- Email: [email protected]
A versatile plasmid expression vector for the production of biotinylated proteins by site-specific, enzymatic modification in Escherichia coli
Gene, 169 (1996) 59-64 ©1996 Elsevier Science B.V. All rights reserved. 0378-1119/96/$15.00
59
GENE 09465
A versatile plasmid expression vector for the production of biotinylated proteins by site-specific, enzymatic modification in Escherichia coli (Enzymatic biotinylation; biotin holoenzyme synthetase; BirA; maltose-binding protein; MalE; expression vector; affinity chromatography)
Kwei-Lan Tsao, Barbara DeBarbieri, Hanspeter Michel and David S. Waugh Roche Research Center, Nutley, NJ 07110, USA
Received by G.P. Livi: 13 May 1995; Accepted: 15 July 1995; Received at publishers: 16 October 1995
SUMMARY
A versatile plasmid vector was designed to direct the synthesis of recombinant proteins in either one of two forms that will be biotinylated in Escherichia coli with high efficiency at a single, unique site. The protein of interest can be produced with a peptide substrate for E. coli biotin holoenzyme synthetase (BirA)joined directly to its N terminus, or alternatively, as a fusion to the C terminus of a maltose-binding protein domain (MalE) with the peptide substrate on its N terminus. To maximize the yield of biotinylated protein, the vector is designed to express the substrate in a coupled translation arrangement with the enzyme.
INTRODUCTION
Escherichia coli biotin holoenzyme synthetase (BirA) catalyzes the covalent addition of biotin to the ~-amino group of a unique lysine side chain in its natural subCorrespondence to: Dr. D.S. Waugh, Department of Physical Chemistry, Roche Research Center, Hoffmann-La Roche Inc., 340 Kingsland Street, Nutley, NJ 07110, USA. Tel. (1-201) 235-2875; Fax (1-201) 235-22500; e-mail: [email protected]
Abbreviations: A, absorbance (1 cm); aa, amino acid(s); bio, peptide substrate for enzymatic biotinylation; BirA, biotin holoenzyme synthetase; birA, BirA-encoding gene; bla, 13-1actamase-encodinggene; bp, base pair(s); HRP, horseradish peroxidase; IPTG, isopropyl-l-thio-13-ogalactopyranoside; kb, kilobase(s) or 1000 bp; LacI, lactose repressor; lacI, LacI-encoding gene; lacI Q, overproducing promoter of lacl; LB broth, Luria-Bertani (medium); LC ESI-MS, liquid chromatography electrospray ionization mass spectrometry; MalE, maltose-binding protein; malE, MalE-encoding gene; nt, nucleotide(s); ORF, open reading frame; ori, origin of DNA replication; PAGE, polyacrylamide-gel electrophoresis; PCR, polymerase chain reaction; Pt,c, tre promoter; Raf55_132, aa 55-132 of human Raf kinase; RBS, ribosome-binding site(s); re-, recombinant; rop, repressor of primer gene from pBR322; rrnT, Rho-independent transcription terminator from rRNA operon T; SDS, sodium dodecyl sulfate; UTR, untranslated region(s); [], denotes plasmid-carrier state. SSDI 0378-1119(95)00762-8
strate, biotin carboxyl carrier protein (BCCP) (Cronan, 1990). A related, 13-aa consensus sequence defines the minimal substrate for this enzyme in vivo; tagging a recombinant (re-) protein at either end with such a peptide will cause it to be biotinylated in E. coli (Schatz, 1993). The biotin moiety can be used as an affinity handle to purify the protein on monomeric avidin resin (Kohanski and Lane, 1990). Moreover, the single biotin borne by each protein can be used to tether it to avidin or streptavidin coated surfaces for various purposes, such as the construction of a protein affinity column, the development of a scintillation proximity assay for drug screening, or for ligand binding experiments that utilize surface plasmon resonance technology. The chief advantage of this approach is that, unlike chemical reagents, enzymatic biotinylation assures that all molecules will be immobilized in a uniform, bioactive orientation. Here we describe the properties of a plasmid vector designed to direct the synthesis of biotinylated proteins in E. coll. In one mode, the vector can be used to join a peptide substrate for BirA directly to the N terminus of any protein. Alternatively, the protein of interest can be fused to the C terminus of a maltose-binding protein
60 domain (MalE) that carries the peptide substrate on its N terminus. One advantage of the latter arrangement is that it often will improve the solubility of a protein which has a tendency to aggregate when expressed directly. Moreover, because amylose resin costs less and binds more protein than monomeric avidin, and since essentially all of the re-protein is biotinylated in vivo (see below), biotinylated MalE fusion proteins can be purified more efficiently and economically on amylose resin.
EXPERIMENTAL AND DISCUSSION
(a) Vector design The structure of pDW363, a general expression vector designed to direct the synthesis of recombinant protein substrates for enzymatic biotinylation in a coupled translation arrangement with BirA, is illustrated schematically in Fig. 1A. Transcription of the malE and birA genes is regulated by a consensus E. coli promoter (Pt,c) in conjunction with a lac operator site. The nt sequence of the regulatory region is shown in Fig. lB. The 5' U T R of the IPTG-inducible transcript is a combination of sequences from the E. coli lacZ and bacteriophage T7 gene 10 leader regions. The first 24 codons in the IPTGinducible mRNA encode a peptide substrate for enzymatic biotinylation (Schatz, 1993). This peptide sequence can be joined directly to the N terminus of any protein by utilizing the unique XhoI site in pDW363 for cloning. In such cases, a suitable restriction protease recognition site (e.g., for Factor Xa) can be incorporated into the PCR primer used to amplify the ORF in a manner which will permit the biotin-peptide affinity tag to be cleaved from the protein after it has been purified. The peptide substrate for enzymatic biotinylation is followed, in-frame, by the ORF of the mature Male (without its N-terminal signal sequence). This feature permits a Male domain to be inserted between the peptide substrate for BirA and the protein of interest, if desired. The nt sequence surrounding the junction between the malE and birA genes in pDW363 is presented in Fig. 1C. The ORF of the Male domain is followed by a poly(Asn) linker, a canonical Factor Xa cleavage site and an XmnI site, just as it is in pMal-C2 (Maina et al., 1988). EcoRI and BamHI sites are situated near the XmnI site in pDW363 to facilitate the cloning of DNA fragments. pDW363 is designed so that when ORFs which terminate with a TAA codon are inserted between either the XhoI and BamHI or the XmnI and BamHI sites, this will give rise to a dicistronic mRNA wherein the first reading frame encodes a re-protein substrate for enzymatic biotinylation and the second reading frame encodes BirA. Such an arrangement is exemplified by the structure of pDW375 (Fig. 2). In conjunction with the BamHI site
(GGATCC), the TAA stop codon from the first reading frame creates a sequence (AGGA) that might serve as an internal RBS.
(b) Enzymatic biotinylation of re-protein substrates in E. coli To demonstrate the efficacy of our vector design, three derivatives of pDW363 were constructed and characterized: pDW375, pDW342 and pDW333. The IPTGinducible proteins they produce are illustrated schematically in Fig. 2. The Male domain was included in each of the model substrates to facilitate characterization of the reaction products (see below), pDW375 directs the synthesis of a dicistronic mRNA; the first reading frame encodes a MalE fusion protein with a peptide substrate for enzymatic biotinylation on its N terminus and aa 55-132 of human Raf kinase (Bonner et al., 1986)joined to its C terminus, and the second reading frame encodes BirA (Howard et al., 1985). pDW342 directs the synthesis of the same MalE-Rafs~_132 fusion protein with the peptide substrate for BirA on its N terminus, but not the enzyme. The MalE-Raf55_132 fusion protein encoded by pDW333, which also does not overproduce BirA, lacks a peptide substrate for BirA. Following induction with IPTG, samples of the total intracellular protein from E. coli cells harboring either pDW333, pDW342 or pDW375 were collected and analyzed by SDS-PAGE. The results are shown in Fig. 3A. All three vectors produce a large amount of IPTG-inducible MBP-Raf55_~32 fusion protein, although cells harboring pDW375 do not accumulate as much of the protein as do the other strains. This difference may reflect the fact that pDW333 and pDW342 utilize a T7 promoter instead of Pt,c. Another IPTG-inducible protein with the apparent molecular mass expected for BirA (approx. 34 kDa) is evident only in the cells that harbor pDW375. BirA is not overproduced to nearly the same degree as the substrate, but this is neither unexpected nor undesirable. It is not uncommon for the second reading frame to be expressed at low levels in artificial bicistronic mRNAs. Besides, the ideal vector would produce only as much BirA as is required to biotinylate all of the fusion protein in the cells, so that the balance of the cell's metabolic energy can be expended on the production of the fusion protein substrate. It will be shown below that pDW375 produces enough BirA to biotinylate all of the substrate in vivo. To determine which fusion proteins are biotinylated in vivo, samples of the total intracellular protein from these strains were blotted onto a nitrocellulose membrane after SDS-PAGE and probed with a streptavidin-HRP conjugate. The results of this experiment are shown in Fig. 3C. In cells harboring either pDW342 or pDW375, both of
61 XbaI
A MscI "--I
- - ! " % 1 #i
I .
B
StuI
XhoI
#~_ e~
i
pwvvooo
-35
: •
--.;.da,
gI
-10
/acopera~r
AGATCT~TTAATCATCCGGCTC~TGTGG'~'~G9%~6tG%A~C~XA~TtCCCTCTAGAA
XbaI
(Bg~I)
M
RBS ATAATTTTGTTTAACTTTAAGAAGGAGATATACAT
A
G
G
L
N
D
I
F
E
ATG GCT GGA GGC CTG AAC GAT ATT TTC GAA
Stul
A
Q
[]
I
E
W
H
E
D
T
G
G
S
S
K
I
E
E
G
GCT CAG AAA ATC GAA TGG CAC GAG GAC ACT GGT GGC TCG AGCIAAA ATC GAA GAA ~._GGT
XhoI
C
FactorXa , E G
R T,
malE
BirA s
E F G slM
K
0%
ATC GAG GGA )kGG ATT TCA GAA TT~ GGA TCC ATG AAG GAT AAC
biotin
!
"°°''4.
[
malE
'
"
,.-°'"
0
~
Fig. 1. Plasmid vector for the production of biotinylated proteins in E. coli. (A) Schematic illustration (not to scale), showing the approximate locations of the relevant genetic elements and some of the restriction sites. Except for BglII, all the indicated sites occur only once. (B) The nt sequence between the BgIII and XhoI sites in pDW363, which includes Pt,c, the 5' U TR of the mRNA, the bio ORF and the first 5 aa of MalE. The corresponding aa sequence is given in single letter code. The Lys that is biotinylated by BirA is indicated by the black box. The - 3 5 and - 10 consensus sequences which define Pt,c, the lac operator sequence, and a potential RBS near the Metstart codon are indicated. (C) The nt sequence surrounding the junction between the Male and BirA ORFs in pDW363. The locations of the unique XmnI, EcoRI and BamHI sites, and the Factor Xa site are indicated. pDW363 was constructed by standard recombinant DNA techniques and confirmed by dideoxy DNA sequencing (Sambrook et al., 1989). The nt sequence between the BglII and XhoI sites in panel B is of synthetic origin. The DNA between the MscI site and the BgllI site adjacent to the inducible promoter, which includes lacl, is from p E T l l d (Studier et al., 1991). The DNA between the HindIII and MscI sites, which includes bla, originates from pMal-C2 (Maina et al., 1988). The XhoI site in pDW363 was created by site-directed mutagenesis. The nt sequence between this site and the XmnI site in pDW363 is the same as that of the male gene in pMal-C2. The BirA ORF (Howard et al., 1985), which was amplified from E. coli B DNA (ATCC No. 11303) by PCR, is situated between the BamHI and HindIII sites in pDW363. The birA stop codon (TAA) is followed by and partially overlaps the HindII! site (TAAGCTT).
which encode MalE-Raf55_132 fusion proteins with a peptide substrate for BirA, there is a clear indication of biotinylated protein On the other hand, there is no evidence
of biotinylated protein in the strain that produces the fusion protein without an N-terminal peptide substrate for BirA. Hence, the peptide sequence is necessary and
62 1 2345
"F L TTC
CTG
D~ GAT
~M K
m~s TAA
GGA
TCC
........................... BamHI "'-,
ATG
AAG
D Iq GAT
D
/'~116'
AAC
45~
"~ 54
.... ...........
31 22
"4 M
~
43 29~ 18~" 141~ 6~
pDW375 C
biotin
~
1
45 ~.31D.22 ~14P-
pDW342
2
3
4
5
6
7
~
D
"
1 2345
ili!iii iiiiiiiiiiii!i!iiii!i!iiiiiiii!iiiiiiiiii!iiiii iii i iiiiiiii ii
7 -iiIi~i
W~#~r#55-132 I
pDW333 Fig. 2. IPTG-inducible proteins encoded by pDW375, pDW342 and pDW333. Also shown is the nt sequence surrounding the junction between the two ORFs in the pDW375 regulon and a potential RBS between them. All plasmids were constructed using standard recombinant DNA techniques and confirmed by dideoxy DNA sequencing (Sambrook et al., 1989). The construction of pDW333 has been described (Scheffler et al., 1994). pDW375 was constructed by ligating the NcoI-BamHI fragment of pDW333 that includes the Raf55 132 ORF and part of the malE gene with the NcoI-BamHI vector fragment of pDW363, pDW342 was constructed by ligating the XbaI-BamHI fragment of pDW375 that includes the ORF of the MalE-Rafss_la 2 fusion protein and the peptide substrate for BirA with the XbaI-BamHI vector fragment of pET3d (Studier et al., 1991).
sufficient to target this MalE fusion protein for biotinylation in vivo. The difference between the signal intensities observed in Fig. 3C, lanes 5 and 7, suggests that a larger fraction of the protein is biotinylated in cells that overproduce the enzyme along with the substrate than in cells which only produce the substrate, despite the fact that there is less fusion protein in the former strain than in the latter. This observation led us to investigate what fraction of the fusion protein substrate is biotinylated in each case. (c) Efficiency of biotinylation in vivo To determine what fraction of the re-protein substrate is biotinylated in cells harboring pDW342 or pDW375, some MalE-Raf55_132 fusion protein was purified from each strain by affinity chromatography on amylose resin and analyzed by LC ESI-MS. To serve as a standard for this experiment, a homogeneous sample of biotinylated fusion protein was obtained by capturing some of the protein from CT14 [pDW375] cells on monomeric avidin resin. In addition, a nearly homogeneous sample of the unreacted re-protein substrate was obtained by first isolating some fusion protein from CT14[pDW342] cells on amylose resin, and then extracting it repeatedly with
Fig. 3. SDS-PAGE of intracellular protein from E. coli cells producing MalE-Raf55_~32 fusion proteins (A and C) or mature DsbA with a peptide substrate for enzymatic biotinylation joined directly to its N terminus (B and D). (A) 0.1% SDS-12% PAGE stained with Coomassie brilliant blue. Lanes: 1, biotinylated molecular mass standards (BioRad); 2, CT14[pDW333] ( - I P T G ) ; 3, CT14[pDW333] (+IPTG); 4, CT14[pDW342] ( - I P T G ) ; 5, CT14[pDW342] (+IPTG); 6, CT14[-pDW375] ( - I P T G ) ; 7, CT14[pDW375] (+ IPTG). Sizes of the MalE fusion proteins (54 kDa) and BirA (34 kDa) are indicated. (B) 0.1% SDS-4-20% gradient PAGE stained with Coomassie brilliant blue: lanes: 1, biotinylated MalE-Raf55_~n; 2, low-range molecular mass standards (GIBCO-BRL); 3, CT14[pDW394] ( - I P T G ) ; 4, CT14[pDW394] (+IPTG); 5, soluble protein from CT141-pDW394] cells (+IPTG). ( C + D ) The gels in panels A and B were blotted onto nitrocellulose membranes and probed with a streptavidin-HRP conjugate. Methods: The DsbA ORF (Bardwell et al., 1991) was amplified from E. coli MG1655 genomic DNA by PCR, using the following primers: 5'-TAATAACTCGAGTGCGCAGTATGAAGATGGTAAACAGT and 5'-AATAATGGATCCTTATTTTTTCTCGGACAGATATTTCAC. The PCR fragment was cleaved with XhoI +BamHI, and then ligated with the XhoI-BamHI vector fragment of pDW363 to construct pDW394. Cultures of E. coli CT14 cells (Scheffler et al., 1994) containing either pDW333, pDW342, pDW375 or pDW394 were grown overnight from single colonies at 37°C in LB broth (Sambrook et al., 1989) supplemented with 50 p.M biotin and 100 ~tg ampicillin/ml. These cultures were diluted 100-fold in the same medium and grown to mid-log phase (A60o approx. 0.6), at which point IPTG was added to a final concentration of 1 mM. To prepare samples of total intracellular protein, 1 ml of cells was removed from the cultures before and 3 h after induction with IPTG, and the cells were pelleted at 14000 rpm in a microcentrifuge. The pellets were resuspended in 100 ~tl of SDS-PAGE sample buffer (Sambrook et al., 1989), heated at 90°C for 4 min, and then centrifuged again as above. The sample of soluble protein (DsbA) was prepared as described in the legend to Fig. 4. After SDS-PAGE, the gels were either stained with Coomassie brilliant blue or the protein was electroblotted onto a nitrocellulose membrane using a Bio-Rad TransBlot SD device at 20 V for 1 h. Following transfer, the membrane was blocked overnight at room temperature in 30 ml of TBS (Sambrook et al., 1989) containing 0.2% Tween-20 and 5% dry milk. Next, 30 ~tl of a streptavidin-HRP conjugate (Boehringer-Mannheim; 1089-153) was added, and the incubation continued for 1 h. The membrane was washed twice with TBS+Tween, and then once with TBS. The membrane was developed using the ECL Western Blotting detection system (Amersham), in accordance with the instructions of the manufacturer.
63 streptavidin agarose to remove the biotinylated form. The deconvoluted mass spectra are shown in Fig. 4. The major species in the nominally pure sample of unreacted fusion protein (which still contains a very small amount of the biotinylated species) was found to have an average molecular mass of 53 749 Da (Fig. 4A), which differs by only 13 Da from the predicted 53736 Da (N-terminal aa sequencing indicated that the initiator Met is removed by post-translational processing). This discrepancy is within the normal experimental variation for a protein of this size. The pure sample of biotinylated
I
^
53749
53973
B
53745
C
53200
I
53600
54000
54400 MW (Da)
Fig. 4. Analysis of the MalE-Raf55_~32 fusion proteins by LC ESI-MS. (A) A nominally pure sample of the unmodified (non-biotinylated) fusion protein. (B) A pure sample of the biotinylated fusion protein, purified by affinity chromatography on monomeric avidin resin. (C) A sample of the fusion protein from cells that do not overproduce BirA (CT14[pDW342]), purified by affinity chromatography on amylose resin. (D) A sample of the fusion protein from cells that overproduce BirA (CT14[-pDW375]), purified by affinity chromatography on amylose resin. Methods: l-liter cultures of E. coli CT14 cells containing either pDW333, pDW342 or pDW375 were grown and induced as described in the legend to Fig. 3. 3 h after induction, the cells were collected by centrifugation and resuspended in 10 ml of lysis buffer (20 mM Tris.HC1 pH 8.0/1 mM EDTA), on ice. The ice-cold cell suspensions were sonicated for 2 min to induce lysis, and then NaC1 was added to achieve a final concentration of 100 mM. Insoluble material was pelleted by centrifugation at 20 000 × g for 15 min, and then the fusion proteins were purified by affinity chromatography using either amylose (New England Biolabs) or Soft-Link monomeric avidin (Promega) resins in batch mode, in accordance with the instructions provided by the manufacturers. After elution from the resin, the proteins were dialyzed exhaustively in H20. For LC ESI-MS analysis, the affinitypurified proteins were diluted with H20 and 1 ~tl (approx. 5 pmol) was added onto a micro-capillary column (100 Ixm x 15 cm) packed with a Poros RH2 reverse-phase resin (PerSeptive Biosystems). The column was washed with 0.5% (v/v) acetic acid in H20. The protein was eluted directly into the electrospray ionization source with a gradient of acetonitrile, and molecular mass was recorded on-line with a triple quadrupole mass spectrometer (Finnigan-Mat TSQ700). Original spectra were deconvoluted using the manufacturer's software. Quantitation was done by comparing the peak areas in the deconvoluted spectra. More detailed experimental conditions were described previously (Hunt et al., 1991).
fusion protein was found to have a molecular mass of 53 973 Da (Fig. 4B). The difference between this value and the molecular mass of the unreacted substrate (224 Da) is almost exactly what is predicted for the addition of a single biotin moiety to a Lys side chain in the protein (226 Da). In the sample of affinity-purified protein isolated from CT14 [pDW342] cells, which do not overproduce BirA, two distinct species were detected by LC ESI-MS with average molecular masses of 53 745 and 53 973 Da (Fig. 4C). These values are in good agreement with those in the control samples (Fig. 4A,B). Thus, this preparation of protein evidently is a mixture of the unreacted substrate and the biotinylated fusion protein. From the areas under the two peaks in the deconvoluted spectrum, it appears that about 13% of the fusion protein is biotinylated in CT14[pDW342] cells. On the other hand, only a single species was observed in the sample of protein isolated from CT14[pDW375] cells (Fig. 4D), with an average molecular mass (53 973 Da) that corresponds to the biotinylated form of the fusion protein. Hence, even a modest degree of BirA overproduction (Fig. 3A) is sufficient to biotinate all of a highly-expressed fusion protein substrate in vivo.
(d) Biotinylation of re-proteins without an intervening MalE domain pDW363 also can be used to couple the peptide substrate for BirA directly to the N terminus of a re-protein. A representative example is shown in Fig. 3B. In this instance, the vector (pDW394) directs the synthesis of mature DsbA (Bardwell et al., 1991) with the peptide substrate attached to its N terminus. A large amount of a protein with the anticipated molecular mass (approx. 24kDa) accumulates in CT14[pDW394] cells upon induction with IPTG (lane 4), and virtually all of this material is soluble in the crude cell extract (lane 5). Thus, the peptide substrate does not interfere with the solubility of DsbA. A Western blot (Fig. 3D), reveals that at least some of this re-DsbA is biotinylated in vivo. In fact, as was the case with the MalE-Raf55_132 fusion protein produced by pDW375, essentially all of the re-DsbA can be captured on monomeric avidin resin (data not shown). The absence of any immunoreactive species other than full length DsbA is noteworthy, as this suggests that the peptide tag does not target DsbA for proteolytic degradation. Similar results were obtained when the peptide sequence was joined directly to the N terminus of E. coli DsbC and human cyclin H (data not shown). (e) Conclusions (1) The vector we have described can be modified to produce any re-protein in either of two forms that will be biotinylated at a unique site in vivo with high
64 efficiency. In one configuration, the re-protein can be produced with a peptide substrate for enzymatic biotinylation joined directly to its N terminus. Alternatively, it can be synthesized as a C-terminal extension of a MalE domain with the peptide substrate on its N terminus. (2) The biotin moiety can be used as an affinity handle to purify the protein on monomeric avidin resin. However, since essentially all of the re-protein is biotinylated in vivo when the enzyme is overproduced along with the substrate, if the MalE domain is also present then the biotinylated protein can be purified more efficiently on amylose resin instead. (3) Unless a free N terminus is essential for its activity, the unique biotin can be used to anchor the re-protein to avidin or streptavidin coated surfaces for various types of ligand binding experiments. This approach is likely to result in the highest possible specific activity, because enzymatic biotinylation ensures that every molecule will be immobilized in the same orientation. ACKNOWLEDGEMENTS
We thank D. Ciolek, K. Hollfelder and Y.-C. Pan for protein sequencing and aa analysis, and E. RiosFredrickson for assistance with the preparation of this manuscript.
REFERENCES Bardwell, J.C.A., McGovern, K. and Beckwith, J.: Identification of a protein required for disulfide bond formation in vivo. Cell 67 (1991) 581-589.
Bonner, T.I., Oppermann, H., Seeburg, P., Kerby, S.B., Gunnell, M.A., Young, A.C. and Rapp, U.R.: The complete coding sequence of the human raf oncogene and the corresponding structure of the c-raf-1 gene. Nucleic Acids Res. 14 (1986) 1009-1015. Cronan, J.E.: Biotinylation of proteins in vivo: a post-translational modification to label, purify and study proteins. J. Biol. Chem. 265 (1990) 10327 10333. Howard, P.K., Shaw, J. and Otsuka, A.J.: Nucleotide sequence of the BirA gene encoding the biotin operon repressor and biotin holoenzyme synthetase functions of Escherichia coll. Gene 35 (1985) 321 331. Hunt, D.F., Alexander, J.E., McCormack, A.L., Martino, P.A., Michel, H., Shabanowitz, J., Sherman, N., Moseley, M.A., Jorgenson, J.W. and Tomer, K.B.: Mass spectrometric methods for protein and peptide sequence analysis. In: Villafranca, J.J. (Ed.), Techniques in Protein Chemistry II. Academic Press, San Diego, CA, 1991, pp. 441-454. Kohanski, R.A. and Lane, M.D.: Monovalent avidin affinity columns. Methods Enzymol. 184 (1990) 194-200. Laemmli, U.K.: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 (1970) 680-685. Maina, C.V., Riggs, P.D., Grandea, A.G., Slatko, B.E., Moran, L.S., Tagliamonte, J.A., McReynolds, L.A. and Guan, C.: A vector to express and purify foreign proteins in Escherichia coli by fusion to, and separation from, maltose binding protein. Gene 74 (1988) 365 373. Sambrook, J., Fritsch, E.F. and Maniatis, T.: Molecular Cloning. A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. Schatz, P.J.: Use of peptide libraries to map the substrate specificity of a peptide-modifying enzyme: a 13 residue consensus peptide specifies biotinylation in Escherichia coli. Bio/Technology 11 (1993) 1138 1143. Schemer, J.E., Waugh, D.S., Bekesi, E., Kiefer, S.E., LoSardo, J.E., Neri, A., Prinzo, K.M., Tsao, K.-L., Wegrzynski, B., Emerson, S.D. and Fry, D.C.: Characterization of a 78-residue fragment of c-Raf-1 that comprises a minimal binding domain for the interaction with RasGTP. J. Biol. Chem. 269 (1994) 22340-22346. Studier, F.W., Rosenberg, A.H., Dunn, J.J. and Dubendorff, J.W.: Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185 (1990) 60-89.
59
GENE 09465
A versatile plasmid expression vector for the production of biotinylated proteins by site-specific, enzymatic modification in Escherichia coli (Enzymatic biotinylation; biotin holoenzyme synthetase; BirA; maltose-binding protein; MalE; expression vector; affinity chromatography)
Kwei-Lan Tsao, Barbara DeBarbieri, Hanspeter Michel and David S. Waugh Roche Research Center, Nutley, NJ 07110, USA
Received by G.P. Livi: 13 May 1995; Accepted: 15 July 1995; Received at publishers: 16 October 1995
SUMMARY
A versatile plasmid vector was designed to direct the synthesis of recombinant proteins in either one of two forms that will be biotinylated in Escherichia coli with high efficiency at a single, unique site. The protein of interest can be produced with a peptide substrate for E. coli biotin holoenzyme synthetase (BirA)joined directly to its N terminus, or alternatively, as a fusion to the C terminus of a maltose-binding protein domain (MalE) with the peptide substrate on its N terminus. To maximize the yield of biotinylated protein, the vector is designed to express the substrate in a coupled translation arrangement with the enzyme.
INTRODUCTION
Escherichia coli biotin holoenzyme synthetase (BirA) catalyzes the covalent addition of biotin to the ~-amino group of a unique lysine side chain in its natural subCorrespondence to: Dr. D.S. Waugh, Department of Physical Chemistry, Roche Research Center, Hoffmann-La Roche Inc., 340 Kingsland Street, Nutley, NJ 07110, USA. Tel. (1-201) 235-2875; Fax (1-201) 235-22500; e-mail: [email protected]
Abbreviations: A, absorbance (1 cm); aa, amino acid(s); bio, peptide substrate for enzymatic biotinylation; BirA, biotin holoenzyme synthetase; birA, BirA-encoding gene; bla, 13-1actamase-encodinggene; bp, base pair(s); HRP, horseradish peroxidase; IPTG, isopropyl-l-thio-13-ogalactopyranoside; kb, kilobase(s) or 1000 bp; LacI, lactose repressor; lacI, LacI-encoding gene; lacI Q, overproducing promoter of lacl; LB broth, Luria-Bertani (medium); LC ESI-MS, liquid chromatography electrospray ionization mass spectrometry; MalE, maltose-binding protein; malE, MalE-encoding gene; nt, nucleotide(s); ORF, open reading frame; ori, origin of DNA replication; PAGE, polyacrylamide-gel electrophoresis; PCR, polymerase chain reaction; Pt,c, tre promoter; Raf55_132, aa 55-132 of human Raf kinase; RBS, ribosome-binding site(s); re-, recombinant; rop, repressor of primer gene from pBR322; rrnT, Rho-independent transcription terminator from rRNA operon T; SDS, sodium dodecyl sulfate; UTR, untranslated region(s); [], denotes plasmid-carrier state. SSDI 0378-1119(95)00762-8
strate, biotin carboxyl carrier protein (BCCP) (Cronan, 1990). A related, 13-aa consensus sequence defines the minimal substrate for this enzyme in vivo; tagging a recombinant (re-) protein at either end with such a peptide will cause it to be biotinylated in E. coli (Schatz, 1993). The biotin moiety can be used as an affinity handle to purify the protein on monomeric avidin resin (Kohanski and Lane, 1990). Moreover, the single biotin borne by each protein can be used to tether it to avidin or streptavidin coated surfaces for various purposes, such as the construction of a protein affinity column, the development of a scintillation proximity assay for drug screening, or for ligand binding experiments that utilize surface plasmon resonance technology. The chief advantage of this approach is that, unlike chemical reagents, enzymatic biotinylation assures that all molecules will be immobilized in a uniform, bioactive orientation. Here we describe the properties of a plasmid vector designed to direct the synthesis of biotinylated proteins in E. coll. In one mode, the vector can be used to join a peptide substrate for BirA directly to the N terminus of any protein. Alternatively, the protein of interest can be fused to the C terminus of a maltose-binding protein
60 domain (MalE) that carries the peptide substrate on its N terminus. One advantage of the latter arrangement is that it often will improve the solubility of a protein which has a tendency to aggregate when expressed directly. Moreover, because amylose resin costs less and binds more protein than monomeric avidin, and since essentially all of the re-protein is biotinylated in vivo (see below), biotinylated MalE fusion proteins can be purified more efficiently and economically on amylose resin.
EXPERIMENTAL AND DISCUSSION
(a) Vector design The structure of pDW363, a general expression vector designed to direct the synthesis of recombinant protein substrates for enzymatic biotinylation in a coupled translation arrangement with BirA, is illustrated schematically in Fig. 1A. Transcription of the malE and birA genes is regulated by a consensus E. coli promoter (Pt,c) in conjunction with a lac operator site. The nt sequence of the regulatory region is shown in Fig. lB. The 5' U T R of the IPTG-inducible transcript is a combination of sequences from the E. coli lacZ and bacteriophage T7 gene 10 leader regions. The first 24 codons in the IPTGinducible mRNA encode a peptide substrate for enzymatic biotinylation (Schatz, 1993). This peptide sequence can be joined directly to the N terminus of any protein by utilizing the unique XhoI site in pDW363 for cloning. In such cases, a suitable restriction protease recognition site (e.g., for Factor Xa) can be incorporated into the PCR primer used to amplify the ORF in a manner which will permit the biotin-peptide affinity tag to be cleaved from the protein after it has been purified. The peptide substrate for enzymatic biotinylation is followed, in-frame, by the ORF of the mature Male (without its N-terminal signal sequence). This feature permits a Male domain to be inserted between the peptide substrate for BirA and the protein of interest, if desired. The nt sequence surrounding the junction between the malE and birA genes in pDW363 is presented in Fig. 1C. The ORF of the Male domain is followed by a poly(Asn) linker, a canonical Factor Xa cleavage site and an XmnI site, just as it is in pMal-C2 (Maina et al., 1988). EcoRI and BamHI sites are situated near the XmnI site in pDW363 to facilitate the cloning of DNA fragments. pDW363 is designed so that when ORFs which terminate with a TAA codon are inserted between either the XhoI and BamHI or the XmnI and BamHI sites, this will give rise to a dicistronic mRNA wherein the first reading frame encodes a re-protein substrate for enzymatic biotinylation and the second reading frame encodes BirA. Such an arrangement is exemplified by the structure of pDW375 (Fig. 2). In conjunction with the BamHI site
(GGATCC), the TAA stop codon from the first reading frame creates a sequence (AGGA) that might serve as an internal RBS.
(b) Enzymatic biotinylation of re-protein substrates in E. coli To demonstrate the efficacy of our vector design, three derivatives of pDW363 were constructed and characterized: pDW375, pDW342 and pDW333. The IPTGinducible proteins they produce are illustrated schematically in Fig. 2. The Male domain was included in each of the model substrates to facilitate characterization of the reaction products (see below), pDW375 directs the synthesis of a dicistronic mRNA; the first reading frame encodes a MalE fusion protein with a peptide substrate for enzymatic biotinylation on its N terminus and aa 55-132 of human Raf kinase (Bonner et al., 1986)joined to its C terminus, and the second reading frame encodes BirA (Howard et al., 1985). pDW342 directs the synthesis of the same MalE-Rafs~_132 fusion protein with the peptide substrate for BirA on its N terminus, but not the enzyme. The MalE-Raf55_132 fusion protein encoded by pDW333, which also does not overproduce BirA, lacks a peptide substrate for BirA. Following induction with IPTG, samples of the total intracellular protein from E. coli cells harboring either pDW333, pDW342 or pDW375 were collected and analyzed by SDS-PAGE. The results are shown in Fig. 3A. All three vectors produce a large amount of IPTG-inducible MBP-Raf55_~32 fusion protein, although cells harboring pDW375 do not accumulate as much of the protein as do the other strains. This difference may reflect the fact that pDW333 and pDW342 utilize a T7 promoter instead of Pt,c. Another IPTG-inducible protein with the apparent molecular mass expected for BirA (approx. 34 kDa) is evident only in the cells that harbor pDW375. BirA is not overproduced to nearly the same degree as the substrate, but this is neither unexpected nor undesirable. It is not uncommon for the second reading frame to be expressed at low levels in artificial bicistronic mRNAs. Besides, the ideal vector would produce only as much BirA as is required to biotinylate all of the fusion protein in the cells, so that the balance of the cell's metabolic energy can be expended on the production of the fusion protein substrate. It will be shown below that pDW375 produces enough BirA to biotinylate all of the substrate in vivo. To determine which fusion proteins are biotinylated in vivo, samples of the total intracellular protein from these strains were blotted onto a nitrocellulose membrane after SDS-PAGE and probed with a streptavidin-HRP conjugate. The results of this experiment are shown in Fig. 3C. In cells harboring either pDW342 or pDW375, both of
61 XbaI
A MscI "--I
- - ! " % 1 #i
I .
B
StuI
XhoI
#~_ e~
i
pwvvooo
-35
: •
--.;.da,
gI
-10
/acopera~r
AGATCT~TTAATCATCCGGCTC~TGTGG'~'~G9%~6tG%A~C~XA~TtCCCTCTAGAA
XbaI
(Bg~I)
M
RBS ATAATTTTGTTTAACTTTAAGAAGGAGATATACAT
A
G
G
L
N
D
I
F
E
ATG GCT GGA GGC CTG AAC GAT ATT TTC GAA
Stul
A
Q
[]
I
E
W
H
E
D
T
G
G
S
S
K
I
E
E
G
GCT CAG AAA ATC GAA TGG CAC GAG GAC ACT GGT GGC TCG AGCIAAA ATC GAA GAA ~._GGT
XhoI
C
FactorXa , E G
R T,
malE
BirA s
E F G slM
K
0%
ATC GAG GGA )kGG ATT TCA GAA TT~ GGA TCC ATG AAG GAT AAC
biotin
!
"°°''4.
[
malE
'
"
,.-°'"
0
~
Fig. 1. Plasmid vector for the production of biotinylated proteins in E. coli. (A) Schematic illustration (not to scale), showing the approximate locations of the relevant genetic elements and some of the restriction sites. Except for BglII, all the indicated sites occur only once. (B) The nt sequence between the BgIII and XhoI sites in pDW363, which includes Pt,c, the 5' U TR of the mRNA, the bio ORF and the first 5 aa of MalE. The corresponding aa sequence is given in single letter code. The Lys that is biotinylated by BirA is indicated by the black box. The - 3 5 and - 10 consensus sequences which define Pt,c, the lac operator sequence, and a potential RBS near the Metstart codon are indicated. (C) The nt sequence surrounding the junction between the Male and BirA ORFs in pDW363. The locations of the unique XmnI, EcoRI and BamHI sites, and the Factor Xa site are indicated. pDW363 was constructed by standard recombinant DNA techniques and confirmed by dideoxy DNA sequencing (Sambrook et al., 1989). The nt sequence between the BglII and XhoI sites in panel B is of synthetic origin. The DNA between the MscI site and the BgllI site adjacent to the inducible promoter, which includes lacl, is from p E T l l d (Studier et al., 1991). The DNA between the HindIII and MscI sites, which includes bla, originates from pMal-C2 (Maina et al., 1988). The XhoI site in pDW363 was created by site-directed mutagenesis. The nt sequence between this site and the XmnI site in pDW363 is the same as that of the male gene in pMal-C2. The BirA ORF (Howard et al., 1985), which was amplified from E. coli B DNA (ATCC No. 11303) by PCR, is situated between the BamHI and HindIII sites in pDW363. The birA stop codon (TAA) is followed by and partially overlaps the HindII! site (TAAGCTT).
which encode MalE-Raf55_132 fusion proteins with a peptide substrate for BirA, there is a clear indication of biotinylated protein On the other hand, there is no evidence
of biotinylated protein in the strain that produces the fusion protein without an N-terminal peptide substrate for BirA. Hence, the peptide sequence is necessary and
62 1 2345
"F L TTC
CTG
D~ GAT
~M K
m~s TAA
GGA
TCC
........................... BamHI "'-,
ATG
AAG
D Iq GAT
D
/'~116'
AAC
45~
"~ 54
.... ...........
31 22
"4 M
~
43 29~ 18~" 141~ 6~
pDW375 C
biotin
~
1
45 ~.31D.22 ~14P-
pDW342
2
3
4
5
6
7
~
D
"
1 2345
ili!iii iiiiiiiiiiii!i!iiii!i!iiiiiiii!iiiiiiiiii!iiiii iii i iiiiiiii ii
7 -iiIi~i
W~#~r#55-132 I
pDW333 Fig. 2. IPTG-inducible proteins encoded by pDW375, pDW342 and pDW333. Also shown is the nt sequence surrounding the junction between the two ORFs in the pDW375 regulon and a potential RBS between them. All plasmids were constructed using standard recombinant DNA techniques and confirmed by dideoxy DNA sequencing (Sambrook et al., 1989). The construction of pDW333 has been described (Scheffler et al., 1994). pDW375 was constructed by ligating the NcoI-BamHI fragment of pDW333 that includes the Raf55 132 ORF and part of the malE gene with the NcoI-BamHI vector fragment of pDW363, pDW342 was constructed by ligating the XbaI-BamHI fragment of pDW375 that includes the ORF of the MalE-Rafss_la 2 fusion protein and the peptide substrate for BirA with the XbaI-BamHI vector fragment of pET3d (Studier et al., 1991).
sufficient to target this MalE fusion protein for biotinylation in vivo. The difference between the signal intensities observed in Fig. 3C, lanes 5 and 7, suggests that a larger fraction of the protein is biotinylated in cells that overproduce the enzyme along with the substrate than in cells which only produce the substrate, despite the fact that there is less fusion protein in the former strain than in the latter. This observation led us to investigate what fraction of the fusion protein substrate is biotinylated in each case. (c) Efficiency of biotinylation in vivo To determine what fraction of the re-protein substrate is biotinylated in cells harboring pDW342 or pDW375, some MalE-Raf55_132 fusion protein was purified from each strain by affinity chromatography on amylose resin and analyzed by LC ESI-MS. To serve as a standard for this experiment, a homogeneous sample of biotinylated fusion protein was obtained by capturing some of the protein from CT14 [pDW375] cells on monomeric avidin resin. In addition, a nearly homogeneous sample of the unreacted re-protein substrate was obtained by first isolating some fusion protein from CT14[pDW342] cells on amylose resin, and then extracting it repeatedly with
Fig. 3. SDS-PAGE of intracellular protein from E. coli cells producing MalE-Raf55_~32 fusion proteins (A and C) or mature DsbA with a peptide substrate for enzymatic biotinylation joined directly to its N terminus (B and D). (A) 0.1% SDS-12% PAGE stained with Coomassie brilliant blue. Lanes: 1, biotinylated molecular mass standards (BioRad); 2, CT14[pDW333] ( - I P T G ) ; 3, CT14[pDW333] (+IPTG); 4, CT14[pDW342] ( - I P T G ) ; 5, CT14[pDW342] (+IPTG); 6, CT14[-pDW375] ( - I P T G ) ; 7, CT14[pDW375] (+ IPTG). Sizes of the MalE fusion proteins (54 kDa) and BirA (34 kDa) are indicated. (B) 0.1% SDS-4-20% gradient PAGE stained with Coomassie brilliant blue: lanes: 1, biotinylated MalE-Raf55_~n; 2, low-range molecular mass standards (GIBCO-BRL); 3, CT14[pDW394] ( - I P T G ) ; 4, CT14[pDW394] (+IPTG); 5, soluble protein from CT141-pDW394] cells (+IPTG). ( C + D ) The gels in panels A and B were blotted onto nitrocellulose membranes and probed with a streptavidin-HRP conjugate. Methods: The DsbA ORF (Bardwell et al., 1991) was amplified from E. coli MG1655 genomic DNA by PCR, using the following primers: 5'-TAATAACTCGAGTGCGCAGTATGAAGATGGTAAACAGT and 5'-AATAATGGATCCTTATTTTTTCTCGGACAGATATTTCAC. The PCR fragment was cleaved with XhoI +BamHI, and then ligated with the XhoI-BamHI vector fragment of pDW363 to construct pDW394. Cultures of E. coli CT14 cells (Scheffler et al., 1994) containing either pDW333, pDW342, pDW375 or pDW394 were grown overnight from single colonies at 37°C in LB broth (Sambrook et al., 1989) supplemented with 50 p.M biotin and 100 ~tg ampicillin/ml. These cultures were diluted 100-fold in the same medium and grown to mid-log phase (A60o approx. 0.6), at which point IPTG was added to a final concentration of 1 mM. To prepare samples of total intracellular protein, 1 ml of cells was removed from the cultures before and 3 h after induction with IPTG, and the cells were pelleted at 14000 rpm in a microcentrifuge. The pellets were resuspended in 100 ~tl of SDS-PAGE sample buffer (Sambrook et al., 1989), heated at 90°C for 4 min, and then centrifuged again as above. The sample of soluble protein (DsbA) was prepared as described in the legend to Fig. 4. After SDS-PAGE, the gels were either stained with Coomassie brilliant blue or the protein was electroblotted onto a nitrocellulose membrane using a Bio-Rad TransBlot SD device at 20 V for 1 h. Following transfer, the membrane was blocked overnight at room temperature in 30 ml of TBS (Sambrook et al., 1989) containing 0.2% Tween-20 and 5% dry milk. Next, 30 ~tl of a streptavidin-HRP conjugate (Boehringer-Mannheim; 1089-153) was added, and the incubation continued for 1 h. The membrane was washed twice with TBS+Tween, and then once with TBS. The membrane was developed using the ECL Western Blotting detection system (Amersham), in accordance with the instructions of the manufacturer.
63 streptavidin agarose to remove the biotinylated form. The deconvoluted mass spectra are shown in Fig. 4. The major species in the nominally pure sample of unreacted fusion protein (which still contains a very small amount of the biotinylated species) was found to have an average molecular mass of 53 749 Da (Fig. 4A), which differs by only 13 Da from the predicted 53736 Da (N-terminal aa sequencing indicated that the initiator Met is removed by post-translational processing). This discrepancy is within the normal experimental variation for a protein of this size. The pure sample of biotinylated
I
^
53749
53973
B
53745
C
53200
I
53600
54000
54400 MW (Da)
Fig. 4. Analysis of the MalE-Raf55_~32 fusion proteins by LC ESI-MS. (A) A nominally pure sample of the unmodified (non-biotinylated) fusion protein. (B) A pure sample of the biotinylated fusion protein, purified by affinity chromatography on monomeric avidin resin. (C) A sample of the fusion protein from cells that do not overproduce BirA (CT14[pDW342]), purified by affinity chromatography on amylose resin. (D) A sample of the fusion protein from cells that overproduce BirA (CT14[-pDW375]), purified by affinity chromatography on amylose resin. Methods: l-liter cultures of E. coli CT14 cells containing either pDW333, pDW342 or pDW375 were grown and induced as described in the legend to Fig. 3. 3 h after induction, the cells were collected by centrifugation and resuspended in 10 ml of lysis buffer (20 mM Tris.HC1 pH 8.0/1 mM EDTA), on ice. The ice-cold cell suspensions were sonicated for 2 min to induce lysis, and then NaC1 was added to achieve a final concentration of 100 mM. Insoluble material was pelleted by centrifugation at 20 000 × g for 15 min, and then the fusion proteins were purified by affinity chromatography using either amylose (New England Biolabs) or Soft-Link monomeric avidin (Promega) resins in batch mode, in accordance with the instructions provided by the manufacturers. After elution from the resin, the proteins were dialyzed exhaustively in H20. For LC ESI-MS analysis, the affinitypurified proteins were diluted with H20 and 1 ~tl (approx. 5 pmol) was added onto a micro-capillary column (100 Ixm x 15 cm) packed with a Poros RH2 reverse-phase resin (PerSeptive Biosystems). The column was washed with 0.5% (v/v) acetic acid in H20. The protein was eluted directly into the electrospray ionization source with a gradient of acetonitrile, and molecular mass was recorded on-line with a triple quadrupole mass spectrometer (Finnigan-Mat TSQ700). Original spectra were deconvoluted using the manufacturer's software. Quantitation was done by comparing the peak areas in the deconvoluted spectra. More detailed experimental conditions were described previously (Hunt et al., 1991).
fusion protein was found to have a molecular mass of 53 973 Da (Fig. 4B). The difference between this value and the molecular mass of the unreacted substrate (224 Da) is almost exactly what is predicted for the addition of a single biotin moiety to a Lys side chain in the protein (226 Da). In the sample of affinity-purified protein isolated from CT14 [pDW342] cells, which do not overproduce BirA, two distinct species were detected by LC ESI-MS with average molecular masses of 53 745 and 53 973 Da (Fig. 4C). These values are in good agreement with those in the control samples (Fig. 4A,B). Thus, this preparation of protein evidently is a mixture of the unreacted substrate and the biotinylated fusion protein. From the areas under the two peaks in the deconvoluted spectrum, it appears that about 13% of the fusion protein is biotinylated in CT14[pDW342] cells. On the other hand, only a single species was observed in the sample of protein isolated from CT14[pDW375] cells (Fig. 4D), with an average molecular mass (53 973 Da) that corresponds to the biotinylated form of the fusion protein. Hence, even a modest degree of BirA overproduction (Fig. 3A) is sufficient to biotinate all of a highly-expressed fusion protein substrate in vivo.
(d) Biotinylation of re-proteins without an intervening MalE domain pDW363 also can be used to couple the peptide substrate for BirA directly to the N terminus of a re-protein. A representative example is shown in Fig. 3B. In this instance, the vector (pDW394) directs the synthesis of mature DsbA (Bardwell et al., 1991) with the peptide substrate attached to its N terminus. A large amount of a protein with the anticipated molecular mass (approx. 24kDa) accumulates in CT14[pDW394] cells upon induction with IPTG (lane 4), and virtually all of this material is soluble in the crude cell extract (lane 5). Thus, the peptide substrate does not interfere with the solubility of DsbA. A Western blot (Fig. 3D), reveals that at least some of this re-DsbA is biotinylated in vivo. In fact, as was the case with the MalE-Raf55_132 fusion protein produced by pDW375, essentially all of the re-DsbA can be captured on monomeric avidin resin (data not shown). The absence of any immunoreactive species other than full length DsbA is noteworthy, as this suggests that the peptide tag does not target DsbA for proteolytic degradation. Similar results were obtained when the peptide sequence was joined directly to the N terminus of E. coli DsbC and human cyclin H (data not shown). (e) Conclusions (1) The vector we have described can be modified to produce any re-protein in either of two forms that will be biotinylated at a unique site in vivo with high
64 efficiency. In one configuration, the re-protein can be produced with a peptide substrate for enzymatic biotinylation joined directly to its N terminus. Alternatively, it can be synthesized as a C-terminal extension of a MalE domain with the peptide substrate on its N terminus. (2) The biotin moiety can be used as an affinity handle to purify the protein on monomeric avidin resin. However, since essentially all of the re-protein is biotinylated in vivo when the enzyme is overproduced along with the substrate, if the MalE domain is also present then the biotinylated protein can be purified more efficiently on amylose resin instead. (3) Unless a free N terminus is essential for its activity, the unique biotin can be used to anchor the re-protein to avidin or streptavidin coated surfaces for various types of ligand binding experiments. This approach is likely to result in the highest possible specific activity, because enzymatic biotinylation ensures that every molecule will be immobilized in the same orientation. ACKNOWLEDGEMENTS
We thank D. Ciolek, K. Hollfelder and Y.-C. Pan for protein sequencing and aa analysis, and E. RiosFredrickson for assistance with the preparation of this manuscript.
REFERENCES Bardwell, J.C.A., McGovern, K. and Beckwith, J.: Identification of a protein required for disulfide bond formation in vivo. Cell 67 (1991) 581-589.
Bonner, T.I., Oppermann, H., Seeburg, P., Kerby, S.B., Gunnell, M.A., Young, A.C. and Rapp, U.R.: The complete coding sequence of the human raf oncogene and the corresponding structure of the c-raf-1 gene. Nucleic Acids Res. 14 (1986) 1009-1015. Cronan, J.E.: Biotinylation of proteins in vivo: a post-translational modification to label, purify and study proteins. J. Biol. Chem. 265 (1990) 10327 10333. Howard, P.K., Shaw, J. and Otsuka, A.J.: Nucleotide sequence of the BirA gene encoding the biotin operon repressor and biotin holoenzyme synthetase functions of Escherichia coll. Gene 35 (1985) 321 331. Hunt, D.F., Alexander, J.E., McCormack, A.L., Martino, P.A., Michel, H., Shabanowitz, J., Sherman, N., Moseley, M.A., Jorgenson, J.W. and Tomer, K.B.: Mass spectrometric methods for protein and peptide sequence analysis. In: Villafranca, J.J. (Ed.), Techniques in Protein Chemistry II. Academic Press, San Diego, CA, 1991, pp. 441-454. Kohanski, R.A. and Lane, M.D.: Monovalent avidin affinity columns. Methods Enzymol. 184 (1990) 194-200. Laemmli, U.K.: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 (1970) 680-685. Maina, C.V., Riggs, P.D., Grandea, A.G., Slatko, B.E., Moran, L.S., Tagliamonte, J.A., McReynolds, L.A. and Guan, C.: A vector to express and purify foreign proteins in Escherichia coli by fusion to, and separation from, maltose binding protein. Gene 74 (1988) 365 373. Sambrook, J., Fritsch, E.F. and Maniatis, T.: Molecular Cloning. A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. Schatz, P.J.: Use of peptide libraries to map the substrate specificity of a peptide-modifying enzyme: a 13 residue consensus peptide specifies biotinylation in Escherichia coli. Bio/Technology 11 (1993) 1138 1143. Schemer, J.E., Waugh, D.S., Bekesi, E., Kiefer, S.E., LoSardo, J.E., Neri, A., Prinzo, K.M., Tsao, K.-L., Wegrzynski, B., Emerson, S.D. and Fry, D.C.: Characterization of a 78-residue fragment of c-Raf-1 that comprises a minimal binding domain for the interaction with RasGTP. J. Biol. Chem. 269 (1994) 22340-22346. Studier, F.W., Rosenberg, A.H., Dunn, J.J. and Dubendorff, J.W.: Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185 (1990) 60-89.