporters in the salt stress response. Plant J. 30, 529–539. Yoshiba, Y., Kiyosue, T., Nakashima, K., Yamaguchi-Shinozaki, K., Shinozakj, K., 1997. Regulation of levels of proline as an osmolyte in plants under water stress. Plant Cell Physiol. 38, 1095–1102. Yu, B., Zhai, H., Wang, Y.P., Zang, N., He, S.Z., Liu, Q.C., 2007. Efficient Agrobacterium tumefaciens-mediated transformation using embryogenic suspension cultures in sweetpotato, Ipomoea batatas (L.) Lam. Plant Cell Tissue Organ Cult. 90, 265–273. Zang, N., Zhai, H., Gao, S., Chen, W., He, S.Z., Liu, Q.C., 2009. Efficient production of transgenic plants using the bar gene for herbicide resistance in sweetpotato. Sci. Hortic. 122, 649–653. Zou, J., Liu, C.F., Liu, A., Zou, D., Chen, X.B., 2012. Overexpression of OsHsp17.0 and OsHsp23.7 enhances drought and salt tolerance in rice. J. Plant Physiol. 169, 628–635. Zhao, Q., Zhang, H., Wang, T., Chen, S.X., Dai, S.J., 2013. Proteomics-based investigation of salt-responsive mechanisms in plant roots. J. Proteom. 82, 230–253. Zhang, H.X., Hodson, J.N., Williams, J.P., Blumwald, E., 2001. Engineering salt-tolerant Brassica plants: characterization of yield and seed oil quality in transgenic plants with increased vacuolar sodium accumulation. Proc. Natl. Acad. Sci. U. S. A. 98, 12832–12836. Zhang, H., Han, B., Wang, T., Chen, S., Li, H., Zhang, Y., Dai, S., 2012. Mechanisms of plant salt response: insights from proteomics. J. Proteome Res. 11, 49–67. Zhu, J.K., 2001. Plant salt tolerance. Trends Plant Sci. 6, 66–71. Zhu, J.K., 2002. Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biol. 53, 247–273.