A YAC-, P1-, and cosmid-based physical Map of the BRCA1 region on chromosome 17q21

GENOMICS25, 264-273 (1995)

A YAC-, PI-, and Cosmid-Based Physical Map of the BRCA1 Region on Chromosome 17q21 FERGUS J. COUCH,*A LUCID H. CASTILLA,t A JUNZHE Xu,$ A KENNETH J. ABEL,§'1 PIRI WELCSH,¶'1 STEPHANIE E. KING,II LINGHUA WONG,II PEGGY P. HO,~ SOFIA MERAJVER,$ LAWRENCE C. BRODY,t GuIYING YIN,~ STEVET. HAYES,II LINN M. GIESER,t WENDY L. FLEJTER,II THOMAS W. GLOVER,II'** LORI S. FRIEDMAN,t$ ERIC D. LYNCH,tt JOSE E. MEZA,t t MARY-CLAIRE KING,tt DAVID J. LAw, l] LARRY DEAVEN,t~ ANNE M. BOWCOCK,¶ FRANCISS. COLLINS,$ BARBARA L. WEBER,*'*** AND SETTARAC. CHANDRASEKHARAPPAt'2 Departments of * lntemal Medicine and ***Genetics, University of Pennsylvania Medical School, Philadelphia, Pennsylvania 19104; Departments of *Internal Medicine, §Human Genetics, and **Pediatrics, and the IIHuman Genome Center, University of Michigan Medical School, Ann Arbor, Michigan 48109; tLaboratory of Gene Transfer, National Center for Human Genorne Research, National Institutes of Health, Bethesda, Maryland 20892; ¶Department of Pediatrics and McDermott Center, Southwestern University, Dallas, Texas 75235; ttDepartment of Molecular and Cell Biology and School of Public Health, University of California, Berkeley, California 94720; and **Los Alamos National Laboratory, Los Alamos, New Mexico

ReceivedOctober18, 1994;revisedNovember28, 1994 A familial early-onset breast c a n c e r g e n e (BRCA1) has b e e n l o c a l i z e d to c h r o m o s o m e 17q21. To characterize this r e g i o n and to aid in the identification of the BRCA1 gene, a p h y s i c a l m a p of a r e g i o n o f 1.0-1.5 Mb b e t w e e n the EDH17B1 and the PPY loci o n chromos o m e 17q21 w a s g e n e r a t e d . The p h y s i c a l m a p is comp o s e d o f a y e a s t artificial c h r o m o s o m e (YAC) and P1 p h a g e c o n t i g w i t h o n e gap. The majority of the interval has also b e e n c o n v e r t e d to a c o s m i d contig. T w e n t y three PCR-based s e q u e n c e - t a g g e d sites (STSs) w e r e m a p p e d to these contigs, t h e r e b y c o n f i r m i n g the o r d e r and o v e r l a p of i n d i v i d u a l clones. This c o m p l e x physical m a p of the BRCA1 r e g i o n w a s u s e d to isolate g e n e s b y a n u m b e r o f g e n e identification t e c h n i q u e s and to g e n e r a t e transcript m a p s of the region, as p r e s e n t e d in the t h r e e a c c o m p a n y i n g m a n u s c r i p t s of B r o d y e t al. (1995), O s b o r n e - L a w r e n c e et al. (1995), and F r i e d m a n et al. (1995). © 1995AcademicP..... Inc.

INTRODUCTION Breast cancer is currently one of the leading causes of death among women in the United States, being diagnosed in over 170,000 individuals per y ear (Silverberg and Boring, 1990). Family history of breast cancer has been identified as a major risk factor in the development of early-onset breast cancer. About 5% of all breast cancer appears to be inherited (Claus et al., 1991). Several reports have suggested t h a t the in1These authors contributed equally to this work. 2To whom correspondence should be addressed at the Physical Mapping Core, Laboratory of Gene Transfer, NCHGR, Building 49, National Institutes of Health, 9000 Rockville Pike, Bethesda, MD 20892. Telephone: (301) 402-2344. Fax: (301) 402-4929. 0888-7543/95$6.00 Copyright© 1995by AcademicPress, Inc. All rights of reproductionin any formreserved.

creased risk of early-onset breast and ovarian cancer in some families is due to an autosomal dominant susceptibility allele (Newman et al., 1988; Claus et al., 1991), which accounts for 5 - 1 0 % of all breast cancer. In 1990, a susceptibility gene for early-onset breast cancer (BRCA1) was localized by genetic linkage to the long arm of chromosome 17q (Hall et al., 1990). This finding was later verified in early-onset breast and ovarian cancer families (Narod et al., 1991). A collaborative study utilizing over 200 families determined t h a t breast/ovarian cancer was linked to m arke rs in this region in greater t h a n 90% of families with at least one case of ovarian cancer along with breast cancer. However, linkage between breast cancer and 17q12q21 m arkers was observed in j ust 45% of families with breast cancer only (Easton et al., 1993). Using recombination events in linked families, the BRCA1 region was refined to a 12-cM interval flanked by the m arkers D17S250 and D17S588 (Easton et al., 1993). Other recombination events in BRCA1 families using the m a r k e r s THRA1 and D17S579 reduced the BRCA1 interval to 4 cM in size (Bowcock et al., 1993; Chamberlain et al., 1993) and subsequently to a region of approximately 1.5 Mb between the m a rk e rs D17Sl185 and D17S78 (Couch et al., 1994b). D17S78 and PPY have been previously shown to reside on the same cosmid ( C h a n d r a s e k h a r a p p a et al., 1994). High-density genetic maps (Anderson et al., 1993; Albertsen et al., 1994a), radiation hybrid maps (Abel et al., 1993; O'Connell et al., 1994), fluorescence in situ hybridization (FISH) maps (Flejter et al., 1993), polymorphic STS content maps (Couch et al., 1994a), and physical maps of YACs and P l s (Albertsen et al., 1994b) of the BRCA1 region have been constructed in an att em pt to localize more precisely the BRCA1 gene. In

264

PHYSICAL MAP OF THE BRCA1 REGION

this report we present a yeast artificial chromosome (YAC) and P1 contig of the BRCA1 region, much of which has been reduced to a cosmid contig. The STSs EDH17B1 and PPY define the boundaries of the contig, which is about 1.0 to 1.5 Mb in size and contains a single gap. Using these clones, we have identified many genes in the BRCA1 region as presented in three accompanying papers (Brody et al., 1995; Osborne-Lawrence et al., 1995; Friedman et al., 1995). MATERIALS AND METHODS

Sequence-tagged sites (STSs) from 17q21. All of the STSs listed in Fig. 1 have been deposited with G e n B a n k and the Genome Data Base. The G e n B a n k accession numbers for the MTO-63, MTO-139, and MTO-206 STSs are T27196, T27191, and T27197. The STS for CA125 (5' TCGTCAGGGCAGATCTTATTTTACA 3 ' and 5' ACT ATC TTT TCC CCT TCG GTC TGG 3'; 441-bp product u n d e r cycling conditions of 94°C for 30 s, 60°C for 30 s, and 72°C for 60 s) was designed from sequence retrieved from GenBank (Accession No. X76952). The STSs for PPY and p131 were reported earlier (Chand r a s e k h a r a p p a et al., 1994). The STS 17B51 was generated by sequencing one of the products from an inter-Alu-PCR reaction of the YAC clone 26F3. The 42A12 STS was derived from inter-Alu-PCR of the 42A12 cosmid clone. The STSs 26F3LE and 416F6RE were obtained by sequencing the termini of the inserts in YAC clones 26F3 and 416F6, respectively, as described below. To use STSs for screening of the YAC libraries or for STS-content mapping, PCR conditions were optimized to amplify specifically sequences from hum a n DNA in the presence of yeast DNA. These PCR conditions are available in the Genome Data Base. Yeast artificial chromosome and P1 clones. YAC clones in Saccharomyces cerevisiae were obtained by screening two total h u m a n genomic YAC libraries: one constructed at the Center for Genetics in Medicine (CGM), Washington University at St. Louis, Missouri (Burke et al., 1987), and the other at the Centre d'Etude du Polymorphisme H u m a i n (CEPH) in Paris, France (Albertsen et al., 1990). The entire screening procedure, including the identification of the final colony, was carried out by a PCR-based pooling method using region-specific STSs (Green and Olson, 1990). The procedures for the preparation of total yeast DNA (in agarose blocks and in liquid form) and characterization of the YAC clones have been described previously ( C h a n d r a s e k h a r a p p a et al., 1992). The DuPont P1 phage library, DMPC-HFF No. 1 series B (Shepherd et al., 1994), was screened by hybridization with exon probes derived by exon amplification (Church et al., 1994) from cosmids in the region (Abel et al., 1994). Positive clones were retested by PCR with STSs from these exons. DNA was prepared using the alkaline lysis method. Pulsed-field gel electrophoresis (PFGE). CHEF gel electrophoresis was carried out u n d e r the following conditions: 1% agarose gel, 0.5x TBE, 200 V for 24 h with 50- to 90-s ramp, using a CHEF-DRII (Bio-Rad) system. The sizes of the YAC inserts were determined by hybridization of Southern blots of pulsed-field gels with radiolabeled pBR322 ( C h a n d r a s e k h a r a p p a et al., 1992). Southern hybridization was carried out by s t a n d a r d procedures. Fluorescence in situ hybridization (FISH). Several YAC clones were mapped to the BRCA1 region and tested for chimerism by FISH as shown in Fig. 1. Total yeast DNA from YAC clones was used as probes for FISH analysis. Alu-PCR products of YAC clones (26D6 and B 2 6 0 E l l ) were used as probes for FISH analysis of these YACs. The procedures have been previously described (Flejter et al., 1993). Three chimeric YACs were due to cocloning of greater t h a n two inserts. The YAC 30G2 contained four inserts, while the YACs D52H10 and B 2 6 0 E l l contained three inserts. Identification of YAC insert ends. Insert end sequences of YAC clones 26F3 and 416F6 were obtained by amplification of end fragm e n t s from vectorette libraries using linkers complementary to RsaI and Hinfl sites as described (Riley et al., 1990). The first PCR was performed with primers 1089, 1091, and 224. The second PCR was

265

performed with 224 and hemi-nested primers LS-2 and RA-2. The sequences of the primers are as follows: LS-2, 5'-TCTCGGTAGCCAAGTTGGTTTAAGG-3' (for the 1089/224 YAC insert end product); RA-2, 5'-TCGAACGCCCGATCTCAAGATTAC-3' (for the 1091/224 YAC insert end product). Annealing t e m p e r a t u r e s for both primers were 67°C. End-clone STSs. End-clone PCR products generated from the vector/insert junction of YACs and cosmids were gel purified using the Qiagen Gene Clean kit according to the manufacturer's directions. End-clone PCR products were t h e n sequenced using the BRL Cycle Sequencing kit as suggested by the manufacturer. STSs for the YAC end-clone sequences were developed from the end fragment sequences. Oligonucleotide primers were selected with the aid of the PRIMER computer program provided by E. Lander (Whitehead Institute). The oligonucleotide primer sequences of STSs for each YAC end fragment and the product sizes after PCR are as follows: 26F3LE (5'-AAGCAACTAGGGGTCAGG-3', 5'-ATTTTCAGAGGGGACACAG-3'), 490 bp; 416F6RE (5'-CCTAAGAAGTCCATATCCTT-3', 5'-CCCAAGCCACGTGGCTAGTTAC-3'), 125 bp. PCRs were performed u n d e r s t a n d a r d conditions with an annealing temperature of 55°C for 26F3LE and 50°C for 416F6RE. The chromosomal origins of the end-clone sequences and other STSs were determined by amplification of genomic DNA from a panel of chromosome 17-containing somatic cell hybrids described below. Somatic cell hybrid mapping. A panel of the following five somatic cell hybrids containing parts of chromosome 17 were used: P12.3B (pter to q12), SP3 ( q l l . 2 to qter), DCR1/NF13 ( q l l . 2 to qter), MH41 (q23-qter), and L(17n)C (entire q arm) (Abel et al., 1993). Alu-PCR of YAC clones. The sequences of the 5'- and 3 ' - h u m a n Alu-PCR primers and the reaction conditions were as described in Tagle and Collins (1992). Three independent PCR reactions were carried out for each YAC clone with 5'-primer alone, 3 '-primer alone, and both 5'- and 3 '-primers using total yeast DNA (1 ng/#l) as template. Each reaction was carried out in a total volume of 100 #l with 1 ng/#l of template DNA. The PCR products were isolated using Magic PCR Prep columns (Promega), and the products from all three reactions for a YAC clone were subsequently pooled.

Screening high-density (HD) gridded chromosome 17 cosmid filters. Membranes containing spotted colony lysates of cosmid clones from an arrayed chromosome 17 cosmid library (from Larry Deaven at Los Alamos National Laboratory) were prepared using the Biomek 1000 HD stamping tool (Beckman, Inc.). Each filter contained a total of 1536 colonies, of which 1440 were cosmid clones from 15 microtiter plates (96 well) and 96 were control plasmids from 1 microtiter plate. The control plasmid contains a CFTR (cystic fibrosis t r a n s m e m b r a n e regulator) cDNA insert and serves as a registration m a r k e r for identification of the signals from the individual cosmid clones from the HD filters (Fig. 4). The entire library of 160 microtiter plates was accommodated on 11 HD filters. Prehybridization was carried out for 4 - 6 h in a solution containing 1 M NaC1, 1% SDS, 10% dextran sulfate, and 125 #g/ml denatured placental DNA. Radioactive probes were prepared by the random-primer labeling method. Alu-PCR products of YAC clones, as well as inserts from cosmid clones released by NotI digestion, were used as probes for screening HD-gridded filters. Radiolabeled CFTR cDNA fragment was used as a control probe in each hybridization. Both Alu-PCR products of YAC clones and cosmid inserts were preannealed with placental DNA to block the repeats from hybridizing to the filters. For preannealing, the probes were added to 1 ml ofprehybridization solution and placental DNA (0.5 mg/ml), boiled for 5 rain, and allowed to anneal for 2 h in a 65°C waterbath. The probes were added to the filters in prehybridization solution (approximately 1 million cpm/ml of specific probe and about 100,000 cpm/ml of control CFTR probe), and hybridization was continued at 65°C overnight. Washes were performed twice for 30 min each in 2× SSC, 0.5% SDS. Hybridizing cosmids were identified by autoradiography at -70°C for 1 2 - 2 4 h using the positive control CFTR signals to align the films precisely to the arrayed library. Escherichia coli strains containing positive cosmids were streaked on LB agar plates containing 30 #g/ml of kanamycin. Four colonies were picked from each plate, grown overnight in 96-well plates, and stamped onto filters. Colony lysates were hybridized with

266

COUCH E T A L .

the original probe to verify overlap. Bacterial strains containing positive cosmids were restamped onto filters and used as mapping grids for YACs, cosmids, exons, and cDNAs. Restriction digestion and cosmid walking. Digests of 5 #g of DNA from cosmids identified by high-density cosmid library screening were performed with 10 U of the enzymes AccI, SacI, and PstI. Digested fragments were separated on 0.8% agarose gels, stained with ethidium bromide, and photographed on a UV light box. Restriction mapping identified overlapping cosmids. The overlap of cosmids was verified by cosmid to cosmid hybridization as described above. End clones from the minimally overlapping cosmids were then used as probes to rescreen the high-density cosmid library to walk into any remaining gaps. RESULTS

Isolation of Y A C and P1 Clones To generate a physical map of the BRCA1 region, two large insert YAC libraries were initially screened with 9 PCR-based STSs from the 17q12-q21 region. Several clones t h a t formed unconnected islands of overlapping DNA fragments were identified. New STSs were derived from the original YAC clones. The STSs took the form of polymorphic markers, single-copy AluPCR products, and YAC end clones. These STSs were then used to identify more YAC clones t h a t extended and connected the original islands. Each new STS was mapped to the BRCA1 region by PCR of chromosome 17-specific somatic cell hybrids (Abel et al., 1993), and each new YAC clone was mapped back to the BRCA1 region by STS content and FISH analysis (Flejter et al., 1993). FISH was also used to assess chimerism in the YACs, by hybridizing total yeast DNA from the YAC clones to metaphase spreads of normal h u m a n chromosomes. The clones t h a t showed hybridization signals to regions in addition to 17q12-q21 were scored as chimeric (Fig. 1). Nineteen of the 32 YACs were isolated from the CEPH library, and 13 were isolated from the St. Louis library. Thirty-three percent of the clones from the CEPH library and 75% of the clones from the St. Louis library t h a t were tested for size and chimerism by FISH were found to be chimeric. The number of clones obtained with an individual STS varied from I to 5, and the sizes of the clones ranged from 65 to 600 kb. Five YACs, 2 from the ICI library (19DC6 and 22HE5) and 3 from the CEPH library (173B7, 727A12, and 300C2), which were reported by others (Albertsen et al., 1994b), were used in an attempt to connect YAC islands. These YACs were also tested with a number of STSs in the region to verify overlaps. Two P1 clones were isolated from the DuPont P1 phage library by hybridization with STS PCR products and were used to close a gap in the YAC contig distal to the RNU2 region as shown in Fig. 2. The P912A5 and P1068C9 P1 clones were isolated using the MTO-63 STS. P1068C9 was also isolated independently using the MTO-206 STS. S T S Content Analysis of YACs and P1 "s Overlaps of YAC and P1 clones were verified by content mapping with 23 STSs, 9 of which had previously

been used to isolate the YAC clones. A chart indicating which genomic clones were positive for each STS is shown in Fig. 1. Two regions of the contig appear to contain gaps as determined by STS content mapping. The first potential gap is located between the 26F3LE and D17Sl142 STSs. No YAC was shown to contain both of these STSs. However, other experiments verified t h a t the YACs A191H6 and 308G8 overlap in this region. The cosmids 7F12 and 119D4 were isolated using A l u - P C R products from both of these YACs independently. Furthermore, A l u - P C R products from each YAC clone detected the other by hybridization of Southern blots of YAC DNAs as diagrammed in Fig. 2. The cumulative data suggest t h a t the YACs overlap but t h a t the 308G8 and D41B12 YAC clones were deleted in the region of the D17Sl142 and MTO-139 STSs. The cosmid content of the YACs in this region as described below indicates t h a t the combination of all of the YACs completely fills all holes in this region. The second gap in the contig is located between the D17S855 and the 42A12 STSs. No YAC or P1 clone t h a t contained both STSs was isolated. No cosmids common to the B109C8 and 308G8 YACs, which are proximal to the gap, and the A167E6 YAC, which is distal to the gap, were identified. The YACs B153E3, 939G3, 727A12, and 173B7, which were also mapped to this region, were not used to isolate cosmids. Another contig of this region was completed using the 727A12, 173B7, and other YAC clones (Albertsen et al., 1994b). In the current study, PCR analysis of these YACs with the D17S855 STS failed to generate a product, suggesting t h a t the 22HE5 YAC, which had been reported to contain the D17S855 STS, contained a deletion in this region in our stock. The size of the gap can be estimated by a variety of methods. Multipoint maximum likelihood analysis of a radiation hybrid panel indicates t h a t the D17S855/ RNU2 region is between 350 and 630 kb in size (Abel et al., 1993), suggesting t h a t the gap in the contig is less t h a n 630 kb. A previously presented physical map of the BRCA1 region (Albertsen et al., 1994b) indicates t h a t the A167E6 YAC overlaps with the 173B7 YAC, which in t u r n overlaps with the 167B7 YAC. These data suggest t h a t the gap in the present contig exists between the 167B7 YAC and the 308G8 YAC. The 22HE5 YAC (420 kb) has been shown to bridge this hole (Albertsen et al., 1994b). However, the gap must be less t h a n 420 kb because the 22HE5 YAC overlaps both the 308G8 and the 167B7 YACs. The D17S855 marker, which is present within the YAC 308G8, is known to be within the 3' end of the BRCA1 gene. This suggests t h a t a large section of the 100-kb BRCA1 gene (Miki et al., 1994) lies in the gap in this contig. The P1 clones P1068C9 and P912A5 were used to close a gap in the YAC contig t h a t was located distal to the RNU2 region. The 300C2 YAC from Albertsen et al. (1994b) was also shown to bridge this gap. Construction of a Cosmid Contig To simplify the search for genes in the BRCA1 region, a cosmid contig of the EDH17B1-D17S78 interval was

267

PHYSICAL MAP OF THE BRCA1 REGION

STS

do.e~ 30G2 Z79F$ 331All 176F3 T84B4 368C7 Z6F3. 303G8 B51H11 &12E9 &191H6 &230Ell B117H4 B188B2 D41B12 308G8 B153E3 B109C8 ~39G3 r27A12 17387 k167E6 ~71D6 B196A12 D52H10

size~kbt ¢ ~ m e r l 500 C 300 C 65 NC 320/30CNC 235 NC 300 NC 240 N C 300 320 NC 350 C 500 C 340 C 375 iC 575 JC 360 !NC

]

100

NC

320 360 190 300 140 505

~NC NC NC C C

÷

+

÷

÷

÷

÷

÷

÷

÷

÷

÷

÷

÷

÷

÷

+ + + + + +

÷

+

+

÷

÷

÷

÷

÷

÷

÷

÷

÷

÷

÷

÷

÷

4-

+

÷

÷

÷

÷

÷

÷

÷

÷

÷

J

+ I

i

•

÷

t 1

÷:;I

÷

÷

÷

230

÷

+

÷

i

÷1

.

,

÷ ÷

÷

i

÷

÷

÷

÷

÷

÷

÷

÷

÷

÷

÷ ÷

J

÷

t

262D12 T94B8 B121A11 19DC6 779C4 237E9. 251H5 26D6 B260E11

÷

÷

÷

P106eCgl |16F6

÷

L

+

÷

÷

"

.

+

+

C !NC

270 460

C C

400 80 600 150

C NO C C

~'

+

÷

NO

+

+

i i i~i_ilI~ ~~_I~ii_i ~ .

i

~

i

.

.

-

+

÷

+

+

+

+

+

÷

-

.

I

÷

÷

÷

÷

÷

÷

FIG. l. A chart of overlapping YAC and P1 clones in the BRCA1 region between the EDH17B1 and the D17S78 markers. The map indicates which of the 39 clones are positive for each of the 23 STS markers. The STSs are presented on the horizontal axis. Those with an asterisk were originally used to isolate YACs from libraries. The YAC and P1 genomic clones are shown on the vertical axis, along with the size of the clones and the chimerism status. STSs that are present in a clone are indicated by a plus. YACs from the St. Louis library are prefixed with A, B, C, or D. P1 clones commence with the letter P. All other YACs are from the CEPH library except for 19DC6 from the ICI library. ND indicates t h a t the clone was not typed with the STS. Sizes of YAC clones are presented for those clones t h a t underwent pulsed-field gel electrophoresis to determine size during the course of this work. Note the two potential gaps in the contig.

generated directly from the YAC contig described above. Alu-PCR products from many of the YACs described in Fig. 1 were used to screen directly the Los Alamos chromosome 17 flow-sorted cosmid library as shown in Fig. 3. The use of this library greatly reduced the difficulties of working with chimeric YAC clones. A total of 492 cosmids were isolated, the well locations of which are available upon request. The cosmids were first placed into bins defined by regions of YAC overlap based on cosmid content. This resulted in the grouping of cosmids into regions of less than 100 kb. The cosmids were then restriction mapped to identify overlaps. All cosmids were digested with the enzymes AccI and SacI, which do not cut in the sCosl vector and which generate a well-distributed pattern of digest fragments on agarose gels. Several fragments greater than 7 kb in size were omitted from analysis, due to the possibility that these fragments contained the sCosl vector. All cosmids were also digested with the enzyme PstI, which cut in the sCosl vector and

generated a more complex pattern of restriction fragments. An example of a restriction map generated with the enzyme AccI is shown in Fig. 4. Several groups of fragments could not be specifically ordered because no cosmids that contained some of the fragments and not others were present. A good example is the fragments of 2, 8, 3.7, and 3.2 kb shown in Fig. 4. These four fragments could have been presented in any random order on the restriction map. The overlaps detected by restriction digestion in many cases verified the grouping of the cosmids by the YAC overlap bin method and connected several of the groups into small cosmid contigs. Cosmid to cosmid hybridization was undertaken to confirm the cosmid overlaps that were observed by restriction mapping. Bacterial strains containing cosmids were grown in microtiter plates and stamped onto filters that were used as reference and mapping grids. Inserts from cosmids were isolated by NotI digestion and preparative agarose gel electrophoresis. Each in-

268

COUCH ET AL. BI09C8

A191HI6

308041

)-~)

I

;I

=, <

~3E12

9~16

1108

6B9

90E4

23C2

69A8

7F12 134o~o~ ~gD41~r~7 ~

60F9

28D10

2~Fs

4C9

103C1 I

.

J, -qr 0

0 Ig

237E9 053B3

41§F6 n

A16"R6

P912A5 P1068C9

c~ 120D8 42A12 7ASiiiiiiii I

81 C6

i 95G7~

i

14(]E9

'

86Gll ~2H10''

~o Z

"~

n,-

56B12

~

114A~.

o

~

32E5

101D~

o

~

FIG. 2. A contig of overlapping YAC, cosmid, and P1 clones from the BRCA1 region showing the locations of 18 PCR-based markers and 18 hybridization-based exon probes. The map is drawn with a minimal set of YACs and cosmid genomic clones. Long vertical lines represent PCR-based STSs t h a t are positive in the YACs and cosmid genomic clones indicated. Deletions in the 308G8 YAC clone are drawn as bracketed gaps in the YAC. Exons, denoted MTO, were detected in the cosmid clones by hybridization. Cosmids in the RNU2 region t h a t were not ordered are presented as a shaded block. The upper and lower sections of the figure are separated by a gap in both the YAC and the cosmid contigs.

•

•

~

Q

0

Q

O

O

I

I

t

~

II

e

e

e

0 Ib

•

ill

a

°

FIG. 3. (A) Autoradiogram of a filter from the high-density cosmid library hybridized with Alu-PCR products from the A191H6 YAC clone. Regularly spaced positive signals represent the control CFTR plasmid, which was used to orient the high-density grid. Six cosmids (126A12, 127C4, 126E6, 122F6, 134G10, and 131G2) were detected by this hybridization probe. The cosmid 134G10, which is present in the minimal contig in Fig. 2, is indicated by a n arrow. The filter contains 1536 clones, of which 1440 are cosmids. (B) Hybridization of the exon, MTO-127, to a grid of 386 cosmids from the BRCA1 region. Cosmid grids of this type were used to map YACs, cosmids, exons, and cDNAs to the BRCA1 region. The exon hybridized to 9 cosmids (3G7,155C1, 126A12, 90E4, 138E4, 3E6, 68G2, 3G6, and 61A8). The cosmids 3E6 and 90E4 are present in the minimal cosmid contig in Fig. 2.

269

PHYSICAL MAP OF THE BRCA1 REGION A

206

167

158

143

157

I

156

144

155

81H8

=

:

:

:

81H7 81C6 50E10

= ~ ,i

', : i

'. : I

: i I

i I

92A5 76B6 58E8

:

: I I

: i I

I

I

" "=

: I I

I i

l

i

I

I

52C2 21H12 7B5

'~ 9 "1

I I I

J ] i

I I I

I [ I

I

I

I

I

I

I

I

7B4 80A2

q =i

I I

I 1

I I

I I

I

I

I

I

133F6

q

I

I

I

I

I

i

I

I

= : = : ..........

: :

: I

i I I

I

I

i

~ I

I I

I I

I I I

124C12 139C3 134A3

154

225

170

107F2 109H4 33G10 106G10

I I I J

I I

125C3 157F6

i I

i I

i

1G3

I

I

I

I

I

I

+ +

88B8 41A8

110

2.7

1.4

1

3.8

>12

2.8

1.7

+ +

+ +

+ +

+ + + + + + +

+ + + + + + +

+ +

+ +

+

+ + +

+ + +

+ + +

i

i

I

I

I

I

I

I

J

I

)

I

I

I

I

I

I

I

I

I

t

I

i

I

I

I

I

I

I

.

.

.

5

.

.

.

.

.

.

.

.

.

.

.

.

.

Accl Restriction Analysis 4 3.1 1.8 2.6 2

1.5

.

.

.

8

.

.

.

I

I

I

I

I I I i

I

I

J I

J I t

I I J

I I

=

I

i

i

i

i i

.

.

.

.

.

3.713.2

.

.

194

I .

1.9

.

>10

.

.

: .

4.8

I

5.8

4.6

>9

~[ / L

....

+

+

+

+

+

93E'12

+

+

+

+

+

+

+ +

+ +

+ + +

+

1 5 2 A 5. . . . 78C4

+ +

+

+

+

+

+ +

+ +

+ +

÷ +

+ +

+ +

+ +

+ +

+ +

+

+

+ +

+ +

+ +

+ +

+ +

+ +

+

+

+

.

61C9 68B3

20F11 95G9

I I I I

204

I

+

17B7 53B12

224

I

+

140C10

106

I

Cosmids 4.2

107

I

46F1 57D5 14F6 86G 11 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14F2 131A6 52G12 . . . . . . . . . . . . . . . . . . . . . . .

37G2 96H6 69F3 81Dll 81D12 48H1 79F4

168

I

80F6 140E9 . . . . . . . . . . . . . . . . . . . . . . . . . . . 9G7 2G8 103Gll 44F12 157H2 128B5 17F2 82H10 ................................. 123H5 8A9 69A2 32E8

B

169

~~ t

.

.

/ +

.

I +

+

+

+

+

+

F I G . 4. (A) An exon-based content m a p of a representative section of the cosmid contig between cosmids 81C6 a n d 52G12. Exons derived by exon amplification are p r e s e n t e d on the horizontal axis. Cosmid clones are shown on the vertical axis. Cosmids from the "minimal" contig are d r a w n as large boldface lines. Small vertical lines in the cosmid clones indicate which exons hybridized to each cosmid. The separation of the exons in the figure is for presentation purposes only and does not r e p r e s e n t proportional exon spacing in the cosmids. The level of r e d u n d a n c y of the cosmids varies from 15-fold in the region of cosmid 81C6 to 3-fold in the region of cosmid 52G12. (B) An AccI restriction digest-based contig of a region of the cosmid contig. Sizes of AccI digestion f r a g m e n t s are presented on the horizontal axis. Cosmid clones from the 96H6 to 53B12 region are shown on the vertical axis. Cosmids from the m i n i m a l contig are in boldface type. AccI f r a g m e n t s t h a t are p r e s e n t in cosmid clones are indicated by a plus. Several f r a g m e n t s larger t h a n 7 kb are not included in the analysis due to the presence of vector sequence. Therefore, cosmid inserts are larger t h a n the s u m of the f r a g m e n t s reported here.

270

COUCH ET AL.

sert was blocked for the presence of Alu repeats and hybridized to the cosmid filters. To connect the cosmid islands, the cosmid filters were hybridized with cosmids t h a t had not been placed in the islands but had been predicted by the YAC overlaps to lie in the region of interest. Several islands of cosmids were connected by this method, resulting in the generation of five cosmid contigs within the BRCA1 region.

Cosmid Walking A cosmid walking strategy was adopted in an attempt to close the gaps in the contig. The cosmids t h a t extended furthest into the gaps were identified by restriction analysis. These cosmids were subsequently used as hybridization probes to screen the chromosome 17-specific cosmid library. New cosmids identified in this screen were restriction mapped. These cosmids were added to the cosmid mapping filters, and the cosmid t h a t overlapped least with the original probe by restriction analysis was used to verify the overlap by hybridization. F u r t h e r cosmid walking was then undertaken with the new minimally overlapping cosmid. In this m a n n e r a large gap between cosmid 128Dll and 103C1 was filled as shown in Fig. 2. Five new cosmids were required to complete the contig in this region. It was later determined t h a t the clones from the three YACs in this region, D41B12, 308G8, and B109C8, which had been used to isolate cosmids, had contained large deletions. Subsequent to the cosmid walking a new YAC clone, B109C8, t h a t was shown to contain the previously deleted region was isolated. Cosmid walking failed to close any of the other three gaps in the cosmid contig. The cosmid contig is composed of four unconnected islands (Fig. 2). The minimal cosmid contig is aligned with the minimal YAC contig using PCR-based STSs and exon hybridization probes.

Cosmid Rearrangement Five cosmid clones t h a t were rearranged in relation to the genomic DNA of this region were also identified by a combination of restriction mapping and hybridization to a panel of h u m a n chromosome 17 somatic cell hybrid DNAs. These rearrangements may have been due to cosmid chimerism and/or contamination of the cosmid DNA and colony stock with another cosmid from the library. Several cosmids with deletions were also identified by restriction digestion analysis. Two examples of cosmids t h a t contained deletions are observed in Fig. 4. The exon hybridization probe, MTO-143, failed to detect the cosmid 92A5, and the exons MTO224 and MTO-204 failed to detect the cosmid 14F2.

R N U 2 Contig Tandem arrays of U2 RNA genes t h a t cover a region of approximately 120 kb (Durnam et al., 1988) are present in the BRCA1 region. Several YAC clones were isolated from this region using an STS from the RNU2 gene as described under Materials and Methods. These

YACs were used to isolate a total of 60 cosmids. However, restriction mapping detected several multiplecopy fragments in m a n y cosmids, suggesting the existence of tandemly repeated U2 gene fragments. As a result the data could not be arranged into a complete restriction map of the region. In an attempt to complete a contig of the U2 RNA gene region, cosmid to cosmid hybridizations were performed. A contig of the region still could not be constructed, due to the tendency of U2 RNA-containing cosmids to hybridize to all other U2 cosmids. However, several non-U2 RNA gene fragments were identified. Alu-PCR of a selection of cosmids resulted in the generation of the 42A12 STS (described under Materials and Methods) and the identification of several cosmids t h a t contain non-U2 RNA sequence. These cosmids are presented in Fig. 2. Other cosmids from the region t h a t contain U2 sequence are presented as an RNU2 block. The RNU2 region may be composed of several small islands of tandem repeats interspersed with non-RNU2-containing segments. Well locations of all cosmids are available upon request.

S T S and Exon Content Analysis of Cosmids The cosmid overlaps were also verified by STS content mapping. In all, 25 PCR markers were mapped onto the cosmids, of which 21 were developed by this group. To solidify the cosmid contig structure further, 73 single-copy exons t h a t had been isolated by exon amplification from pools of the 492 cosmids were used as hybridization probes on the cosmid filters as shown in Fig. 3 (Abel et al., 1994; Brody et al., 1995). The 18 exons shown in Fig. 2 represent a minimal set t h a t demonstrates overlap between cosmids not previously connected by the PCR markers. Three gaps were observed in the cosmid contig. The first gap between the cosmids 103C1 and 42A12, flanked by the D17S855 and 42A12 STSs, is of unknown size. Screening of two YAC libraries, a cosmid library, and a P1 library failed to identify a genomic clone t h a t extended telomeric from D17S855. PCR analysis of several isolates of the 22HE5 YAC (AIbertsen et al., 1994b) with the D17S855 STS failed to detect a product, suggesting t h a t these YAC clones were deleted in this region. Furthermore, problems with the tandem repeat structure of the RNU2 region prevented the identification of the most proximal cosmid of this filled region and the initiation of cosmid walking in a centromeric direction into the gap. The 42A12 cosmid shown in Fig. 2 is intended to represent a non-RNU2-containing cosmid and not necessarily the most proximal cosmid of the RNU2 region. The accompanying papers by Brody et al. (1995), Friedman et al. (1995), and Osborne-Lawrence et al. (1995) describe the isolation of at least 30 genes from the interval diagrammed in Fig. 2. The second gap in the cosmid contig is located between the cosmids 23C7 and 120D8 on the distal side of the RNU2 region. The cosmids 120D8 and 95G7 and

PHYSICAL MAP OF THE BRCA1 REGION the P1 clone P1068C9 were recently added to the contig and resulted in the closure of the gap as shown in Fig. 2. The 300C2 YAC, which was initially placed in this region by Albertsen et al. (1994b), was also shown to close the gap as defined by PCR-based STS analysis. The bridging of the gap by the P1 clone suggests t h a t the region between the MTO-63 and MTO-206 STSs is less t h a n 100 kb in size. The addition of the two minimally overlapping cosmids, 95G7 and 120D8, suggests t h a t a gap of no more t h a n one cosmid length remains in the cosmid contig. The YAC and P1 clones 120D8, P1068C9, and 300C2 were not utilized for identification of transcripts. The third gap in the cosmid contig is located between the cosmids 102E12 and 52C6 near the telomeric end of the contig. This region is thought to be fully contained within the 237E9 YAC. However, the A l u - P C R products from the YAC failed to identify cosmids t h a t completely covered the region. A deletion within the YAC, a low complexity of A l u - P C R products, or a region unclonable in cosmids may explain this result. The cosmid 102E12 was identified by cosmid walking with a 39A1 cosmid insert hybridization probe. DISCUSSION

A YAC- and Pl-based contig of the breast cancer region between the STSs EDH17B1 and MTO-208 was generated. The 1- to 1.5-Mb physical map comprises 39 overlapping YACs and P r s , which have been scored for the presence of 23 STSs. One gap was detected in the contig, distal to the D17S855 marker, which has since been shown to contain most of the BRCA1 gene (Miki et al., 1994). Another region of the map was also not represented in the YACs, as an apparent result of deletions t h a t may have occurred during library construction or during colony growth due to inherent YAC instability. This second hole was filled by new isolates of the unstable YACs, by identification of new YACs, and by supplementation of the physical map with P l ' s and cosmids. A minimal cosmid contig comprising 46 overlapping cosmids has been scored for the presence of 25 STSs by PCR and 73 exons by hybridization, as shown in Fig. 2. Several holes were detected in the cosmid contig, one of which was the same gap as t h a t in the YAC contig. No additional cosmids, P r s , or YACs were identified in any of the libraries by screening with the insert from the 103C 1 clone, suggesting t h a t this region is difficult to clone. The 22HE5 YAC from the ICI library was reported to cover this region (Albertsen et al., 1994b); however, our STS analysis failed to verify this result. The identification of deleted clones and the inability to clone some regions suggest t h a t in general physical mapping results, even when apparently complete, should be cautiously interpreted by investigators. Screening of several different sources of genomic DNA clones and careful analysis with closely spaced STSs should be undertaken when generating a physical map. Chimerism in YACs can lead to isolation of clones

271

from other regions of the genome when the chimeric clones are used as hybridization probes or when STSs are derived from the chimeric fragments. The YACs described in Fig. 1 were isolated exclusively by PCRbased STS screening of YAC libraries with STSs t h a t had been mapped to the BRCA1 region. This method of YAC isolation removed the possibility of isolating completely non-BRCA1 region YACs. The problem of non-BRCA1 YAC isolation may have been avoided; however, the problem of YAC chimerism was not, with several chimeric YACs having been isolated. YACs were used to isolate cosmids by direct hybridization of the Los Alamos flow-sorted chromosome 17-specific cosmid library, essentially eliminating the problem of chimerism from the cosmid contig. The cosmid library provided 5- to 7-fold coverage of the genome. This copy number was observed across most of the BRCA1 contig. An 8- to 12-fold coverage was observed in the region presented in Fig. 3. However, some cosmids such as 138A5 and 102E12 were the only clones detected for t h a t region, and no cosmids were detected in the gap distal to 103C 1. These findings are in excess of expected statistical spread and indicate t h a t great variability in cloning efficiency of different regions of the genome exists and t h a t the BRCA1 region may contain at least one unstable region. The h u m a n homolog (MOX1) of the mouse homeobox Moxl gene has previously been mapped to this region distal to the marker D17S858 and proximal to the marker D17S78 (Futreal et al., 1994). However, in the study described above, this gene was mapped to the cosmids 134A3, 140E9, and 82H10, proximal to the D17S858 marker (Brody et al., 1995). F u r t h e r investigation of the position of the MOX1 gene on the physical map of this region of chromosome 17q21 is necessary before this gene can be accurately localized. The search for the familial early-onset breast cancer gene (BRCA1) has presented one of the more difficult applications of the positional cloning strategy. A sparsity of informative recombination events across the critical region has prevented reduction of the BRCA1 region to much less t h a n 1 Mb in size. Furthermore, no clear evidence of linkage disequilibrium in the region has appeared, apparently because of the presence of multiple independent BRCA1 mutations (Miki et al., 1994). The lack of any large DNA rearrangements prevented targeting of a smaller region containing the gene. The identification of the BRCA1 gene thus called for complete cloning of a region of 1 to 1.5 Mb of DNA and the isolation and characterization of more t h a n 30 genes from t h a t interval (Brody et al., 1995; Friedman et al., 1995; Osborne-Lawrence et al., 1995). While this paper was in preparation the cloning of BRCA1 was announced (Miki et al., 1994). Information from this report indicates t h a t the BRCA1 gene lies in part in the single gap in our contig between the D17S855 and the 42A12 STSs. The 3' end of the gene lies within the cosmid 103C1. Following the identification of the BRCA1 gene, this region of chromosome 17q21 is likely to remain a focus of attention. This phys-

272

COUCH E T A L .

ical map of the region, in association with the accompanying transcription map papers, contributes information on the organization of many transcription units in this gene-rich region. The establishment of the contig will probably play a role in the identification of other genes of biological significance located within this region. The 1- to 1.5-Mb contig also provides an excellent resource for large-scale genomic sequencing. ACKNOWLEDGMENTS

The authors express their gratitude to the University of Michigan Human Genome Center for the use of many facilities during this study. This work was supported by NIH RO1 Grants CA-57601 and CA-61231 (B.W.), CA-60650 (A.B.), and CA-27632 (M.-C.K.). Piri Welcsh is supported in part by a Susan G. Komen Fellowship. REFERENCES

Abel, K. J., Boehnke, M., Prahalad, M., Ho, P., Flejter, W. L., Watkins, M., Vanderstoep, J., Chandrasekharappa, S. C., Collins, F. S., Glover, T. W., and Weber, B. L. (1993). A radiation hybrid map of the BRCA1 region of chromosome 17q12-q21. Genomics 17: 632-641. Abel, K. A., Castilla, L. H., Buckler, A. J., Couch, F. J., Ho, P., Schaefer, I., Chandrasekharappa, S. C., Collins, F. S., and Weber, B. L. (1994). Isolation of gene sequences from the BRCA1 region of chromosome 17q21 by exon amplification. In "Identification of Transcribed Sequences" (U. Hochgeschwender and K. Gardiner, Eds.), Plenum, New York. Albertsen, H. M., Abderrahim, H., Cann, H. M., Dausset, J., Le Paslier, D., and Cohen, D. (1990). Construction and characterization of a human yeast artificial chromosome library containing seven haploid genome equivalents. Proc. Natl. Acad. Sci. USA 87: 42564260. Albertsen, H., Plaetke, R., Ballard, L., Fujimoto, E., Connolly, J., Lawrence, E., Rodriguez, P., Robertson, M., Bradley, P., Milner, B., Fuhrman, D., Marks, A., Sargent, R., Cartwright, P., Matsunami, N., and White, R. (1994a). Genetic mapping of the BRCA1 region on chromosome 17q21. Am. J. Hum. Genet. 54: 516-525. Albertsen, H. M., Smith, S. A., Mazoyer, S., Fujimoto, E., Stevens, J., Williams, B., Rodriguez, P., Cropp, C. S., Slijepcevic, P., Carlson, M., Robertson, M., Bradley, P., Lawrence, E., Harrington, T., Mei Sheng, Z., Hoopes, R., Sternberg, N., Brothman, A., Callahan, R., Ponder, B. A. J., and White, R. (1994b). A physical map and candidate genes in the BRCA1 region on chromosome 17q12-21. Nature Genet. 7: 472-479. Anderson, L. A., Friedman, L., Osborne-Lawrence, S., Lynch, E., Weissenbach, J., Bowcock, A., and King, M.-C. (1993). High-density genetic map of the BRCA1 region of chromosome 17q12-q21. Genomics 17: 618-623. Bowcock, A. M., Anderson, L. A., Friedman, L. S., Black, D. M., Osborne-Lawrence, S., Rowell, S. E., Hall, J. M., Solomon, E., and King, M.-C. (1993). THRA1 and D17S183 flank an interval of <4 cM for the breast-ovarian cancer gene (BRCA1) on chromosome 17q21. Am. J. Hum. Genet. 52: 718-722. Brody, L. C., Abel, K. J., Castilla, L. H., Couch, F. J., McKinley, D. R., Yin, G. Y., Ho, P. P., Merajver, S., Chandrasekharappa, S. C., Xu, J., Cole, J. L., Struewing, J. P., Valdes, J. M., Collins, F. S., and Weber, B. L. (1995). Construction of a transcription map surrounding the BRCA1 locus of chromosome 17. Genornics 25" 238-247. Burke, D. T., Carle, G. F., and Olson, M. V. (1987). Cloning of large segments of exogeneous DNA into yeast by means of artificial chromosome vectors. Science 236: 806-812. Chamberlain, J. S., Boehnke, M., Frank, T. S., Kiousis, S., Xu, J., Guo, S.-W., Hauser, E. R., Norum, R. A., Helmbold, E. A., Markel,

D. S., Keshavarzi, S. M., Jackson, C. E., Calzone, K., Garber, J., Collins, F. S., and Weber, B. L. (1993). BRCA1 maps proximal to D17S579 on chromosome 17q21 by genetic analysis. Am. J. Hum. Genet. 52: 792-798. Chandrasekharappa, S. C., Marchuk, D. A., and Collins, F. S. (1992). Analysis of yeast artificial chromosome clones. Methods Mol. Biol. 12: 235-257. Chandrasekharappa, S. C., Friedman, L., King, S. E., Lee, Y.-H., Welcsh, P., Bowcock, A. M., Weber, B. L., King, M.-C., and Collins, F. S. (1994). The gene for pancreatic polypeptide (PPY) and the anonymous marker D17S78 are within 45 kb of each other on chromosome 17q21. Genomics 21: 458-460. Church, D. M., Stotler, C. J., Rutter, J. L., Murrell, J. R., Trofatter, J. A., and Buckler, A. J. (1994). Isolation of genes from complex sources of mammalian genomic DNA using exon amplification. Nature Genet. 6: 98-104. Claus, E. B., Risch, N., and Thompson, W. D. (1991). Genetic analysis of breast cancer in the cancer and steroid hormone study. Am. J. Hum. Genet. 48: 232-241. Couch, F. J., Kiousis, S., Castilla, L. H., Xu, J., Chandrasekharappa, S. C., Chamberlain, J. S., Collins, F. S., and Weber, B. L. (1994a). Characterization of 10 new polymorphic dinucleotide repeats and generation of a high-density microsatellite-based physical map of the BRCA1 region of chromosome 17q21. Genomics 24: 419-424. Couch, F. J., Garber, J., Kiousis, S., Calzone, K., Hauser, E. R., Boehnke, M., Chamberlain, J. S., Collins, F. S., and Weber, B. L. (1994b). Genetic analysis of eight breast/ovarian cancer families with suspected BRCA1 mutations. J. Natl. Cancer Inst., in press. Durnam, D. M., Menninger, J. C., Chandler, S. H., Smith, P. P., and McDougall, J. K. (1988). A fragile site in the human U2 small nuclear RNA gene cluster is revealed by adenovirus type 12 infection. Mol. Cell. Biol. 8: 1863-1867. Easton, D. F., Bishop, D. T., Ford, D., Crockford, G. P., and the Breast Cancer Linkage Consortium (1993). Genetic linkage analysis in familial breast and ovarian cancer--Results from 214 families. Am. J. Hum. Genet. 52: 678-701. Flejter, W. L., Barcroft, C. L., Guo, S.-W., Lynch, E. D., Boehnke, M., Chandrasekharappa, S., Hayes, S., Collins, F. S., Weber, B. L., and Glover, T. W. (1993). Multicolor FISH mapping with AluPCR-amplified YAC clone DNA determines the order of markers in the BRCA1 region on chromosome 17q12-q21. Genomics 17: 624631. Friedman, L. S., Ostermeyer, E. A., Lynch, E. D., Welcsh, P., Szabo, C. I., Meza, J. E., Anderson, L. A., Dowd, P., Lee, M. K., Rowell, S. E., Ellison, J., Boyd, J., and King, M.-C. (1995). 22 genes from chromosome 17q21: Cloning, sequencing, and characterization of mutations in breast cancer families and tumors. Genomics 25: 256-263. Futreal, P. A., Cochran, C., Rosenthal, J., Miki, Y., Swenson, J., Hobbs, M., Bennett, L. M., Haugen-Strano, A., Marks, J., Barrett, J. C., Tavtigian, S. V., Shattuck-Eidens, D., Kamb, A., Skolnick, M., and Wiseman, R. W. (1994). Isolation of a diverged homeobox gene, MOX1, from the BRCA1 region on 17q21 by solution hybrid capture. Hum. Mol. Genet. 3: 1359-1364. Green, E. D., and Olson, M. V. (1990). Systematic screening of yeast artificial-chromosome libraries by use of the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 87: 1213-1217. Hall, J. M., Lee, M. K., Morrow, J., Newman, B., Anderson, L., Huey, B., and King, M.-C. (1990). Linkage of early onset breast cancer to chromosome 17q21. Science 250: 1684-1689. Miki, Y., Swensen, J., Shattuck-Eidens, D., Futreal, P. A., Harshman, K., Tavtigian, S., Liu, Q., Cochran, C., Bennett, L. M., Ding, W., Bell, R., Rosenthal, J., Hussey, C., Tran, T., McClure, M., Frye, C., Hattier, T., Phelps, R., Haugen-Strano, A., Katcher, H., Yakumo, K., Gholami, Z., Shaffer, D., Stone, S., Bayer, S., Wray, C., Bogden, R., Dayananth, P., Ward, J., Tonin, P., Narod, S., Bristow, P. K., Norris, F. H., Helvering, L., Morrison, P., Rosteck, P., Lai, M., Barrett, J. C., Lewis, C., Neuhausen, S., Cannon-Albright, L., Goldgar, D., Wiseman, R., Kamb, A., and Skolnick, M. H. (1994).

PHYSICAL MAP OF THE BRCA1 REGION Isolation of a strong candidate for the 17q-linked breast and ovarian cancer susceptibility gene, BRCA1. Science 266: 66-71. Narod, S. A., Feunteun, J., Lynch, H. T., Watson, P., Conway, T., Lynch, J., and Lenoir, G. M. (1991). Familial breast-ovarian cancer locus on chromosome 17q12-q23. Lancet 338: 82-83. Newman, B., Austin, M. A., Lee, M., and King, M.-C. (1988). Inheritance of breast cancer: Evidence for autosomal dominant transmission in high risk families. Proc. Natl. Acad. Sci. USA 85: 1-5. O'Connell, P., Albertsen, H., Matsunami, N., Taylor, T., Hundley, J. E., Johnson-Pais, T. L., Reus, B., Lawrence, E., Ballard, L., White, R., and Leach, R. J. (1994). A radiation hybrid map of the BRCA1 region. Am. J. Hum. Genet. 54: 526-534. Osborne-Lawrence, S., Welcsh, P. L., Spillman, M., Chandrasekharappa, S. C., Gallardo, T. D., Lovett, M., and Bowcock, A. M. (1994). Direct selection of expressed sequences within a 1-Mb region

273

flanking BRCA1 on human chromosome 17q21. Genomics 25- 248255. Riley, J., Butler, R., Ogilvie, D., Finniear, R., Powell, S., Anand, R., Smith, J. C., and Markham, A. F. (1990). A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res. 18" 2887-2890. Shepherd, N. S., Pfrogner, B. D., Coulby, J. N., Ackerman, S. L., Vaidynathan, G., Sauer, R. H., Balkenhol, T. C., and Sternberg, N. (1994). Preparation and screening of an arrayed human genomic library generated with the P1 cloning system. Proc. Natl. Acad. Sci. USA 91: 2629-2633. Silverberg, E., and Boring, C. (1990). Cancer statistics--1990. CA Cancer J. Physicians 40: 9-26. Tagle, D. A., and Collins, F. S. (1992). An optimizedAlu-PCR primer pair for human-specific amplification of YACs and somatic cell hybrids. Hum. Mol. Genet. 1: 121-122.